ID: 1147334086

View in Genome Browser
Species Human (GRCh38)
Location 17:39716389-39716411
Sequence CCACGCACTCCTGGCCCCGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 188}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147334086_1147334095 8 Left 1147334086 17:39716389-39716411 CCTTCGGGGCCAGGAGTGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1147334095 17:39716420-39716442 CGAGTACTGCAGGGGTATGAGGG 0: 1
1: 0
2: 2
3: 4
4: 70
1147334086_1147334101 24 Left 1147334086 17:39716389-39716411 CCTTCGGGGCCAGGAGTGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1147334101 17:39716436-39716458 ATGAGGGGCGGAGGAGAGGGTGG 0: 1
1: 0
2: 5
3: 111
4: 1398
1147334086_1147334094 7 Left 1147334086 17:39716389-39716411 CCTTCGGGGCCAGGAGTGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1147334094 17:39716419-39716441 CCGAGTACTGCAGGGGTATGAGG 0: 1
1: 0
2: 1
3: 3
4: 72
1147334086_1147334099 20 Left 1147334086 17:39716389-39716411 CCTTCGGGGCCAGGAGTGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1147334099 17:39716432-39716454 GGGTATGAGGGGCGGAGGAGAGG 0: 1
1: 0
2: 3
3: 61
4: 735
1147334086_1147334096 9 Left 1147334086 17:39716389-39716411 CCTTCGGGGCCAGGAGTGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1147334096 17:39716421-39716443 GAGTACTGCAGGGGTATGAGGGG 0: 1
1: 0
2: 1
3: 8
4: 148
1147334086_1147334097 12 Left 1147334086 17:39716389-39716411 CCTTCGGGGCCAGGAGTGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1147334097 17:39716424-39716446 TACTGCAGGGGTATGAGGGGCGG 0: 1
1: 0
2: 1
3: 25
4: 241
1147334086_1147334090 -2 Left 1147334086 17:39716389-39716411 CCTTCGGGGCCAGGAGTGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1147334090 17:39716410-39716432 GGAGGAATGCCGAGTACTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 117
1147334086_1147334100 21 Left 1147334086 17:39716389-39716411 CCTTCGGGGCCAGGAGTGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1147334100 17:39716433-39716455 GGTATGAGGGGCGGAGGAGAGGG 0: 1
1: 0
2: 4
3: 51
4: 668
1147334086_1147334092 0 Left 1147334086 17:39716389-39716411 CCTTCGGGGCCAGGAGTGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1147334092 17:39716412-39716434 AGGAATGCCGAGTACTGCAGGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1147334086_1147334091 -1 Left 1147334086 17:39716389-39716411 CCTTCGGGGCCAGGAGTGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1147334091 17:39716411-39716433 GAGGAATGCCGAGTACTGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 91
1147334086_1147334098 15 Left 1147334086 17:39716389-39716411 CCTTCGGGGCCAGGAGTGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1147334098 17:39716427-39716449 TGCAGGGGTATGAGGGGCGGAGG 0: 1
1: 0
2: 1
3: 34
4: 373
