ID: 1147333932

View in Genome Browser
Species Human (GRCh38)
Location 17:39715726-39715748
Sequence TAGGCGCCACTATGGGAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147333932_1147333937 -4 Left 1147333932 17:39715726-39715748 CCTTTCTCCCATAGTGGCGCCTA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1147333937 17:39715745-39715767 CCTACTCGCTGACCCTGCAAGGG 0: 1
1: 0
2: 0
3: 4
4: 84
1147333932_1147333943 15 Left 1147333932 17:39715726-39715748 CCTTTCTCCCATAGTGGCGCCTA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1147333943 17:39715764-39715786 AGGGCTGGGCATCAGCTGGCTGG 0: 1
1: 1
2: 7
3: 33
4: 341
1147333932_1147333944 16 Left 1147333932 17:39715726-39715748 CCTTTCTCCCATAGTGGCGCCTA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1147333944 17:39715765-39715787 GGGCTGGGCATCAGCTGGCTGGG 0: 1
1: 1
2: 8
3: 28
4: 357
1147333932_1147333939 1 Left 1147333932 17:39715726-39715748 CCTTTCTCCCATAGTGGCGCCTA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1147333939 17:39715750-39715772 TCGCTGACCCTGCAAGGGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 113
1147333932_1147333942 11 Left 1147333932 17:39715726-39715748 CCTTTCTCCCATAGTGGCGCCTA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1147333942 17:39715760-39715782 TGCAAGGGCTGGGCATCAGCTGG 0: 1
1: 0
2: 0
3: 25
4: 216
1147333932_1147333938 0 Left 1147333932 17:39715726-39715748 CCTTTCTCCCATAGTGGCGCCTA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1147333938 17:39715749-39715771 CTCGCTGACCCTGCAAGGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 144
1147333932_1147333935 -5 Left 1147333932 17:39715726-39715748 CCTTTCTCCCATAGTGGCGCCTA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1147333935 17:39715744-39715766 GCCTACTCGCTGACCCTGCAAGG 0: 1
1: 0
2: 0
3: 14
4: 75
1147333932_1147333945 17 Left 1147333932 17:39715726-39715748 CCTTTCTCCCATAGTGGCGCCTA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1147333945 17:39715766-39715788 GGCTGGGCATCAGCTGGCTGGGG 0: 1
1: 2
2: 6
3: 40
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147333932 Original CRISPR TAGGCGCCACTATGGGAGAA AGG (reversed) Exonic
906568241 1:46815451-46815473 AAGGCTCCATTTTGGGAGAATGG - Intronic
910941468 1:92539575-92539597 TAGGCGGATCTTTGGGAGAATGG - Intronic
916601412 1:166297155-166297177 TAAGCCCCACTATGGAAAAAAGG - Intergenic
919821355 1:201474529-201474551 TAGGAGAAACTATGGGGGAAGGG + Intergenic
920675874 1:208038464-208038486 TTGGCGCCACTCTGGGTGGAGGG + Exonic
1076935300 10:133564936-133564958 TAGGAGCCACTATGGCAGGTCGG + Intronic
1078877783 11:15415437-15415459 AAGATGCCAATATGGGAGAAGGG - Intergenic
1080196098 11:29611035-29611057 TAAGAGGCACTATAGGAGAATGG + Intergenic
1086887006 11:92217850-92217872 TAGGAGCCTCTTTGGGATAAAGG - Intergenic
1090419230 11:126562584-126562606 TAGGAGACACAAAGGGAGAAGGG + Intronic
1090458640 11:126870543-126870565 GAGGGGCCACTATGGGAGCCGGG - Intronic
1091584753 12:1809859-1809881 TGGGCCCCACAATGGTAGAAAGG + Intronic
