ID: 1147335917

View in Genome Browser
Species Human (GRCh38)
Location 17:39726946-39726968
Sequence TGCCCCCAGCGCCCGGGGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 338}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147335917_1147335927 13 Left 1147335917 17:39726946-39726968 CCCTGCCCCGGGCGCTGGGGGCA 0: 1
1: 0
2: 3
3: 30
4: 338
Right 1147335927 17:39726982-39727004 GCACCGCAGCTCATCTACCAGGG 0: 1
1: 0
2: 0
3: 3
4: 44
1147335917_1147335923 -9 Left 1147335917 17:39726946-39726968 CCCTGCCCCGGGCGCTGGGGGCA 0: 1
1: 0
2: 3
3: 30
4: 338
Right 1147335923 17:39726960-39726982 CTGGGGGCATGGTCCACCACAGG 0: 1
1: 0
2: 0
3: 9
4: 108
1147335917_1147335926 12 Left 1147335917 17:39726946-39726968 CCCTGCCCCGGGCGCTGGGGGCA 0: 1
1: 0
2: 3
3: 30
4: 338
Right 1147335926 17:39726981-39727003 GGCACCGCAGCTCATCTACCAGG 0: 1
1: 0
2: 0
3: 3
4: 77
1147335917_1147335929 26 Left 1147335917 17:39726946-39726968 CCCTGCCCCGGGCGCTGGGGGCA 0: 1
1: 0
2: 3
3: 30
4: 338
Right 1147335929 17:39726995-39727017 TCTACCAGGGTCAGTGCCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147335917 Original CRISPR TGCCCCCAGCGCCCGGGGCA GGG (reversed) Exonic
900341691 1:2192524-2192546 TGCCCCCCGCCCCCCGGGGAGGG - Intronic
900342442 1:2195279-2195301 TGCCCCCAGGGCCCTGGCCCAGG - Intronic
900511290 1:3062304-3062326 TCTCTCCAGCCCCCGGGGCATGG + Intergenic
900866908 1:5275408-5275430 TGCCTCCACCTCCCCGGGCAGGG - Intergenic
901144131 1:7053779-7053801 TGTCCCCAGCGCCCATAGCAGGG + Intronic
901855117 1:12039511-12039533 GGCCTCCAGCTCCCGAGGCAAGG + Intergenic
902311512 1:15584921-15584943 TGCGCCCGGGGCCCGGGGCCCGG - Exonic
903300008 1:22372042-22372064 TACCCTCAGTGCCCGGAGCAGGG - Intergenic
904035563 1:27556957-27556979 TGGCCCCAGGGGGCGGGGCAGGG - Intronic
904296215 1:29521349-29521371 TGCTCCCAGCTCCCAGGGCTTGG - Intergenic
904772207 1:32886628-32886650 CGCCCCCGCCACCCGGGGCAAGG - Intronic
905468785 1:38176020-38176042 TGCCCCCATCACCCAGGGCATGG - Intergenic
905768900 1:40624869-40624891 TGGCCCCAGCACCTGAGGCAGGG - Exonic
905815731 1:40949372-40949394 TGTCCCCAGCACCAGGGGCCTGG + Intergenic
905865165 1:41372498-41372520 TGCTCCCAGGGCCTGGGGCAGGG + Intronic
906475828 1:46168743-46168765 GGCCTCCAGAGCCAGGGGCAGGG - Intronic
908356513 1:63328819-63328841 CACCCCCAGCTCCAGGGGCAGGG + Intergenic
914310073 1:146458652-146458674 TGACCACAGCCCCCGGGGCTTGG - Intergenic
916069308 1:161160727-161160749 TGCCCCCAGGGCCCGCAGCAAGG + Exonic
916070666 1:161167926-161167948 TGACCCCAGCGCCTGGAGCTGGG + Intronic
916500784 1:165384962-165384984 TGCTCCCAGCAGCCAGGGCATGG + Intergenic
918070135 1:181128599-181128621 AGCCTCAAGCGCCAGGGGCAAGG - Intergenic
919892065 1:201982809-201982831 GGCCTCCAGGGCCCGGCGCAGGG + Exonic
919991376 1:202710229-202710251 TGCCCCCACCGGCGGGGGTATGG + Intronic
920117256 1:203629557-203629579 TGCCCCGAGCCCCGGGGGAAGGG - Intronic
921274051 1:213499676-213499698 TGGCCCCAGCCCCCAGGCCATGG - Intergenic
922542560 1:226430026-226430048 AGCCCCCAGTGCCTGGTGCATGG - Intergenic
922725620 1:227921778-227921800 TGCCACCTGCCCCCGAGGCACGG + Exonic
923631092 1:235649897-235649919 AGCCCCCAGCGTCCAGGGCCGGG - Exonic
924387277 1:243510614-243510636 TGTCCCCAGAGCCCGAGGCATGG + Intronic
1064167859 10:13001785-13001807 TGCCCCCTGCGGCTGGGGCGTGG + Intronic
1064392466 10:14953857-14953879 AGCCCCCAGCGCCCCGGGAGCGG + Intronic
1065390349 10:25175782-25175804 TGTGTCCAGCGCCCGGTGCAAGG - Exonic
1067110682 10:43397363-43397385 TGGGCCCAGCGCGCGGGCCACGG - Intronic
1067560401 10:47300852-47300874 GGGCCCCAGCGCCCAGGACATGG + Exonic
1069550498 10:69360664-69360686 TGCCCACAGCCCCTTGGGCAGGG - Intronic