1147334086_1147334102 28 Left 1147334086 17:39716389-39716411 CCTTCGGGGCCAGGAGTGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 188
Right 1147334102 17:39716440-39716462 GGGGCGGAGGAGAGGGTGGCTGG 0: 1
1: 0
2: 14
3: 151
4: 1581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147334086 Original CRISPR CCACGCACTCCTGGCCCCGA AGG (reversed) Exonic
901202117 1:7472895-7472917 CCAGGCGGTCCTGGCCCCAAAGG + Intronic
902304705 1:15527046-15527068 CCAGTCACTGCTGGCCCCGGGGG + Intronic
903341850 1:22659586-22659608 CCTGGGACACCTGGCCCCGATGG + Exonic
903491263 1:23730364-23730386 CCTCGAACTCCTGGGCCCAAGGG + Intergenic
904052225 1:27646591-27646613 TCAAGCACTCCTGGCCCCCAAGG - Intergenic
905204626 1:36336266-36336288 CCTGGCCCTCCTGGCCCCTATGG + Intergenic
906344366 1:45005996-45006018 CCAGGAACTCCTTACCCCGAAGG + Exonic
907794408 1:57700512-57700534 CCACTCACTCCTGGCCTATATGG + Intronic
910180753 1:84479798-84479820 CTACGCCCTCCTGGCCCAGAAGG + Intronic
910895000 1:92059941-92059963 CCTCGAACTCCTGGCCTCAAAGG + Intronic
911022227 1:93400485-93400507 TCACGAACTCCTGGCCTCAAGGG - Intergenic
911033827 1:93517408-93517430 CCTCGAACTCCTGGCCCCAAGGG + Intronic
916107591 1:161442458-161442480 CCACAAACGCCTGGCCCCGCCGG + Intergenic
916109175 1:161449876-161449898 CCACAAACGCCTGGCCCCGCCGG + Intergenic
916110762 1:161457257-161457279 CCACAAACGCCTGGCCCCGCCGG + Intergenic
916112348 1:161464667-161464689 CCACAAACGCCTGGCCCCGCCGG + Intergenic
916113934 1:161472048-161472070 CCACAAACGCCTGGCCCCGCCGG + Intergenic
919514721 1:198509331-198509353 CCACTCTCTCCTGGCCTGGAAGG + Intergenic
921711618 1:218378688-218378710 CCTGGAACTCCTGGCCCCAAAGG + Intronic
924043874 1:240009191-240009213 CCACCTACTCCTGGCCCAGCTGG + Intergenic
924642590 1:245848490-245848512 CCTCGAACTCCTGGGCTCGAGGG + Intronic
1065461017 10:25964924-25964946 CCACTCTCTCCTGGCCCATAAGG + Intronic
1066289939 10:34004675-34004697 TCACGAACTCCTGGCCTCAAGGG + Intergenic
1070437039 10:76403481-76403503 CCATGCACCACTGGCCCTGAGGG - Intronic
1071225713 10:83526225-83526247 CCACCCAATCCTGGCCCAGCTGG - Intergenic
1073510448 10:104039462-104039484 CCAGGCCCACCTGGCCCCCAGGG - Exonic
1074301621 10:112239098-112239120 CCACTCTCTCCTGGCCCATAAGG + Intergenic
1075025649 10:118981339-118981361 CCAGGTACCCCTGGCCCAGATGG - Intergenic
1075519343 10:123134882-123134904 ACACCCACTCCTGGTCCCGGGGG + Intergenic
1076754058 10:132558875-132558897 CCACACACCCATGGCCCCGGAGG - Intronic
1077110129 11:858667-858689 CCACGCACCCCAGGCTCCCACGG + Intronic
1078261997 11:9718305-9718327 ACAAGCACTCCTGGCCCCAGAGG - Intronic
1079038230 11:17039202-17039224 CCACTCTCTCCTGGCCCGTAAGG - Intergenic
1080210700 11:29781528-29781550 CCACCCACTACTGGCCCCACAGG - Intergenic
1080637998 11:34140259-34140281 CCACACAGCCCTGGCCCAGAGGG - Intronic
1080706586 11:34701292-34701314 CCACCCATTCCTGGCTCCCACGG - Intergenic