1107417569 13:40215701-40215723 CAGGACCCACTTTGGGAGAAGGG - Intergenic
1116903092 14:50380133-50380155 TAAGAGCCAATATGGCAGAAAGG + Intronic
1121289038 14:92759606-92759628 TAGGCCCCACTTTGTTAGAAAGG + Intergenic
1122929368 14:104926331-104926353 CAGGTGCCACCATGGGGGAAGGG - Intronic
1124619294 15:31264875-31264897 AAGGCCCCACTGTGGGAGATAGG + Intergenic
1134261129 16:12651661-12651683 CATGCGCCACTGGGGGAGAAAGG - Intergenic
1137545732 16:49401942-49401964 TAGGAGCCCCAATGTGAGAAAGG + Intergenic
1138229215 16:55325141-55325163 GAGGCGCCTCTATGGGGGATAGG + Intronic
1140308220 16:73823648-73823670 TTGGCGCTACAATGGCAGAATGG + Intergenic
1147333932 17:39715726-39715748 TAGGCGCCACTATGGGAGAAAGG - Exonic
1155673665 18:28403234-28403256 TAATCACCACTGTGGGAGAAAGG + Intergenic
1157151687 18:45224512-45224534 TGGGCCCAACTATGGGAGACAGG + Intronic
1160596286 18:79976725-79976747 GAGGCTCCACTTTTGGAGAATGG + Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1164844595 19:31421097-31421119 TAGGGGGCACTGTGGGAAAAGGG - Intergenic
929021024 2:37553171-37553193 TAAGAGCCACTATGGTAGGAAGG + Intergenic
946372560 2:219289849-219289871 TATGCTCCAGTATGGAAGAATGG - Exonic
948742606 2:240057443-240057465 TAGGCGGCACCAGGGAAGAAGGG + Intergenic
1169362319 20:4961427-4961449 TAGGCCCCACTCTGGGGGATTGG - Intronic
1176064778 20:63188776-63188798 TGGGCCCCACTGTGGGAGCACGG - Intergenic
1182123809 22:27802229-27802251 TGGGCGCCGCTAGCGGAGAACGG - Intergenic
950995690 3:17494151-17494173 CAGCAGCCACTATGGAAGAAGGG - Intronic
959577386 3:107949205-107949227 TGGGAGGCACTCTGGGAGAACGG + Intergenic
961243420 3:125431762-125431784 TAGGGGTCACTATGGGAGGCAGG - Intergenic
966900615 3:184481327-184481349 TAGGCACCACAATGAGAGAAAGG - Intronic
972637951 4:40901026-40901048 AAGGTGCAACTATGGGAGAAGGG + Intronic
984658477 4:182346459-182346481 TGGGCGCAATTATGGGAGGAGGG - Intronic
998729894 5:145062640-145062662 TACACGCCTCTGTGGGAGAATGG + Intergenic
1000848330 5:166309278-166309300 GAGGCTCCACTATAGGAGAGAGG + Intergenic
1003874313 6:10422911-10422933 TAGCAGCCACTGTGGGAGACAGG - Intergenic
1006175984 6:32121860-32121882 GAGGAGCCACTAAAGGAGAAAGG - Intronic
1010361847 6:75004242-75004264 TAGGCTCCACTCTGGGGGCAGGG + Intergenic
1012085828 6:94824702-94824724 TAGGCTCCACTCTGGGGGCAGGG + Intergenic
1014351215 6:120348725-120348747 TAGGCTCCACGATGGCAAAATGG + Intergenic
1023987037 7:45102788-45102810 TTGGAGACATTATGGGAGAAGGG - Intronic
1029445119 7:100607623-100607645 CAGTCACCACTGTGGGAGAATGG - Exonic
1050501427 9:6301985-6302007 TAGGCTCAGCTATGAGAGAAAGG + Intergenic
1054753402 9:68931703-68931725 TAGGTTCCAATATGGCAGAAGGG + Intronic
1057131415 9:92656822-92656844 TAGGGGCCGCTTTGGGAGAAGGG - Intronic
1186925896 X:14333054-14333076 CAGGAGCCAGTATGGTAGAATGG - Intergenic
1188340914 X:29000255-29000277 TAGGTGGCACCATGGGAGAAAGG + Intronic
1194413298 X:93580479-93580501 TAAGCACCACTTTGGGAGCAGGG - Intergenic
1197866013 X:131017976-131017998 TAATGGCCACTGTGGGAGAAAGG + Intergenic
1198162058 X:134017735-134017757 TTGGAGCCACTAGGGTAGAAAGG + Intergenic