ID: 1147331895

View in Genome Browser
Species Human (GRCh38)
Location 17:39704275-39704297
Sequence GGTCCCCGTTGATTTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147331895_1147331903 15 Left 1147331895 17:39704275-39704297 CCCCCAGGAAATCAACGGGGACC 0: 1
1: 0
2: 1
3: 4
4: 117
Right 1147331903 17:39704313-39704335 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
1147331895_1147331909 28 Left 1147331895 17:39704275-39704297 CCCCCAGGAAATCAACGGGGACC 0: 1
1: 0
2: 1
3: 4
4: 117
Right 1147331909 17:39704326-39704348 AGCACTTTGGGAGGCCGAGACGG 0: 5294
1: 101129
2: 189241
3: 132828
4: 69895
1147331895_1147331904 16 Left 1147331895 17:39704275-39704297 CCCCCAGGAAATCAACGGGGACC 0: 1
1: 0
2: 1
3: 4
4: 117
Right 1147331904 17:39704314-39704336 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
1147331895_1147331910 29 Left 1147331895 17:39704275-39704297 CCCCCAGGAAATCAACGGGGACC 0: 1
1: 0
2: 1
3: 4
4: 117
Right 1147331910 17:39704327-39704349 GCACTTTGGGAGGCCGAGACGGG 0: 4244
1: 97188
2: 231521
3: 234490
4: 154551
1147331895_1147331906 19 Left 1147331895 17:39704275-39704297 CCCCCAGGAAATCAACGGGGACC 0: 1
1: 0
2: 1
3: 4
4: 117
Right 1147331906 17:39704317-39704339 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147331895 Original CRISPR GGTCCCCGTTGATTTCCTGG GGG (reversed) Intronic
901564799 1:10104932-10104954 GCTCCCAGTTGATTTACTGTTGG - Intronic
903587937 1:24431239-24431261 AATTCCCCTTGATTTCCTGGTGG + Intronic
907194889 1:52678527-52678549 GGTCCAGGATGACTTCCTGGAGG + Intergenic
912715714 1:111982336-111982358 AGTCCCCGATGATCTCCGGGAGG + Exonic
917496826 1:175548087-175548109 GGTCCTCGTTGAGTCCATGGTGG + Intronic
919242073 1:194926455-194926477 GGTCCCAATTTTTTTCCTGGTGG - Intergenic
919938137 1:202268388-202268410 GGGAGCCGTTGATTGCCTGGAGG - Intronic
921014788 1:211179289-211179311 GATCCCTGTTGCTTTCTTGGAGG - Intergenic
922311191 1:224392590-224392612 GGTCTTAGTTGATTTCCTAGAGG + Intronic
922660859 1:227429271-227429293 GGTCCCCCTGGATCTCCAGGTGG + Intergenic
923742151 1:236664775-236664797 GGTCCTCGTTATTGTCCTGGAGG - Intergenic
1074122018 10:110499656-110499678 GTCCCCTGTTGATTTCCTGTTGG + Intronic
1076382970 10:130037674-130037696 GGCCCGCATTGATTTCCTTGGGG - Intergenic
1083774139 11:64884956-64884978 GGTCCCCGTTTCCTTGCTGGTGG - Intronic
1085415273 11:76315459-76315481 AGTCCCTGCTGGTTTCCTGGTGG - Intergenic
1088391544 11:109320253-109320275 GGTCCAGGTGGTTTTCCTGGTGG - Intergenic
1092097806 12:5858496-5858518 GGTCTCCGTTTATTTTCAGGTGG - Intronic
1092708301 12:11308426-11308448 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092708415 12:11308804-11308826 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092712433 12:11353252-11353274 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092712447 12:11353315-11353337 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092712465 12:11353375-11353397 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092712487 12:11353438-11353460 GGTCCTTGTGGCTTTCCTGGAGG + Intronic
1092712502 12:11353498-11353520 GGTCCTTGTGGCTTTCCTGGAGG + Intronic
1092712521 12:11353558-11353580 GGTCCTTGTGGCTTTCCTGGAGG + Intronic
1092712543 12:11353621-11353643 GGTCCTTGTGGCTTTCCTGGAGG + Intronic
1092712558 12:11353681-11353703 GGTCCTTGTGGCTTTCCTGGAGG + Intronic
1092712576 12:11353741-11353763 GGTCCTTGTGGCTTTCCTGGAGG + Intronic
1092712598 12:11353804-11353826 GGTCCTTGTGGTTTTCCTGGAGG + Exonic
