ID: 1147328358

View in Genome Browser
Species Human (GRCh38)
Location 17:39681176-39681198
Sequence TCTTATAAGCAGAAACACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 372}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147328354_1147328358 -7 Left 1147328354 17:39681160-39681182 CCGGCCTCCATCACTGTCTTATA 0: 1
1: 1
2: 2
3: 39
4: 361
Right 1147328358 17:39681176-39681198 TCTTATAAGCAGAAACACAAGGG 0: 1
1: 0
2: 1
3: 33
4: 372
1147328349_1147328358 29 Left 1147328349 17:39681124-39681146 CCAAAGTGCTGGAACCGCAGGTG 0: 2
1: 10
2: 309
3: 7327
4: 91555
Right 1147328358 17:39681176-39681198 TCTTATAAGCAGAAACACAAGGG 0: 1
1: 0
2: 1
3: 33
4: 372
1147328353_1147328358 -6 Left 1147328353 17:39681159-39681181 CCCGGCCTCCATCACTGTCTTAT 0: 1
1: 0
2: 6
3: 42
4: 371
Right 1147328358 17:39681176-39681198 TCTTATAAGCAGAAACACAAGGG 0: 1
1: 0
2: 1
3: 33
4: 372
1147328350_1147328358 15 Left 1147328350 17:39681138-39681160 CCGCAGGTGTGAGCCACTGCGCC 0: 2
1: 40
2: 193
3: 734
4: 2372
Right 1147328358 17:39681176-39681198 TCTTATAAGCAGAAACACAAGGG 0: 1
1: 0
2: 1
3: 33
4: 372
1147328352_1147328358 2 Left 1147328352 17:39681151-39681173 CCACTGCGCCCGGCCTCCATCAC 0: 1
1: 10
2: 114
3: 892
4: 4782
Right 1147328358 17:39681176-39681198 TCTTATAAGCAGAAACACAAGGG 0: 1
1: 0
2: 1
3: 33
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147328358 Original CRISPR TCTTATAAGCAGAAACACAA GGG Intronic
902358681 1:15928695-15928717 ACTGACAAGCAGAAACGCAAAGG + Exonic
904213909 1:28904595-28904617 CCTTATAAGAAGAGACACCAAGG + Intronic
908025555 1:59947926-59947948 TCTTAGTGGCAGAGACACAAGGG - Intergenic
908599843 1:65726778-65726800 TTTAATAACCAGAGACACAAAGG - Intergenic
909762243 1:79304934-79304956 TTTTATAAGTACAAAGACAAAGG - Intergenic
910097002 1:83534570-83534592 TCCAATAACCAGAAACTCAATGG + Intergenic
911895752 1:103433002-103433024 GCTTAAAGCCAGAAACACAAAGG + Intergenic
913086997 1:115448353-115448375 TCTTATTAGAAGAAACAGCATGG + Intergenic
914360404 1:146930863-146930885 TCTTATAAGCTGGAAGACAGAGG + Intergenic
914493343 1:148169034-148169056 TCTTATAAGCTGGAAGACAGAGG - Intergenic
914896897 1:151683593-151683615 TGTTAAATGGAGAAACACAATGG - Intronic
915381977 1:155450095-155450117 TTTTACAAGCCAAAACACAATGG - Intronic
915931178 1:160061915-160061937 TCATATATGCAGAGACACACAGG - Intronic
916486513 1:165264631-165264653 TCTTATAAGGTGAAACTAAAGGG + Intronic
918475010 1:184915144-184915166 TCTTATGACCAGTAAGACAAAGG - Intronic
918489855 1:185069940-185069962 CCTCATAAGCAGAAAATCAATGG - Intronic
918612132 1:186504796-186504818 TATTATAATCAGACTCACAAAGG - Intergenic
919145073 1:193623969-193623991 TGTTTTAATAAGAAACACAATGG + Intergenic
919185405 1:194140963-194140985 TCTTATAAGAAGACATACAAAGG + Intergenic
923463058 1:234223970-234223992 TCTTATAAGAAGAGACATCAGGG - Intronic
923910773 1:238440969-238440991 TATTATAAGGAAAAACACAGAGG + Intergenic
924209243 1:241747954-241747976 TCTAAAAGCCAGAAACACAAAGG + Intronic
924725590 1:246667265-246667287 ATAAATAAGCAGAAACACAAAGG - Exonic
924785788 1:247197929-247197951 TCTTATAAGGGGAATCAAAAAGG + Intergenic
1063039858 10:2326436-2326458 TCTAATAACCAGTATCACAACGG + Intergenic
1063511486 10:6648759-6648781 TCTTCTAAGCAGCATTACAATGG - Intergenic
1065232066 10:23608473-23608495 TATTCAAAGCAGAAAAACAAGGG - Intergenic
1066117089 10:32250116-32250138 CCTTATAAGAAGAGACACAGAGG + Intergenic
1066260207 10:33722385-33722407 TCTGATAATCTGAAAGACAAGGG + Intergenic
1067194526 10:44104592-44104614 TATTAAAAGCAGATACAAAATGG + Intergenic
1067973521 10:50997609-50997631 TCTGATAAGCAGATTCTCAATGG - Intronic
1068371117 10:56116726-56116748 TTTTATATGCAAAAACCCAAAGG - Intergenic
1068375852 10:56179582-56179604 TCGTAAAAGCAAAAACATAATGG + Intergenic