1080715390 11:34795256-34795278 CCAATCACTCCTGTCCCCCAGGG - Intergenic
1083637749 11:64129537-64129559 TCCCGCATTCCTGGCCCCCAGGG + Intronic
1083695914 11:64442288-64442310 CCACGCAGTCCTGGAGCCCACGG - Intergenic
1085529280 11:77182084-77182106 CCACGCACTCCTACACCCGGCGG + Exonic
1087503104 11:98984809-98984831 CCACTCTCTCCTGGCCTCTAAGG - Intergenic
1089567148 11:119377839-119377861 CCAGGCGCTCCTGGCCCTGGGGG + Intronic
1091489826 12:923474-923496 CCTTGCACTCCTGGGCCCAAGGG - Intronic
1092095313 12:5837251-5837273 GCAGGCATTCCTGGCCCCGTGGG - Intronic
1094198846 12:27777861-27777883 CCTCAAACTCCTGGCCCCAAGGG - Intergenic
1095982881 12:47982855-47982877 CCCGGCACTCCTGGCACTGATGG - Exonic
1098794759 12:74875208-74875230 CCACACACACCTGGCTCAGAGGG + Intergenic
1103239551 12:119401454-119401476 AGACGCAATCTTGGCCCCGAAGG + Intronic
1103841560 12:123869475-123869497 ACACTCACTCCTGGCTCCAAAGG + Intronic
1104768924 12:131348270-131348292 CCACGGCCTCCTGGCCCTCAGGG - Intergenic
1104810829 12:131619378-131619400 CCACGGCCTCCTGGCCCTCAGGG + Intergenic
1106073561 13:26437111-26437133 CCACTCTCTCCTGGCCTGGAAGG - Intergenic
1113082668 13:106534984-106535006 CCGCGCACTCCGGGCCAAGAAGG + Exonic
1113848643 13:113405747-113405769 CCACGGCCTCCTGGCCCCTGGGG - Intergenic
1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG + Intergenic
1117773164 14:59155118-59155140 CCTCGAACTCCTGGGCCTGAGGG - Intergenic
1118366616 14:65102166-65102188 GGAGGCACTCCTGGCCCCGAGGG + Intronic
1120055730 14:79921946-79921968 TCTCGAACTCCTGGCCCCAAGGG + Intergenic
1121410253 14:93744480-93744502 TCACTCACTCCTCACCCCGAAGG + Intronic
1123006518 14:105326441-105326463 CCAGGAAGGCCTGGCCCCGAGGG - Intronic
1124247273 15:28081713-28081735 CCTCGCACTCCTGCCCCAGGGGG - Exonic
1132685088 16:1158858-1158880 GCCCGCACCCCTGGCCCCGCAGG + Intronic
1134167943 16:11945295-11945317 CCTCGAACTCCTGGCCTCAAGGG - Intronic
1134747947 16:16602377-16602399 CTAGGCACTTCTGGCCCCCAGGG - Intergenic
1134997521 16:18751282-18751304 CTAGGCACTTCTGGCCCCCAGGG + Intergenic
1136366001 16:29809583-29809605 CCACGGGCTCCAGGCCCCGCGGG + Exonic
1141933385 16:87219676-87219698 ACACCCACTCCTGTCCCAGACGG + Intronic
1142408450 16:89904051-89904073 CCAGCCACTCCTAGCCCCCAAGG - Intronic
1142780195 17:2175497-2175519 CCATGCTCTCCTGTCCCCTAAGG + Intronic
1143023179 17:3927129-3927151 CCCCTCACTCCTGGCCCAGCAGG + Intronic
1146055568 17:29579091-29579113 CCACGCACACCCGGCCCAGAAGG + Intronic
1146242323 17:31242059-31242081 CCACTCTCTCCTGGCCTCTAAGG + Intronic
1147334086 17:39716389-39716411 CCACGCACTCCTGGCCCCGAAGG - Exonic
1148147769 17:45376790-45376812 CCTCTCACTCCTGGCCCTGGGGG + Intergenic
1149157177 17:53646116-53646138 CCACACACTCCTGGCCTATAAGG + Intergenic
1150211409 17:63443709-63443731 CCTCGAACTCCTGGGCTCGAGGG + Intronic
1150909715 17:69375305-69375327 CCCTGAACTCCTGGCCCCAAGGG - Intergenic
