ID: 1147335169

View in Genome Browser
Species Human (GRCh38)
Location 17:39723325-39723347
Sequence GACGTCCATCATCTCTGCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 62}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147335151_1147335169 27 Left 1147335151 17:39723275-39723297 CCCCAAACTAGCCCTCAATCCCT 0: 1
1: 0
2: 1
3: 10
4: 171
Right 1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 62
1147335150_1147335169 30 Left 1147335150 17:39723272-39723294 CCACCCCAAACTAGCCCTCAATC 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 62
1147335162_1147335169 -10 Left 1147335162 17:39723312-39723334 CCCCCAGCCCTCTGACGTCCATC 0: 1
1: 0
2: 0
3: 12
4: 198
Right 1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 62
1147335152_1147335169 26 Left 1147335152 17:39723276-39723298 CCCAAACTAGCCCTCAATCCCTG 0: 1
1: 0
2: 2
3: 9
4: 178
Right 1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 62
1147335159_1147335169 2 Left 1147335159 17:39723300-39723322 CCCTGGCTTCCGCCCCCAGCCCT 0: 1
1: 0
2: 4
3: 72
4: 689
Right 1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 62
1147335157_1147335169 8 Left 1147335157 17:39723294-39723316 CCCTGACCCTGGCTTCCGCCCCC 0: 1
1: 0
2: 1
3: 46
4: 377
Right 1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 62
1147335155_1147335169 16 Left 1147335155 17:39723286-39723308 CCCTCAATCCCTGACCCTGGCTT 0: 1
1: 0
2: 0
3: 26
4: 284
Right 1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 62
1147335161_1147335169 -7 Left 1147335161 17:39723309-39723331 CCGCCCCCAGCCCTCTGACGTCC 0: 1
1: 0
2: 4
3: 48
4: 541
Right 1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 62
1147335160_1147335169 1 Left 1147335160 17:39723301-39723323 CCTGGCTTCCGCCCCCAGCCCTC 0: 1
1: 0
2: 8
3: 83
4: 814
Right 1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 62
1147335153_1147335169 25 Left 1147335153 17:39723277-39723299 CCAAACTAGCCCTCAATCCCTGA 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 62
1147335158_1147335169 7 Left 1147335158 17:39723295-39723317 CCTGACCCTGGCTTCCGCCCCCA 0: 1
1: 0
2: 2
3: 42
4: 388
Right 1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 62
1147335156_1147335169 15 Left 1147335156 17:39723287-39723309 CCTCAATCCCTGACCCTGGCTTC 0: 1
1: 0
2: 4
3: 50
4: 439
Right 1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG 0: 1
1: 0
2: 0
3: 13
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147335169 Original CRISPR GACGTCCATCATCTCTGCGG TGG Exonic
904479250 1:30783770-30783792 GAAGTCCCTCAACTCTCCGGCGG + Intergenic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
906200552 1:43957433-43957455 GACGTCAATGGTCTCTGCGATGG - Exonic
917787853 1:178478231-178478253 GACCTCCATCATCTTTGTGGGGG + Intronic
921039634 1:211417093-211417115 GTTGTCCCTCATCTCTGCTGAGG - Intergenic
922251887 1:223856743-223856765 GGTGGCCATCATCTCTGCTGAGG - Intergenic
1063607213 10:7533279-7533301 GACTCCCAGCATCACTGCGGGGG + Intergenic
1071693144 10:87844001-87844023 GAAGTACATCATCCTTGCGGAGG + Intergenic
1072996421 10:100248880-100248902 GGCAGCCATCATCTCTGCTGAGG + Intronic
1081507583 11:43734374-43734396 GGCGGCCATCATCTCTGCTGAGG + Intronic
1086950973 11:92890119-92890141 GAGGTCCATCAGCTGTGCTGTGG - Intronic
1095039132 12:37422848-37422870 GCTGTCAATCATTTCTGCGGCGG - Intergenic
1096005666 12:48169016-48169038 GGCAGCCATCATCTCTGCTGAGG - Intronic
1096519044 12:52173882-52173904 GCCTTCCATCATCTCTCCAGAGG - Intronic
1100820310 12:98423441-98423463 GACGCCCACCATCTCTGTAGGGG - Intergenic
1103597920 12:122035401-122035423 CATGTCCATCATCCCTGGGGAGG - Exonic
1103891343 12:124241343-124241365 GTCCTCCTTCATCTCTTCGGTGG - Intronic
1113706625 13:112438249-112438271 GACCTCCATCATTTCTCCTGGGG + Intergenic
1114210096 14:20606801-20606823 GACGCCCACCATCTCTGCAGGGG - Intronic
1117189161 14:53274229-53274251 GATGCCCACCATCTCTGCAGGGG + Intergenic