1069216453 10:65827309-65827331 TCTTAAAAGCAAAACCAAAAAGG - Intergenic
1072147780 10:92657955-92657977 TCTTGGAAGCAGAAAGACAGTGG + Intergenic
1072241423 10:93498414-93498436 TGTTATCAACAGAAACACATAGG + Intronic
1072379222 10:94850077-94850099 TCTTGTACCCTGAAACACAAAGG - Intronic
1073632367 10:105161606-105161628 TTTTGCAAGCAGAAACACTAGGG + Intronic
1073737956 10:106371607-106371629 TCTAAGCAGCAGAAATACAATGG + Intergenic
1074862310 10:117519838-117519860 TCATATATGTAGAAACTCAAAGG - Intergenic
1076592452 10:131594181-131594203 TCTTCTAAGCTAAGACACAAGGG - Intergenic
1076592769 10:131598882-131598904 TCTTCTAAGCTAAGACACAAGGG - Intergenic
1078407403 11:11082406-11082428 CCTTATCAGAAGATACACAACGG + Intergenic
1078486545 11:11728442-11728464 TATTATGAGCAGAATCTCAATGG - Intergenic
1078809203 11:14741473-14741495 TCTCATATGCAAAAACACATAGG - Intronic
1079211110 11:18461453-18461475 ACTTCTAAGCACTAACACAAAGG + Intronic
1079288096 11:19158410-19158432 TCATATAAAAAGATACACAAAGG - Intronic
1079414730 11:20223180-20223202 ATTTATAGGCAGAAAGACAAAGG - Intergenic
1079414776 11:20223562-20223584 TGTAATAAGCAGAAAGACAAGGG - Intergenic
1080444336 11:32324103-32324125 TTTTATAATCAGAAAAATAAAGG + Intergenic
1080936806 11:36871871-36871893 TCCTATGAGCAAAAACACAAGGG - Intergenic
1080979355 11:37381489-37381511 TCTTATAAAAAGAGACATAAAGG + Intergenic
1081584941 11:44377718-44377740 CCTTATAAGAAGAGACACCAGGG + Intergenic
1082681589 11:56179565-56179587 GCTTATATACAGAAATACAATGG + Intergenic
1082960433 11:58914181-58914203 TGTTAAAAGCAGAAACAGCATGG - Intronic
1082980373 11:59115338-59115360 TGTTAAAAGCAGAAACAGCATGG - Intronic
1084036501 11:66514573-66514595 TCTTATACACATAGACACAAGGG - Exonic
1084811681 11:71615754-71615776 TATTAGAGGCAAAAACACAAGGG + Intergenic
1085730375 11:78992814-78992836 TCTTATAATGAGAAAAGCAAAGG - Intronic
1085740236 11:79072101-79072123 TCTGAGAAGCAGGACCACAAGGG + Intronic
1086029228 11:82333421-82333443 GCTTATAAACTGAAACACACTGG - Intergenic
1086113894 11:83227085-83227107 TCTTATAAGCAGAAAAGGAGAGG + Intronic
1086259023 11:84915269-84915291 TATTATAATCAGAAAAATAATGG - Intronic
1086284901 11:85236463-85236485 CCTTATAAGAAGATACACCAGGG - Intronic
1087205074 11:95386014-95386036 TCTTACAAGCAGATACAACAAGG - Intergenic
1087300215 11:96424403-96424425 TCTTAAAACCAGAGACTCAAGGG - Intronic
1087942700 11:104118274-104118296 CCTTATAAGAAGAGACACAAGGG + Intronic
1088487864 11:110358417-110358439 TCTTATCAGTAGAAAAAGAAGGG + Intergenic
1090527331 11:127551520-127551542 TCTTAGAAGAAGAAAAACAATGG - Intergenic
1091713991 12:2763545-2763567 TCTCAAAAGGAGAATCACAAGGG + Intergenic
1091956947 12:4653082-4653104 TCATGTAAGTAGAAACAAAAAGG - Intronic
1092026943 12:5248746-5248768 TCTTATAGGCAGAAAAATCAAGG + Intergenic
1093683904 12:22034500-22034522 TCTTATTAACAGAAATAAAAAGG + Intergenic
1094023590 12:25940265-25940287 TCTTATCTGCAAAAACAGAAGGG - Intergenic
1095697524 12:45157987-45158009 TATTAGAAGCAATAACACAAGGG - Intergenic
1096576135 12:52553956-52553978 TCTTATTAGCAGATACACATTGG - Intergenic
1097585610 12:61512385-61512407 TCTTATGAACTGAAACACACTGG + Intergenic
1098165556 12:67694031-67694053 TCTCAAAAGGAGAAACTCAACGG + Intergenic
1098745018 12:74225078-74225100 ACTTATAAGTAAGAACACAAAGG + Intergenic
1098932580 12:76437154-76437176 TCCTAGAAGCATAAAAACAAAGG + Intronic
1099250014 12:80242932-80242954 TCTTAGAAGCAGAAACAGGACGG - Intronic
1099431878 12:82596115-82596137 TCTTATAAATAGCAACACAAGGG + Intergenic
1100048791 12:90418224-90418246 TCTTCTGAGCATATACACAAAGG + Intergenic
1100408707 12:94293918-94293940 CCTTATAAGAAGAGACACCAGGG - Intronic
1101579044 12:106025285-106025307 TCTTATATGAAGAGACACCAGGG + Intergenic
1103676513 12:122660269-122660291 TTTTATAAGTCCAAACACAAGGG + Intergenic