1069823670 10:71242490-71242512 TGCCCCCCTCTCCCTGGGCAGGG + Intronic
1071290563 10:84185837-84185859 TGTCCCCAGAGCCCTGGGCCAGG - Intergenic
1071784108 10:88880207-88880229 GGCACCCAGGGGCCGGGGCAGGG + Exonic
1072913167 10:99521475-99521497 TCCCTGCAGCGCCCGGCGCAAGG - Intergenic
1073288101 10:102400381-102400403 TGCCCGCAGCGCCAGATGCATGG - Exonic
1075197689 10:120375268-120375290 TGCCCCCAGCCCCTGGGGCATGG - Intergenic
1075375416 10:121974801-121974823 CTCCCCCCGCGCCCGGCGCAGGG + Intronic
1075424076 10:122328006-122328028 TGTCCCCAGAGCACTGGGCAAGG + Intronic
1075616064 10:123891666-123891688 TCCGCCCCGCGCCCAGGGCAGGG + Exonic
1075754761 10:124801916-124801938 AGCCCCCAGCGGGCGCGGCAGGG - Intronic
1076713990 10:132354104-132354126 TGCCCAGAGAGCCTGGGGCAGGG - Intronic
1076878861 10:133230410-133230432 TTCCCCCAGCGCGCTGGGCGAGG - Exonic
1077152547 11:1078678-1078700 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152569 11:1078746-1078768 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152590 11:1078811-1078833 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152624 11:1078913-1078935 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152657 11:1079012-1079034 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152669 11:1079046-1079068 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152681 11:1079080-1079102 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152693 11:1079114-1079136 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152714 11:1079179-1079201 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152736 11:1079247-1079269 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152796 11:1079445-1079467 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152818 11:1079510-1079532 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152841 11:1079575-1079597 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152853 11:1079609-1079631 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152903 11:1079776-1079798 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152925 11:1079841-1079863 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152955 11:1079940-1079962 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152994 11:1080073-1080095 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153016 11:1080138-1080160 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153119 11:1080457-1080479 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153281 11:1080931-1080953 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153311 11:1081027-1081049 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153356 11:1081157-1081179 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153386 11:1081253-1081275 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153452 11:1081445-1081467 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153486 11:1081541-1081563 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077234584 11:1473846-1473868 TGCCCCCAGCACCCCGGGGATGG + Intronic
1077235752 11:1481301-1481323 GGCCACCAGCGGCAGGGGCAGGG - Intronic
1077342932 11:2034016-2034038 TGGCCCCAGTGGCCTGGGCAGGG + Intergenic
1080454567 11:32406520-32406542 GGCCCCCAACCCCCGGGCCATGG - Intronic
1080878580 11:36298691-36298713 GGCCCCCAACTCCCGGGCCATGG - Intronic
1083223497 11:61268884-61268906 TGCCCCAAGCCCCCAGGGCAGGG - Intronic
1083304779 11:61756592-61756614 TGTCCCCAGCACCCAGTGCAGGG + Intronic
1083888911 11:65586037-65586059 TGCACCCAGCTCATGGGGCAGGG - Intronic
1083901770 11:65646788-65646810 TGCGCGCGGCGCCCGGGGCGCGG + Exonic