1127386881 15:58474196-58474218 GAAGTGCATCCTCTCTGCTGGGG + Intronic
1127484524 15:59407046-59407068 GAGATCCATCATCACTGGGGAGG - Intronic
1127772546 15:62243237-62243259 GGCGTGCAACATCTCTGCAGGGG - Intergenic
1129038648 15:72665890-72665912 GGCGTGCAACATCTCTGCGGGGG + Intronic
1129476296 15:75786444-75786466 GGCGTGCAACATCTCTGCAGGGG + Intergenic
1132759448 16:1501704-1501726 GCCATCCACGATCTCTGCGGGGG - Exonic
1137966094 16:52935442-52935464 GGTGGCCATCATCTCTGCTGAGG + Intergenic
1141461197 16:84179711-84179733 GAGGCCCAGCATCTCTGCGGAGG + Exonic
1145200226 17:20938261-20938283 CACGTGCATCTTCTCTGCGTTGG - Intergenic
1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG + Exonic
1148670304 17:49405165-49405187 GGCGGCCATCATCTCTGCTGAGG - Exonic
1151694338 17:75706470-75706492 GACCACCGTCATCTCTGCTGTGG + Exonic
1152698923 17:81809792-81809814 GAAGTCCATCACCTGAGCGGAGG - Exonic
1159324107 18:66893205-66893227 GAAGTCCATCACCTCTGAGAGGG + Intergenic
1165673166 19:37696791-37696813 GGCGGCCATCATCTCTGCTGAGG - Exonic
1166705476 19:44905804-44905826 GACGTCCTTCACCTCCGCTGGGG - Exonic
934949332 2:98565730-98565752 GACGGGCAGCATGTCTGCGGAGG - Exonic
943320546 2:186437627-186437649 GATGCCCACCATCTCTGCAGGGG - Intergenic
945179588 2:207078089-207078111 AACGTCCATCACCTCTGCAGTGG - Exonic
1175885116 20:62285832-62285854 GACTTCCTTCGTCTCTGCGAAGG + Intronic
1177651170 21:23963883-23963905 GATGCCCACCATCTCTGCAGGGG + Intergenic
1180076538 21:45466133-45466155 GACGTCCATCCCTTCTGCAGTGG - Intronic
1180127796 21:45803933-45803955 GGCGTCCTTCATCTCAGCGAGGG - Intronic
1184659640 22:45959970-45959992 GAGGTCCATGTTATCTGCGGGGG - Intronic
953844686 3:46418061-46418083 GATGTCTACCATCTCTGCAGGGG + Intergenic
955246213 3:57227645-57227667 GACGCCCATCCGCGCTGCGGCGG - Intergenic
957685551 3:83500878-83500900 GATGCCCACCATCTCTGCAGGGG + Intergenic
959162967 3:102741671-102741693 GATGCCCACCATCTCTGCGGGGG - Intergenic
965681657 3:171258058-171258080 GGCATCCATCATCACTGTGGTGG - Intronic
966449123 3:180037319-180037341 GACATGCATCGTCTCTCCGGGGG + Intergenic
967676831 3:192309384-192309406 AAACTCCATCATCTCTGTGGAGG + Intronic
974402420 4:61424508-61424530 GATGCCCACCATCTCTGTGGGGG + Intronic
979082610 4:116361678-116361700 GATGCCCACCATCTCTGCAGGGG - Intergenic
984978964 4:185258894-185258916 GTTGTCCCTCATCTCTGCTGAGG - Exonic
985834736 5:2261941-2261963 GACGTCCTGCTTCTCTGCTGCGG - Intergenic
994589716 5:101758506-101758528 GACGCCCATCATGTCTGTAGGGG + Intergenic
1001894157 5:175364211-175364233 GACGCCCACCATCTCTGTAGGGG - Intergenic
1008909570 6:56718658-56718680 GATGTCCATCAACTCTTAGGTGG + Intronic
1014753028 6:125273926-125273948 GATGCCCACCATCTCTGCAGGGG - Intronic
1026769759 7:73188134-73188156 GGCGGCCATCATCTCTGCCGAGG - Intergenic
1027010627 7:74741516-74741538 GGCGGCCATCATCTCTGCCGAGG - Intronic
1027077415 7:75204524-75204546 GGCGGCCATCATCTCTGCCGAGG + Intergenic
1027684410 7:81264577-81264599 GATGCCCACCATCTCTGCAGGGG + Intergenic
1029728617 7:102425036-102425058 GGGGTCCAGCAGCTCTGCGGAGG + Exonic
1033531702 7:142270686-142270708 CATGTCCATCATCTCTGAAGAGG - Intergenic
1035045944 7:155965397-155965419 GACGCCCTTCATCTCTGCCAAGG - Exonic
1041597002 8:59666432-59666454 GAGTTCCATCCTCTTTGCGGTGG + Intergenic
1045657136 8:104398919-104398941 GAGGCCCATCAGCTCTGCAGGGG - Intronic
1056365384 9:85899526-85899548 GGCGGCCATCATCTCTGCTGAGG + Intergenic
1058750595 9:108035127-108035149 GTCCTCCATCCTCTCTGCTGGGG - Intergenic
1203759236 EBV:3420-3442 ATCATCCATCATCTCGGCGGTGG - Intergenic
1188904704 X:35778447-35778469 GAAGTCCAGCATCTCTGAGAAGG + Intergenic
1194644671 X:96444696-96444718 GACATTCATCACCTCTGCAGGGG + Intergenic
1196862277 X:120039573-120039595 GACCTCCATAGTCTCTGCGAAGG + Intergenic
1196880825 X:120196771-120196793 GACCTCCATAGTCTCTGCGAAGG - Intergenic
1199553285 X:149079751-149079773 GACGCCCACCATCTCTGTAGGGG - Intergenic