1103859217 12:123998569-123998591 ACTTTTAAGCTGAAACCCAAAGG - Intronic
1103966718 12:124644698-124644720 TTTTAGAAGCAGAAACCCAGGGG + Intergenic
1104136575 12:125945320-125945342 TCTTAAAAGCAGAACCAAAGAGG + Intergenic
1105603376 13:21907449-21907471 TCTTTTCAGCAGATACTCAAAGG - Intergenic
1106317988 13:28612120-28612142 ACTTACAAGTAAAAACACAATGG - Intergenic
1108480890 13:50870287-50870309 TCTTAAAAGCAGAGACCGAAGGG + Intergenic
1108982103 13:56527803-56527825 GCTTCTAAGAAGAAACACACAGG - Intergenic
1109112307 13:58336861-58336883 TCTCAGAAGTAGACACACAAAGG - Intergenic
1109361224 13:61297975-61297997 TATTATATTTAGAAACACAAAGG - Intergenic
1110025228 13:70529382-70529404 AAATAAAAGCAGAAACACAAAGG - Intergenic
1110459121 13:75724671-75724693 TCTTCTAAGGAGAAAAACAATGG - Intronic
1110910809 13:80960368-80960390 TTTTTTAAGCTGAAACTCAAAGG - Intergenic
1112144698 13:96685721-96685743 TCTTAAACACAGACACACAATGG + Intronic
1112554301 13:100452474-100452496 TCTTAGTAGAAGAAAAACAAGGG - Intronic
1114127903 14:19751992-19752014 TCTTATATGCTGAAAAGCAAGGG - Intronic
1114703262 14:24700185-24700207 TCCTAAAAGCAGAAGCACATGGG - Intergenic
1115129448 14:30037019-30037041 ACTTAAAAGAAGAAACTCAAGGG - Intronic
1115506999 14:34102255-34102277 TCTTCTAAGAAGAAAGAAAATGG + Intronic
1115718824 14:36137135-36137157 ACATTTGAGCAGAAACACAAAGG + Intergenic
1116570984 14:46514849-46514871 TCTTATAAGGAAATACAAAAGGG + Intergenic
1117439455 14:55746171-55746193 GCTTGTAAGCAGAAACACTAAGG + Intergenic
1118491871 14:66269041-66269063 TCCTGAAAGGAGAAACACAAAGG + Intergenic
1119118957 14:72055124-72055146 TCCTCTAAGCATAGACACAAGGG - Intronic
1120283299 14:82465726-82465748 TCTTAAATGCAGACACACACAGG + Intergenic
1121280013 14:92691360-92691382 CCTTATAAGAAGAGACACCAGGG - Intergenic
1122665257 14:103325401-103325423 CCTTATAAGAAGAGACACAGAGG + Intergenic
1123181574 14:106476236-106476258 TAGCAGAAGCAGAAACACAAAGG - Intergenic
1202945330 14_KI270726v1_random:20493-20515 TAGCAGAAGCAGAAACACAAAGG + Intergenic
1124099699 15:26682097-26682119 TCTTATAAGGACAAACCTAAGGG - Intronic
1124722740 15:32124822-32124844 CCTTATAAGAAGAGACACAAGGG + Intronic
1126648104 15:50895061-50895083 TCTTATCAGCAGAACCACAGAGG - Intergenic
1127394293 15:58531257-58531279 CCTTAAAAGAAGATACACAAAGG - Intronic
1128004154 15:64222386-64222408 TCTTCTAAGGAGAAAAAAAACGG - Intronic
1128934306 15:71732275-71732297 TATTATTAACAGAAACAAAAGGG - Intronic
1129200986 15:73999570-73999592 TCGCAAATGCAGAAACACAATGG - Intronic
1129758829 15:78115642-78115664 GCTTAGGAGCAGAAACAAAAGGG + Intronic
1129926962 15:79373069-79373091 TGCTAAAACCAGAAACACAAGGG - Intronic
1131759637 15:95607266-95607288 CTTTATAAGCAGAAAACCAAAGG + Intergenic
1131872545 15:96777109-96777131 TCTCAAAAGCAGAAAGCCAATGG - Intergenic
1135001911 16:18783852-18783874 GCTTTAAAGCAGAAAAACAAGGG + Intronic
1136014431 16:27386303-27386325 CCTTATAAGAAGAGACACCAGGG - Intergenic
1136715103 16:32273638-32273660 TTTTCTAAACAGATACACAAAGG + Intergenic
1136752812 16:32656093-32656115 TTTTCTAAACAGATACACAAAGG - Intergenic
1136815302 16:33214272-33214294 TTTTCTAAACAGATACACAAAGG + Intronic
1136821778 16:33324352-33324374 TTTTCTAAACAGATACACAAAGG + Intergenic
1136828341 16:33380891-33380913 TTTTCTAAACAGATACACAAAGG + Intergenic
1136833407 16:33479663-33479685 TTTTCTAAACAGATACACAAAGG + Intergenic
1137002585 16:35242601-35242623 TCTCATAGACAGAAACAGAAAGG + Intergenic
1138167975 16:54820457-54820479 TCTTAGAAGCGCAAAGACAAGGG - Intergenic
1141474531 16:84263823-84263845 GTGTAAAAGCAGAAACACAAAGG - Intergenic
1202993879 16_KI270728v1_random:37247-37269 TTTTCTAAACAGATACACAAAGG + Intergenic
1203011509 16_KI270728v1_random:244858-244880 TTTTCTAAACAGATACACAAAGG - Intergenic