1092712616 12:11353864-11353886 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092712634 12:11353924-11353946 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092712656 12:11353987-11354009 GGTCCTTGTGGATTTCCTGGAGG + Exonic
1092716169 12:11392972-11392994 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716185 12:11393035-11393057 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716203 12:11393095-11393117 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716223 12:11393158-11393180 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716237 12:11393221-11393243 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716255 12:11393281-11393303 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716277 12:11393344-11393366 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716292 12:11393407-11393429 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716310 12:11393467-11393489 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716332 12:11393530-11393552 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716345 12:11393593-11393615 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716363 12:11393653-11393675 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716381 12:11393716-11393738 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716397 12:11393776-11393798 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716415 12:11393836-11393858 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1092716435 12:11393899-11393921 GGTCCTTGTGGCTTTCCTGGAGG + Exonic
1093697697 12:22180905-22180927 GGACCCAGTTGATTTCCTGGAGG - Intronic
1094775742 12:33725320-33725342 GTTCCTCTTTGATTTCCTTGAGG - Intergenic
1100223262 12:92530140-92530162 AGTCCCCATTGAGTTCCTTGTGG - Intergenic
1104308888 12:127635928-127635950 GGTCCCCCTTCCTTACCTGGAGG + Intergenic
1107413570 13:40179612-40179634 TCTCCCTGTTGATTTCCTTGAGG - Intergenic
1114571642 14:23673341-23673363 GGTCCAGGTTGATTGCTTGGTGG - Intergenic
1117714902 14:58570655-58570677 GGTACCCGATGACTTCCTTGAGG + Intergenic
1118858862 14:69646120-69646142 GGTCACCAGTGATTTCCTAGTGG + Intronic
1121734428 14:96208074-96208096 GGTCCACTTTCATTTCCTTGGGG + Intronic
1125235737 15:37511431-37511453 GTTGCCCCTTGAATTCCTGGGGG - Intergenic
1131529419 15:93179292-93179314 GGTCCCTGATGCTTTCCTCGTGG + Intergenic
1132591796 16:729321-729343 GGTCCCCGCCGACGTCCTGGAGG + Exonic
1134115892 16:11548479-11548501 GGTCCGTTTTGGTTTCCTGGTGG - Exonic
1141628858 16:85276063-85276085 GGTCCTGGTAGATTTCCTTGGGG + Intergenic
1145094227 17:20010045-20010067 GGTGCCCGTGGGTTTCCCGGTGG + Intronic
1147331895 17:39704275-39704297 GGTCCCCGTTGATTTCCTGGGGG - Intronic
1152076831 17:78164991-78165013 GGTCCACCTTGGTCTCCTGGAGG - Intronic
1161315584 19:3615817-3615839 GGTCCCAGGTGATTGGCTGGAGG - Intronic
1163596549 19:18224274-18224296 GGTCCCGGTTGTCTTCCTGTCGG - Intronic
1163711649 19:18850712-18850734 TGTCCCAGTTGATGTCCTTGAGG - Exonic
1163813106 19:19447067-19447089 GGTGTCCCTTGATATCCTGGGGG + Intronic
1165096247 19:33411414-33411436 GGCCCCCGATGGTTTCCTGTGGG - Intronic
937285731 2:120750037-120750059 TGTCCCTGTGGATATCCTGGCGG - Intronic
946977245 2:225166857-225166879 CATCCCCGTTGAATTCCAGGAGG + Intergenic
947542208 2:230987055-230987077 GGTCCCCTTTGAGCCCCTGGAGG + Intergenic
1172124737 20:32618851-32618873 TGTCCCTGGTGTTTTCCTGGGGG - Intergenic