1151913806 17:77102883-77102905 CCTCGAACTCCTGGGCTCGAGGG + Intronic
1152579881 17:81161147-81161169 CCACGGGCTGCTGGCCCAGACGG + Intronic
1152903504 17:82958234-82958256 CCACGCCGTTCTGGCCCCGTTGG - Intronic
1152919657 17:83059587-83059609 CCAGGCAGGCCTGGCCCCGCAGG - Intergenic
1153881712 18:9426950-9426972 CCAGGCAGCCCTGGCCCGGAGGG - Intergenic
1155441510 18:25867406-25867428 CCTCGAACTCCTGGCCTCAAGGG + Intergenic
1155985411 18:32225821-32225843 TCTCGCACTCCTGGCCTCAAGGG + Intronic
1158589408 18:58767290-58767312 CCTCGAACTCCTGGCCTCAAGGG - Intergenic
1160808620 19:1003348-1003370 GCGGGCACGCCTGGCCCCGATGG + Exonic
1160824450 19:1073168-1073190 CCAGGCACTCGTGGGCCCGCGGG - Exonic
1161026952 19:2041314-2041336 CCACGCACGCCTGGGGCAGAGGG + Intronic
1161162645 19:2769613-2769635 GCAGGCACACCTGGCCCCGTTGG - Intronic
1161296795 19:3524232-3524254 CCACGCACTGCTGGGCCTGCAGG - Intronic
1161420477 19:4173740-4173762 CCACGAACTCCTGACCCAGGGGG + Intergenic
1161933294 19:7355609-7355631 ACACGCACGCATGGCCCCCATGG + Intronic
1164953536 19:32360853-32360875 CCTCGAACTCCTGGCCTCAAGGG + Intronic
1166852575 19:45767625-45767647 CCACGCCGTCCGGGCCCGGAGGG + Intronic
1168149738 19:54439303-54439325 CAACACACACCTGGCTCCGAGGG + Intergenic
925125244 2:1450028-1450050 CCTCGCACACCTGGCCCAGCAGG + Intronic
925185807 2:1845548-1845570 CCTCCCACTCCTGGCCCTGCTGG + Intronic
926155170 2:10449340-10449362 CCACTCACTCCAGGCCACGCTGG + Intergenic
926158113 2:10469313-10469335 CCACCCAAATCTGGCCCCGAGGG - Intergenic
932907202 2:75767059-75767081 CCAAGCTCTCCTGTCCCCTAAGG - Intergenic
938078312 2:128353988-128354010 CCAGGCACTCATGGCCCCATTGG - Intergenic
942139159 2:172959869-172959891 TCTCGCACTCCTGGCCTCAAGGG - Intronic
942308781 2:174634802-174634824 CCAGGCACTCCTGACTCCAAAGG + Intronic
942882214 2:180874009-180874031 CCACTCTCTCCTGGCCCTTAAGG - Intergenic
943529162 2:189057327-189057349 GCAGGAACTCCTGGCCCCAAGGG - Exonic
946034059 2:216727827-216727849 CCACTCACTCCAGCCCCCAAAGG - Intergenic
946419200 2:219555496-219555518 CCTCGAACTCCTGGCCTCAAGGG + Intronic
946842883 2:223836155-223836177 CCACCCACTCCTGCCTCCGGTGG + Intronic
946901953 2:224381370-224381392 CCTCGAACTCCTGGGCTCGAGGG - Intronic
947733036 2:232441514-232441536 CCCAGCACTCCTGGCCCTGTGGG + Intergenic
948058559 2:235027341-235027363 CCACCCACCCCAGGCCCCGAAGG + Intronic
948487861 2:238292072-238292094 CCTCGAACTCCTGGCCTCAAGGG - Intergenic
948685083 2:239665298-239665320 CCACCCACTCCTGTCCTCGAAGG - Intergenic
948893517 2:240917998-240918020 CCAGGCACTCCTGGGGCAGAAGG + Intergenic
1172810126 20:37641391-37641413 CCACTCACTCCCGGGCCTGATGG - Intergenic
1172983393 20:38962294-38962316 CCACGCCCTCCGGGCCCTGGGGG + Intronic
1173514308 20:43654177-43654199 CCACGCTCTCCTGACCAAGAAGG + Intergenic
1179133646 21:38660906-38660928 GCCCGCGCTCTTGGCCCCGAGGG - Intronic