1203054949 16_KI270728v1_random:916131-916153 TTTTCTAAACAGATACACAAAGG - Intergenic
1143068690 17:4270842-4270864 TTTTTTAAGCAGAAATAAAATGG - Exonic
1143653876 17:8281714-8281736 TCTCAAAAGCAAAAACAAAAAGG - Intergenic
1144315887 17:14060821-14060843 TCTTACAAGGAGAATCACTAAGG - Intergenic
1144445025 17:15318972-15318994 TCTTATAAGGACACACACACAGG - Intronic
1146788507 17:35738169-35738191 TCTTGAAAAGAGAAACACAAAGG - Intronic
1147328358 17:39681176-39681198 TCTTATAAGCAGAAACACAAGGG + Intronic
1148248820 17:46055697-46055719 TCTGATAAGCAAAAATACAGGGG + Intronic
1149109731 17:53013725-53013747 TCTTATAATCTGAAATACATAGG + Intergenic
1149526405 17:57359383-57359405 TCTTAAAGTCAGAAAGACAAAGG + Intronic
1149977136 17:61277700-61277722 TCTTCAAAGAAGATACACAATGG + Intronic
1150453424 17:65288186-65288208 CCTTATAAGAAGAGACACATGGG + Intergenic
1150468587 17:65416457-65416479 TCTTATAATGAAAAGCACAAAGG + Intergenic
1151240584 17:72754637-72754659 CCTCCTAAGCAGAAACACCAGGG + Intronic
1152931182 17:83110840-83110862 TCATAGAGGCAGAAACAGAACGG - Intergenic
1154072351 18:11164017-11164039 ACTGATAAGCACAGACACAAAGG + Intergenic
1154364685 18:13696749-13696771 GCTTATAAGCATAAAAATAAAGG + Intronic
1156055778 18:33000570-33000592 TCTTAAAAGCAGCAAGAGAAAGG + Intronic
1156417802 18:36916270-36916292 TCTAAGAAACAGAAAGACAAAGG - Intronic
1156440147 18:37177485-37177507 TCTTACACACAGACACACAAAGG - Intronic
1156977093 18:43236340-43236362 TCTAATAAGCAAAATCTCAAAGG - Intergenic
1158538033 18:58325650-58325672 TAATATAATCAGAAACACATGGG + Intronic
1158740581 18:60137315-60137337 TTTTAAATGCTGAAACACAAAGG - Intergenic
1159576052 18:70179453-70179475 TCTTCTAAGCATAAAAAAAATGG + Intronic
1160220039 18:76968718-76968740 TCTTATAACCAGAAACATGAAGG - Exonic
1162706866 19:12561597-12561619 CCTTATAAGAAGAGACACCAGGG + Intronic
1167568527 19:50272257-50272279 ACTTAGAATCAGAAACAGAAGGG + Intronic
925444198 2:3913815-3913837 TCTTATAAGCATAATTACCAAGG + Intergenic
925666879 2:6266662-6266684 TCATCCAAGCTGAAACACAAAGG + Intergenic
926832967 2:16984236-16984258 TCTTTTGAGAAGAAACAGAAAGG - Intergenic
926885891 2:17598337-17598359 ACTTAGAACCAGAAAAACAAAGG - Intronic
927369258 2:22335771-22335793 CCTTTTAAGAAGAGACACAAAGG + Intergenic
928732888 2:34253140-34253162 TCTTAAAAGAAGAACCACTAAGG - Intergenic
930545403 2:52761280-52761302 TCTTATTAGCTGTAAGACAATGG + Intergenic
932458924 2:71869689-71869711 TCTTAGAAGCAGAAAGACTGGGG + Intergenic
933558116 2:83857018-83857040 TCTTATAAGCAGATACTCTGTGG - Intergenic
936406936 2:112213293-112213315 TCTTATAAGCATAACCACTGGGG - Exonic
937118953 2:119428968-119428990 TGTTAAAAGCAGAAACAGCATGG - Intergenic
937816715 2:126258755-126258777 TTTTATAAGTAGAAATACAAAGG + Intergenic
939334276 2:140805098-140805120 TCTAATAATCAGAAAAACATTGG - Intronic
939664062 2:144928719-144928741 TCTTAGAAACAGAAAGAAAAAGG - Intergenic
939747601 2:145995166-145995188 TCTTAAAAGCAGAGAGACTAAGG + Intergenic
941237377 2:162992157-162992179 TCTTATAATGAGAAAAACTAGGG - Intergenic
941414213 2:165198865-165198887 TGTCACAAGCAGAAACACCAAGG + Intronic
941982022 2:171468971-171468993 CCTAATAAGAAGAAACAGAAAGG + Exonic
943170978 2:184399171-184399193 CCTTATGATCAGGAACACAAGGG - Intergenic
943794432 2:191974018-191974040 TCTTATTAGCAGAATGAGAATGG + Intronic
943904665 2:193483540-193483562 TCCTATAAACAGAATCAGAATGG - Intergenic
944057970 2:195543460-195543482 CCTTATAAGAAGAAACATGAGGG - Intergenic
944139733 2:196442946-196442968 TCTGATAAACCGAAACAGAAAGG + Intronic
945480141 2:210336029-210336051 TCTTAAAAGCAGTAAAAGAAAGG - Intergenic
945687440 2:212988830-212988852 TCTTATATGGAGGAAAACAATGG - Intergenic
946578165 2:221099077-221099099 TTTTATAAGCATGAAGACAATGG + Intergenic
947027234 2:225750099-225750121 TCTTATAAGAAGAGATACAAGGG + Intergenic