1176040781 20:63064749-63064771 GGTCCCCCATGACTTCCTGCTGG + Intergenic
1178059333 21:28834772-28834794 GATCCCCATTCATTTCCAGGTGG - Intergenic
1179105090 21:38392407-38392429 GGTCCAGGCTGATCTCCTGGGGG + Exonic
1180824770 22:18854787-18854809 GGTCCCAGTCCATCTCCTGGAGG - Intronic
1180869296 22:19137401-19137423 AGTCCCCGATGATGACCTGGGGG - Exonic
1181125187 22:20697938-20697960 GGTCCCAGTCCATCTCCTGGAGG - Intergenic
1181187960 22:21119760-21119782 GGTCCCAGTCCATCTCCTGGAGG + Intergenic
1181211238 22:21290733-21290755 GGTCCCAGTCCATCTCCTGGAGG - Intergenic
1181398265 22:22636155-22636177 GGTCCCAGTCCATCTCCTGGAGG + Intergenic
1181501001 22:23315524-23315546 GGTCCCAGTCCATCTCCTGGAGG + Exonic
1181651149 22:24259905-24259927 GGTCCCAGTCCATCTCCTGGAGG - Intergenic
1181706231 22:24650834-24650856 GGTCCCAGTCCATCTCCTGGAGG + Intergenic
1183424964 22:37734520-37734542 GGTCCTGGCTGATGTCCTGGGGG - Exonic
1203215711 22_KI270731v1_random:4698-4720 GGTCCCAGTCCATCTCCTGGAGG + Intergenic
1203274915 22_KI270734v1_random:80693-80715 GGTCCCAGTCCATCTCCTGGAGG - Intergenic
950419879 3:12892546-12892568 GGTCCCTGTGGAGGTCCTGGGGG - Intergenic
950723134 3:14898833-14898855 AGTCCCCATTGATCTCCTGTGGG - Intronic
954419660 3:50412039-50412061 GGTCTCCCTTGACTTCCAGGAGG + Intronic
961046180 3:123709640-123709662 GGTCCCATCTGATTTTCTGGTGG + Intronic
967037296 3:185657451-185657473 GGTACCTGTTGAGTGCCTGGAGG - Intronic
974738126 4:65967324-65967346 GTTGCCTGATGATTTCCTGGAGG + Intergenic
979468665 4:121071073-121071095 GGTCCCAGCTGTTTTCTTGGAGG - Intronic
980602472 4:135041923-135041945 GGTCACGGTTATTTTCCTGGTGG - Intergenic
985537126 5:471872-471894 AGTCCCCATTGAGTCCCTGGTGG - Exonic
996154590 5:120082686-120082708 GGTCCCAGTCAATTTCCTGCAGG - Intergenic
997954010 5:138264375-138264397 GGTCCCTGCTGACTGCCTGGAGG - Exonic
1001476311 5:172053620-172053642 AGTCCCTGTTGATTTCTTGCAGG + Intronic
1002192279 5:177484521-177484543 GGCCCCACTGGATTTCCTGGTGG - Intronic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1010064974 6:71672019-71672041 TGACCCCGTTGATGTCCTAGAGG + Intergenic
1036011282 8:4727638-4727660 GGTCCCCGTGGATTTCAAGTGGG - Intronic
1045573596 8:103395097-103395119 TGACCCAGTAGATTTCCTGGGGG - Intergenic
1047110525 8:121784601-121784623 GCTCCCCCTTCATTTCCTGAAGG + Intergenic
1048511456 8:135066130-135066152 GGTCCCTGTTGTTTGTCTGGTGG + Intergenic
1049565111 8:143334222-143334244 GGTCCCAGGCGCTTTCCTGGAGG - Intronic
1049787444 8:144457725-144457747 GGGCCCCCACGATTTCCTGGTGG + Intronic
1058148677 9:101440463-101440485 GGTCCCATTTCATTTCCTTGTGG + Intergenic
1059860868 9:118460002-118460024 TGTCCTCTATGATTTCCTGGAGG + Intergenic
1060970496 9:127734942-127734964 GGTACCCGTTGAGGTCCAGGAGG - Intronic
1061198568 9:129122580-129122602 GGTACTCCTTGAATTCCTGGTGG + Intronic
1061538042 9:131261470-131261492 GGTCCCCTTTGACGTTCTGGGGG + Intronic
1062274027 9:135722221-135722243 GGTCTCCCTGGATATCCTGGGGG - Intronic
1189380663 X:40500223-40500245 GGGCCCCTTCGATTTCCTGGAGG + Intergenic
1189979197 X:46492147-46492169 GGTCTCCACTGATTGCCTGGGGG - Intronic
1193356494 X:80525069-80525091 GGTCATGGTTGTTTTCCTGGTGG - Intergenic
1193458306 X:81757993-81758015 GCTCCCCATTGATTTCTTGAAGG - Intergenic
1195285385 X:103377585-103377607 TGTCCCCGTCGATTTCCTGCAGG - Exonic
1195329476 X:103785616-103785638 GGCCCCCTTTGCTTCCCTGGTGG + Exonic
1198541055 X:137640001-137640023 GGTCTCAGTTGATTTCCTGATGG - Intergenic