1179443227 21:41410813-41410835 GCAGGCACTCCTGGTCCCCAGGG + Intergenic
1180142932 21:45903258-45903280 CCACGAAACCCTGGCCACGAGGG - Intronic
1180226063 21:46393186-46393208 CCAGGCCCTCCTGGCCCTGGAGG - Intronic
1180967780 22:19799511-19799533 CCACGCATTCCTGGCACCTGAGG - Intronic
1181167367 22:20991003-20991025 CCACGCACCCGTGGCCTCCAGGG - Intronic
1182230623 22:28835221-28835243 TCTCGAACTCCTGGCCCCAAGGG + Intergenic
1183240452 22:36653772-36653794 CCATGCCCTCCTGGTCCTGAAGG - Intronic
1184656612 22:45944964-45944986 CCACCCCCTCCTGTCCCCTATGG + Intronic
1184719819 22:46304893-46304915 CCTCGAACTCCTGGACTCGAGGG - Intronic
1184961165 22:47929902-47929924 CCCCTGACTTCTGGCCCCGAGGG - Intergenic
951435269 3:22655722-22655744 CCACTCTCTCCTGGCCTCTAAGG + Intergenic
951727382 3:25774942-25774964 GCAGGCACTCCTGGCCACCAAGG - Intronic
953490701 3:43347938-43347960 TCACCTACTCCTGGCACCGACGG + Exonic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
954632388 3:52054707-52054729 CCACGCACACCTAGCACCCATGG + Intronic
958154239 3:89732146-89732168 CCACTCTCTCCTGGCCCATAAGG - Intergenic
961108871 3:124266658-124266680 ACAGGCGCTCCTGGCCCCCAGGG - Intronic
961722580 3:128906600-128906622 GCATGCGCTCCTGGCCCCTAGGG + Intronic
961864302 3:129942473-129942495 CCGGGCACTCCTGGCCCCCGAGG - Intergenic
963448244 3:145441821-145441843 CCACTCTCTCCTGGCCCATAAGG - Intergenic
964473413 3:157077533-157077555 CCACCCTCTCCTGGCCACAAAGG + Intergenic
969025190 4:4167166-4167188 CCAGTGACTCCTGACCCCGATGG + Intergenic
969525377 4:7701533-7701555 CCACGGCCTCAGGGCCCCGAAGG - Intronic
969612939 4:8237156-8237178 CCACGCGCTCCTGGGCACCAGGG - Intronic
970510144 4:16773816-16773838 CCTCGAACTCCTGGACGCGAGGG + Intronic
970764026 4:19525047-19525069 CCACCAACTCTTGGCCCAGATGG + Intergenic
972330108 4:38056588-38056610 CCTCGAACTCCTGGCCTCCAGGG - Intronic
975360351 4:73462480-73462502 CCACTCCCTCCTGGCCTTGAAGG - Intergenic
975569049 4:75793361-75793383 CCACCAACTCCTGGCCTCAAGGG + Intronic
978473926 4:109104287-109104309 CCTCGAACTCCTGGGCCCAAGGG - Intronic
985678829 5:1245657-1245679 CCCCAAACTCCTGGCCCGGAGGG + Intronic
987133428 5:14880113-14880135 CCACGAACTCCTGGGCTCAAGGG - Intergenic
995637379 5:114209138-114209160 CCTCACACTCCTGGCCTCAAGGG + Intergenic
996961329 5:129253921-129253943 CCACTCTCTCCTGGCCTGGAAGG + Intergenic
1001528209 5:172444139-172444161 CCACTCACACCTGGCCCATAGGG + Intronic
1002082992 5:176748514-176748536 CCGGGCACTCCTGGCCCTCACGG + Intergenic
1004935994 6:20508985-20509007 CCTCAAACTCCTGGGCCCGAGGG - Intergenic
1008613077 6:53202051-53202073 CCTCATACTCCTGGCCCCAAGGG + Intergenic
1011404225 6:87000567-87000589 CCACTCTCTCCTGGCCTCTAAGG - Intronic
1013241281 6:108248161-108248183 ACACACACTCCTGGCCCCTCAGG + Intronic
1014960926 6:127683413-127683435 CCACTCTCTCCTGGCCCTGAGGG - Intergenic