1169620750 20:7503966-7503988 TCTTTTAAGTAGACACTCAAAGG - Intergenic
1170772814 20:19348865-19348887 TATAAGAAGCAGATACACAATGG - Intronic
1171282298 20:23910985-23911007 TCTCATGGGCAGAAACAGAAGGG - Intergenic
1172187055 20:33037421-33037443 TCTTATTAAGAGAACCACAATGG - Intronic
1172911948 20:38416099-38416121 CCTTATAAGAAGAGACACCAGGG + Intergenic
1173156633 20:40618213-40618235 TTTTATAAGCATAAACACCCAGG - Intergenic
1173334846 20:42104165-42104187 TCTTATAAGAAGAAACATGTAGG + Intronic
1173966065 20:47113783-47113805 TCTGAAAAGCAGAAACATTATGG - Intronic
1174636430 20:52004633-52004655 TTTTTTAAGCAGAATCACACAGG + Intergenic
1174794906 20:53513909-53513931 TCTAATCAGCAGAAAGAGAATGG - Intergenic
1174887591 20:54352716-54352738 TCATACAAGAAGAAACACCAGGG - Intergenic
1175645676 20:60669088-60669110 TCTTATAAAAATAAACATAATGG - Intergenic
1176789120 21:13297443-13297465 TATTATAAGCAGATAAACAAAGG + Intergenic
1177105648 21:16952249-16952271 TCTTAAAAGAAGACACACAAAGG + Intergenic
1177107629 21:16979572-16979594 TTTTATAAGCAGAAGCAAGAGGG + Intergenic
1177343794 21:19841533-19841555 TTTTCTAAAGAGAAACACAACGG + Intergenic
1177704247 21:24679544-24679566 ATTTATAAGCAGATATACAAAGG + Intergenic
1177857739 21:26418797-26418819 TCTTATAAGAAGAAACATAAGGG + Intergenic
1178596142 21:33954621-33954643 CCTTATAAGAAGAGACACCAGGG - Intergenic
1179048511 21:37868744-37868766 TATTCTAAGCAGAATTACAAAGG + Intronic
1182206956 22:28637439-28637461 TATTTTAAGCTGATACACAATGG - Intronic
1184410597 22:44323832-44323854 ATTTAAAAGCAGAAACACCAAGG - Intergenic
1184509412 22:44924522-44924544 TCTTATAAGAAGAGACACGAGGG + Intronic
1184571768 22:45329520-45329542 TAACATAAGCAGACACACAAAGG - Intronic
949126941 3:457409-457431 TTATGTAAGCAGAAAAACAAAGG - Intergenic
950944727 3:16933337-16933359 TCTTTAGAGGAGAAACACAAAGG - Intronic
950986444 3:17374282-17374304 TCATATTGGCAGATACACAAAGG - Intronic
951279958 3:20736004-20736026 TCTTAAAACCAGAAGTACAAGGG + Intergenic
952637805 3:35552892-35552914 TCTGAGCAGCAGTAACACAATGG - Intergenic
953529138 3:43723637-43723659 TCTAATAAGTAAAAACACACAGG + Intronic
955825221 3:62938973-62938995 CCTTATAAGAAGAGACACAGAGG - Intergenic
956293582 3:67688102-67688124 TGTTATAAGCAACAAAACAATGG + Intergenic
958052079 3:88361520-88361542 TTTTAAAAGCAGCAAGACAAAGG - Intergenic
958172663 3:89957568-89957590 TCTAGTTAGCAGAATCACAAAGG - Intergenic
958454402 3:94311516-94311538 TCAAATAATCTGAAACACAAAGG - Intergenic
958670816 3:97201803-97201825 TGTTATATGCAGCAACACATAGG + Intronic
959102071 3:102022122-102022144 TATTATAAGCAGAAATGCAAAGG - Intergenic
959608112 3:108264132-108264154 CCTTATAAGAAGAGACACAGAGG + Intergenic
959784189 3:110273839-110273861 CCTTATAAGAAGAGACACCAGGG - Intergenic
960284868 3:115816695-115816717 TCAATTAAGAAGAAACACAAAGG + Intronic
960368155 3:116799888-116799910 TGTTAAAAGCCTAAACACAAAGG + Intronic
960983859 3:123258388-123258410 TTTTATAATCAGAAAAAAAAAGG + Intronic
961429285 3:126869559-126869581 TCTCAAAAGAAGAAATACAAAGG - Intronic
961617126 3:128191693-128191715 TCATATAAGCAGAATCATACAGG + Intronic
961933524 3:130558767-130558789 TTTTATAAGCAAAAATAAAAAGG + Intergenic
963145035 3:141984778-141984800 TCTTATTTGCAGAAATACACTGG - Intronic
963241880 3:143012320-143012342 TCTGATGAGGAGAATCACAAAGG - Exonic
964355012 3:155842516-155842538 TAGTAAAAGAAGAAACACAAGGG - Exonic
964623585 3:158738587-158738609 CCTTATAAGAAGAGACACAGAGG - Intronic
965732921 3:171791849-171791871 AACTATAAGCATAAACACAATGG + Intronic
965936349 3:174117732-174117754 GCTGATAGGCAGCAACACAATGG - Intronic
965955906 3:174368811-174368833 TCTTAAAAGTAGAAAGATAAAGG + Intergenic
966236019 3:177702435-177702457 TTTGAGAAGCAGAAACACCAAGG + Intergenic
970005674 4:11408671-11408693 CATTAGAAGCAGAAACACACTGG + Intronic
970952514 4:21773824-21773846 TCTTACATGCAGAAACACACAGG - Intronic
972466775 4:39365255-39365277 TTTTTTGAGAAGAAACACAAAGG + Intronic
973561079 4:52136424-52136446 TCTTTTAAGCATAATCACACCGG + Intergenic
973820067 4:54655273-54655295 TCTTATAACCAGAAAGTCCAGGG - Intergenic
974281208 4:59796331-59796353 TCTTTTAAGGAAAAAGACAATGG - Intergenic
975661266 4:76690692-76690714 TTTTATAATCAGAAAAAAAAAGG - Intronic
976694105 4:87899888-87899910 TCTGACAAGAAGAAACAGAATGG + Intergenic
977381151 4:96275159-96275181 TCATATAAGGAGAAACACTAAGG + Intergenic
977732619 4:100372404-100372426 TCTTACATAAAGAAACACAATGG - Intergenic
978691677 4:111520195-111520217 CCTTAAAAACAGAAACAAAAAGG - Intergenic
978896616 4:113896008-113896030 TCTTCTAGGCAGAAAGAGAAAGG + Intergenic
979326783 4:119389635-119389657 TCTTATATGCAGTCACACCATGG - Intergenic
979891720 4:126105749-126105771 TCTTATTGGCAGCAACAAAATGG - Intergenic
979963067 4:127044590-127044612 ACTTATAAGAAGAAAAACTAAGG - Intergenic
982631535 4:157835772-157835794 TATTATAAGCAGGAAAACTATGG + Intergenic
982644202 4:158002475-158002497 TCTTAGAAGCAGAAGTAGAATGG + Intergenic
982712966 4:158776729-158776751 CATTAAAAGCAGAGACACAATGG - Intronic
982718559 4:158835939-158835961 TCCTAAAAGCAGTAACAGAAAGG - Intronic
983380752 4:166989950-166989972 TCTTATAAGTAGAAAGGGAAGGG + Intronic
983990038 4:174107490-174107512 TCTTATAAGCAGAAAAATATTGG - Intergenic
984949436 4:184995950-184995972 TCTTAGGAGCAGAAACTAAATGG + Intergenic
986239089 5:5940929-5940951 TCTCACAATAAGAAACACAAAGG - Intergenic
987045881 5:14107714-14107736 TCCTATAAACAGAAACATACAGG + Intergenic
987388756 5:17355235-17355257 TTTTATAAAAAGAAACATAAAGG + Intergenic
988088183 5:26498810-26498832 CCTTATAAGAAGAGACACAAAGG + Intergenic
988221497 5:28352282-28352304 TCTTAAAAGAAGACATACAAAGG + Intergenic
988893332 5:35644142-35644164 TTTTGTAAGAAGAACCACAAAGG + Intronic
989094877 5:37772504-37772526 TCTTATAGGCAGAAAACCAGAGG - Intergenic
989304265 5:39933648-39933670 TCTTAATAGCAGAAAGACCAAGG - Intergenic
989572539 5:42957986-42958008 TGTTGTAAGCAGGAACCCAAAGG - Intergenic
989806797 5:45618319-45618341 TGTGATAAGCAGAAGCACAGAGG + Intronic
990026618 5:51199326-51199348 TCTTATAAGTAGAAAGATCAAGG - Intergenic
990675749 5:58182738-58182760 TGTTATAAGCAGTCACATAATGG - Intergenic
992158950 5:73981974-73981996 TCTCATCAGCAGAAACAAGAAGG - Intergenic
992345386 5:75870754-75870776 TCTTAAAAGCATAAAGAGAACGG + Intergenic
992622899 5:78611054-78611076 TGCTATAAGCAGACAGACAAAGG + Intronic
992671309 5:79063751-79063773 CCTTATCTGCAGAAACACAATGG - Exonic
992821875 5:80505726-80505748 TCTTATAGGAAGAAAGAAAAGGG - Intronic
993168706 5:84387876-84387898 CCTTATAAGAAGAGACACCAAGG + Intergenic
993556956 5:89351834-89351856 TCTCATGAGCAGATACAAAATGG + Intergenic
993582800 5:89683887-89683909 TCTCAAAAGAAGACACACAAAGG + Intergenic
993666383 5:90703144-90703166 TATTATAAAAAGAAATACAAAGG - Intronic
993876232 5:93310598-93310620 TCTTTTATGAAGCAACACAATGG - Intergenic
994512479 5:100722613-100722635 TCTTAAAAGGAGAAGCACTAGGG + Intergenic
994817573 5:104603828-104603850 TCTCAAAAGAAGAAAAACAATGG + Intergenic
995704112 5:114968071-114968093 TCTTCTAAGCATATACCCAAAGG + Intergenic
996154208 5:120077916-120077938 TGTTGTAATAAGAAACACAAAGG - Intergenic
996256797 5:121414245-121414267 TCAGCTAAGCAGAAACAAAATGG - Intergenic
996364714 5:122688878-122688900 TCTTATAACCATAAATTCAATGG - Intergenic
998752511 5:145338852-145338874 TATTAAAAGCATGAACACAAGGG - Intergenic
999035189 5:148341236-148341258 ACTTATAAGCAGAAACCTGAAGG + Intergenic
1000666366 5:164002817-164002839 TCATATAATCAGAAACTCAGTGG + Intergenic
1001204216 5:169746868-169746890 TTTTATAATCAGAGAAACAAAGG + Intronic
1001895510 5:175376567-175376589 GCTTATAGGCAGAGCCACAATGG - Intergenic