1018020292 6:159756820-159756842 CCTCAAACTCCTGGCCCCAAGGG + Intronic
1019476710 7:1247814-1247836 CCACGCGCTCCAGGTCCTGAGGG - Intergenic
1019612035 7:1941524-1941546 CCCTGCACTGCTGGCCCCGCTGG + Intronic
1022358157 7:29635258-29635280 CCACCCACACCTGGCCCCTCTGG - Intergenic
1022368426 7:29747860-29747882 CCACCCACACCTGGCCCCTCTGG - Intergenic
1024507146 7:50171500-50171522 CAACGCACACCTGGCCCAGGAGG - Intergenic
1026492484 7:70874706-70874728 CCTCGAACTCCTGGCCTCAAGGG + Intergenic
1026678820 7:72449985-72450007 CCTCAAACTCCTGGCCCCAAGGG - Intergenic
1029495131 7:100892468-100892490 CCACGCTCTCCTGGCCCCTGTGG - Exonic
1029657268 7:101935546-101935568 CCGGGCACTCCTGGCCCAGCTGG + Intronic
1030030893 7:105368595-105368617 CCACGCTCTGCTGGCCACGGCGG + Intronic
1030348080 7:108455769-108455791 CCCCGCGCTCCTCGCCCCGCCGG + Intronic
1036910562 8:12754643-12754665 CCGCACCCTCCTGGCCCCGAGGG - Intronic
1039269322 8:35863612-35863634 CGACGGACTCCTGGCTCTGAAGG - Intergenic
1039447260 8:37642815-37642837 CCTCGAACTCCTGGGCCCAAGGG + Intergenic
1039516811 8:38140569-38140591 CCTCGAACTCCTGGGCCCAAGGG - Intronic
1039749034 8:40459549-40459571 CCACAAACTCCTGGCCTCAAGGG - Intergenic
1041254941 8:55971989-55972011 CCAGGCCCTCCTGTCACCGAGGG - Intronic
1043131996 8:76473228-76473250 ACACTCATTCCTGGCCCCCAAGG - Intergenic
1043955059 8:86349991-86350013 CCACGCGCTCCAAGCCCCAATGG + Intronic
1044241686 8:89895065-89895087 CCACTCTCTCCTGGCCTGGAAGG - Intergenic
1045959597 8:107951726-107951748 TCACTCACTCCCGGCCCCCAAGG + Intronic
1049505500 8:142994289-142994311 CCTCACACTCCTGGTCCTGACGG - Intergenic
1049622173 8:143603474-143603496 CCAGCCACTCCTGGCCCAGCTGG - Intergenic
1056516938 9:87361249-87361271 CCACTCTCTCCTGGCCTCTAAGG - Intergenic
1061341156 9:129982744-129982766 CCTCGAACTCCTGGGCCCCAGGG + Intronic
1062011746 9:134270891-134270913 CCACTCACTGTTGGCCCTGAGGG - Intergenic
1062352194 9:136144670-136144692 CCACCCACTCCGGGCCCTGTGGG + Intergenic
1185468246 X:368353-368375 CCACCCACCCCGGGCACCGACGG + Intronic
1185468296 X:368465-368487 CCACCCACCCCGGGCACCGACGG + Intronic
1185468329 X:368539-368561 CCACCCACCCCGGGCACCGACGG + Intronic
1186453369 X:9691643-9691665 CCTCAGACTCATGGCCCCGAAGG - Exonic
1187932134 X:24303168-24303190 CCTCGAACTCCTGGCCTCAAGGG - Intergenic
1188426900 X:30059092-30059114 CCACGCTCTCCTGGCCTGTAAGG + Intergenic
1190404998 X:50078120-50078142 CCTCAAACTCCTGGCCCCGAGGG - Intronic
1190893680 X:54595362-54595384 CCACTCTCTCCTGGCCTGGAAGG + Intergenic
1191879221 X:65828107-65828129 GTAGGCACTCCTGGCCCCCAAGG + Intergenic
1196326306 X:114407963-114407985 CCTCGAACTCCTGGCCTCAAAGG + Intergenic
1196846970 X:119904154-119904176 CCTCGAACTCCTGGCCTCAAGGG + Intronic
1200079314 X:153567795-153567817 CCACGGGCTCCTGACCCCCATGG + Intronic
1200764643 Y:7070260-7070282 CCTCAGACTCGTGGCCCCGAAGG - Exonic