1002067724 5:176660561-176660583 TCAGATATGCAAAAACACAAGGG + Intergenic
1002554726 5:180027387-180027409 GAGTATAAGCAGAAACAGAAAGG + Intronic
1002798731 6:500366-500388 GCTCAAAAGCAGAAACACACAGG + Intronic
1003317799 6:5027571-5027593 TTTTATCAGCAGAAAGAAAAAGG - Intergenic
1003971837 6:11307554-11307576 TCTTATAAGCACAGACACCTTGG - Intronic
1004096718 6:12562274-12562296 TCTTATAAAACGTAACACAAAGG + Intergenic
1008205088 6:48645589-48645611 TCTTATAAGAAGGAACATCAGGG - Intergenic
1008215906 6:48788406-48788428 TATTTTAAGCAAAAACAAAATGG - Intergenic
1009025921 6:58000329-58000351 CCTTGTAAGAAGAAACACCAGGG + Intergenic
1009201476 6:60751796-60751818 CCTTGTAAGAAGAAACACCAGGG + Intergenic
1009428832 6:63543908-63543930 TCTTAAAAACAGAATAACAAGGG - Intronic
1009619444 6:66053944-66053966 TTTTATTTGCAGAAACAAAATGG - Intergenic
1009715218 6:67384203-67384225 TTTTAAAAGCAGAAACAAAAAGG + Intergenic
1009769801 6:68130897-68130919 TCTCATAAGAAGACATACAAAGG - Intergenic
1009847058 6:69146971-69146993 ACTGATAAGCAGAAATTCAAAGG - Intronic
1009940935 6:70287144-70287166 TATTATAAGCAGAGACACGGAGG + Intronic
1010353005 6:74898444-74898466 TCCTAAAAGCAGAAAGAAAAAGG - Intergenic
1011038973 6:83010020-83010042 TCATATCATCAGAATCACAAAGG + Intronic
1011525126 6:88255869-88255891 TCTCATGTGCAGAAACACACAGG + Intergenic
1012944910 6:105455043-105455065 TCTTTTAAGCAGAAAGGGAAAGG + Intergenic
1013765574 6:113571067-113571089 TCTTAGAAGAAGAAAAACTAAGG - Intergenic
1013887052 6:114980686-114980708 TTATATGAGCAGAAACACAGTGG + Intergenic
1014929400 6:127316511-127316533 AAAAATAAGCAGAAACACAAAGG + Intronic
1015004855 6:128267075-128267097 ACAAATAAGCAGAAACAAAAAGG + Intronic
1017736794 6:157372400-157372422 TCTTAAAAACACACACACAAAGG + Intergenic
1018018950 6:159739895-159739917 TTTTATGTGCAGAAAGACAAAGG - Intronic
1018716110 6:166533780-166533802 TCTTATAATCAGAAAACAAAGGG + Intronic
1018876187 6:167825547-167825569 TTTTCTAAGGAGACACACAAAGG + Intergenic
1020601301 7:10277552-10277574 TCTTAAAACCTGAAACAAAAAGG + Intergenic
1020654459 7:10912742-10912764 TCATATAAGCTGAAACCTAAAGG - Intergenic
1020879338 7:13739285-13739307 TCAGATAAGCAGAGACAAAAAGG + Intergenic
1022462635 7:30625617-30625639 TCTTATAACCTGAAACTGAATGG + Intronic
1023100492 7:36713088-36713110 TCTCACATGCAGAAACACATAGG + Intronic
1023117097 7:36873260-36873282 TCTCATGAGCAGAAACAGAGGGG + Intronic
1023297066 7:38726379-38726401 TCTCATATTCAGAAACACTAAGG + Intronic
1023365784 7:39461785-39461807 TCTTATAAGAAAAAACAGTAGGG - Intronic
1023462024 7:40408880-40408902 TTTTATGAACAGATACACAAAGG + Intronic
1024373605 7:48613555-48613577 TTTTCTAAGCAGAAAAGCAATGG - Intronic
1027455407 7:78385291-78385313 TCTTTTAAACATTAACACAATGG + Intronic
1028173488 7:87627943-87627965 GCTAATAAACAGCAACACAATGG - Intronic
1028569195 7:92267441-92267463 CCTTATATGAAGAACCACAATGG - Intronic
1028834416 7:95358529-95358551 TCTTATAGTCAAAATCACAATGG + Intergenic
1029226285 7:99030828-99030850 TATTAGAAGCAGAAAAACACAGG - Intronic
1030251816 7:107454543-107454565 CCTTATACTAAGAAACACAAAGG - Intronic
1030621080 7:111791869-111791891 TCTGTTAAGAAAAAACACAAGGG - Intronic
1030858670 7:114595326-114595348 TTTTATTACCAGAAACAGAAGGG + Intronic
1031260880 7:119518491-119518513 TCTTGTTAACAGCAACACAATGG + Intergenic
1031487329 7:122343714-122343736 TATTCTAAGAAGAAACATAATGG + Intronic
1031782304 7:125984211-125984233 TCATATGAACAGAAACAAAAAGG - Intergenic
1032306824 7:130741871-130741893 TCTTATAAGCAGAAATAAGAAGG - Intergenic
1034057607 7:148052162-148052184 CCTTGTAAGCATAAATACAAAGG + Intronic
1036222493 8:6932254-6932276 TCTTACAAGCAGAACCAGAATGG - Intergenic
1037006044 8:13781334-13781356 TTTTGTAAGCAGGAACACAAAGG + Intergenic
1038151864 8:24949161-24949183 CCTTATAAGCTGGACCACAAAGG + Intergenic
1038288665 8:26228648-26228670 GCTGATAAGCAGAGGCACAACGG - Intergenic
1040446281 8:47498132-47498154 TCTTATAAGAAAACACACATCGG - Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041076333 8:54173479-54173501 TCTTATACACACACACACAAAGG - Intergenic
1042034035 8:64510322-64510344 TCTTCTAAGCAAAAATAAAATGG - Intergenic
1042808750 8:72800741-72800763 TGTTATAATAATAAACACAACGG - Intronic
1044325113 8:90849934-90849956 TCTTCAAAGCAGAAAGATAAGGG + Intronic
1045904110 8:107322660-107322682 TGAAATAATCAGAAACACAAAGG + Intronic
1046236558 8:111431048-111431070 TCTAATAAGGAAAAAGACAAAGG + Intergenic
1047417700 8:124678872-124678894 TATTTTCAGCAGAAACACACAGG + Intronic
1048963312 8:139597496-139597518 TCATATCAGCAGAACCACATTGG + Intergenic
1049161085 8:141098294-141098316 TCTCAGAAGAAGACACACAATGG - Intergenic
1050701140 9:8340308-8340330 TCTTATGAGGAGACACACAAGGG + Intronic
1050934491 9:11377978-11378000 TAGTGTAAGCAGAGACACAATGG + Intergenic
1052167637 9:25352652-25352674 TCTTTTTAGAGGAAACACAATGG - Intergenic
1053336544 9:37278688-37278710 TCTTATAAATAGTAACAGAAAGG + Intronic
1054706264 9:68465376-68465398 TCTAAAAAGAAGAAACAAAATGG - Intronic
1055380431 9:75700749-75700771 TTTTATGAGCAGAAAGACCAAGG - Intergenic
1055624600 9:78162775-78162797 TCTGGAAAGCAGATACACAAGGG + Intergenic
1055696091 9:78885985-78886007 ACTTACAAGAAGAAACTCAATGG - Intergenic
1055709758 9:79047947-79047969 TGTTAAAAGCAGAAATAAAAAGG - Intergenic
1055834941 9:80428684-80428706 TCTTTTCAGCAAATACACAACGG - Intergenic
1055898893 9:81211948-81211970 TATTATAAAAATAAACACAAGGG + Intergenic
1056000744 9:82213919-82213941 TCTTAAAAGCAAATACACAGTGG + Intergenic
1060330552 9:122665223-122665245 TCTTAAAAGCAGAAACCCAGAGG + Intergenic
1060337556 9:122740448-122740470 TCTTATTTGCATAAATACAAAGG - Intergenic
1061522530 9:131127885-131127907 TCATGTAAGGAGAAATACAAAGG - Intronic
1203734437 Un_GL000216v2:122423-122445 TATTATAGGCAGAAACAAGAAGG - Intergenic
1185872358 X:3674530-3674552 TCTTATAAGAAGAGACACACAGG + Intronic
1185936258 X:4260786-4260808 CCTTATAAGAAGAGACACAGGGG - Intergenic
1186178282 X:6948010-6948032 TCTTAAAAGGAAAAACAAAAAGG + Intergenic
1187632088 X:21184381-21184403 TCTTAAAAGAAGACACACAATGG - Intergenic
1187652939 X:21430343-21430365 TCTTATAAGTAAAAATCCAAAGG - Intronic
1188368330 X:29337497-29337519 TATAATAAGCATAAACTCAAGGG - Intronic
1190104031 X:47545754-47545776 TATAAAAAGAAGAAACACAATGG + Intergenic
1191152637 X:57236633-57236655 TCTTAAAAGAAGACATACAAAGG - Intergenic
1191229436 X:58082425-58082447 TATTCTAAGAAGAAAGACAAAGG + Intergenic
1192992697 X:76477885-76477907 TCTTATAAGCAGCAGATCAATGG + Intergenic
1193025262 X:76839896-76839918 TTTTATTAGCAGAATCAGAATGG - Intergenic
1193873424 X:86830505-86830527 CCTTGTAAGCAGACACATAAAGG + Intronic
1193982068 X:88193889-88193911 TCTTAAAAGAAGACATACAAAGG + Intergenic
1194348609 X:92796651-92796673 TCTTATAGGCAGCAGCTCAATGG - Intergenic
1195137757 X:101927400-101927422 TCTTATAAACTGAAAAACTAAGG - Intronic
1195614020 X:106898637-106898659 ACTTACAAACAGAAACAGAATGG + Intronic
1196636432 X:118008017-118008039 ACTGATAACCAGAAAGACAAAGG + Intronic
1197012280 X:121580436-121580458 TTATAAAAGCAGAAACACATTGG - Intergenic
1197228723 X:123980045-123980067 TTTGAGAAGCAGAAACAAAAAGG - Intronic
1199247866 X:145627317-145627339 TCTTATAAGCTGGAAGAGAATGG + Intergenic
1199261205 X:145777885-145777907 TCTAATAAGCAGAAACTTTAGGG + Intergenic
1200656936 Y:5913279-5913301 TCTTATAGGCAGCAGCTCAATGG - Intergenic
1200791548 Y:7304151-7304173 TCTTATAAGAAGAGACACACAGG - Intergenic
1201720611 Y:17093013-17093035 CCTTATAAGAAGAGACACAGGGG - Intergenic
1201947226 Y:19524361-19524383 TCTTATCTTCAGAAAGACAAAGG - Intergenic