1084621215 11:70271146-70271168 TCGCCCCAGCGCCCGGGTCACGG - Intronic
1085266882 11:75242493-75242515 TGCCCCCAGCACCCTGTGCTTGG + Exonic
1085346082 11:75768911-75768933 TGGCCCCGGGGGCCGGGGCATGG + Exonic
1085642734 11:78203013-78203035 TTTCCTCAGTGCCCGGGGCAGGG - Intronic
1087175472 11:95091197-95091219 TTCCCCCAGCAGCCTGGGCAGGG - Intronic
1088480897 11:110296109-110296131 GACCCCCAGCGCCCTGGGGACGG - Intronic
1090780363 11:130002147-130002169 GGCCCCCAGCCCCCGGTGCTCGG + Intronic
1091327331 11:134701014-134701036 TGCCCTCAGTGGCCAGGGCATGG - Intergenic
1202825918 11_KI270721v1_random:89205-89227 TGGCCCCAGTGGCCTGGGCAGGG + Intergenic
1092615516 12:10212798-10212820 TGCGCCAGGCGCCCAGGGCAGGG - Exonic
1092955098 12:13542543-13542565 TGCTGCAAGTGCCCGGGGCAGGG - Exonic
1094155538 12:27333418-27333440 TGCTCCCAGCGCCGGGTGCAAGG - Intronic
1095810768 12:46371928-46371950 AACCCCCAGCTCCCGGGGCCCGG - Intronic
1096513077 12:52142583-52142605 TGGCCTCAGGGCCTGGGGCATGG + Intergenic
1096693438 12:53334835-53334857 TGTCCCCAGCACCAGAGGCAAGG + Intronic
1098369287 12:69739362-69739384 GGTCCCGCGCGCCCGGGGCAGGG + Intronic
1100460268 12:94792721-94792743 TGCCCCTAGAACCAGGGGCAAGG + Intergenic
1101917077 12:108904040-108904062 GGCCCCCAACCCCCGGGCCATGG + Intergenic
1102470777 12:113158771-113158793 TGCCCCCAGTGCCCAGCACAGGG + Exonic
1102934033 12:116882007-116882029 TGCCCCCAGCGCCCGGTGGGAGG + Intergenic
1103359096 12:120342973-120342995 TGCCCCCAACTCCCCGGGCCCGG - Exonic
1103547594 12:121713032-121713054 TGTCCCCACCGCCCGGGCCGGGG - Intronic
1104014352 12:124952357-124952379 TGCCCCAAGCTACCCGGGCAGGG + Intronic
1104014544 12:124953255-124953277 TTCTCCCAGCGCCAGGTGCATGG - Intronic
1104686275 12:130787197-130787219 GGCCACCCGCGCCCAGGGCAGGG + Intergenic
1104937837 12:132375985-132376007 AGAGCCCAGCGCCCCGGGCAGGG + Intergenic
1105541285 13:21319541-21319563 TGCACCCAGCGGCTGGAGCAGGG + Intergenic
1105864950 13:24451188-24451210 TGCCCCCTGCTCCCAGGTCAGGG - Intronic
1106498834 13:30307676-30307698 TGCGTCCAGCCCCCGTGGCAGGG + Intergenic
1110436292 13:75481464-75481486 AGGCCCCAGCGCCCGGCGCGGGG + Exonic
1113507221 13:110825633-110825655 TGGCCACAGCCTCCGGGGCAGGG + Intergenic
1113737618 13:112689861-112689883 TGCCCCCAGGGTCTGGGGCCCGG + Intergenic
1117157089 14:52951434-52951456 GGCCACCAGCGCCCCGGGAAAGG - Intronic
1121613137 14:95294698-95294720 TGCCCCCAGGACACAGGGCAGGG - Intronic
1121932548 14:97985887-97985909 TGCCCCCAGAGCCTGGGACCAGG + Intergenic
1122923507 14:104889666-104889688 GGCCCCCGGCCCCCGGGACACGG + Exonic
1202898524 14_GL000194v1_random:23221-23243 TGTCCCCAGGGCCCAGCGCAGGG + Intergenic
1125597006 15:40893831-40893853 TGACCCCAGCGCCCAGCCCAAGG + Intergenic
1125918500 15:43510429-43510451 CACTCCCAGGGCCCGGGGCAAGG + Intronic
1128161597 15:65426266-65426288 TGCTCCCAGTGCCCAGAGCAGGG - Intergenic
1128263772 15:66251465-66251487 TACCCCCAGAGCTCGGTGCAGGG + Intronic
1128315150 15:66655226-66655248 CGCCCGCAGCGCCTGGGGCCTGG + Intronic
1128942836 15:71802448-71802470 TGCCCACAGGGCCCCGGGCAGGG + Intronic
1129007330 15:72384845-72384867 GGTCCCCAGCCCCCGGGCCATGG + Intergenic
1129276697 15:74450235-74450257 TGCCCCCAGCAACGGGTGCAAGG + Intronic
1132275425 15:100559191-100559213 TGCCCCCACAGCCTGGGCCACGG - Intergenic
1132289760 15:100691455-100691477 TGCTCCCAGACCCCAGGGCAGGG - Intergenic
1132519811 16:381926-381948 TGCCCCCGGCGCCCATGGCCCGG + Exonic
1132931304 16:2460434-2460456 CGCCCCGAGCGCCCAGGGCTGGG + Intronic
1132987709 16:2776764-2776786 TGCCCTCGGCGCCCGGGGCCCGG + Intronic
1133035307 16:3030900-3030922 TGACCCCAGGGCCCTGGACAAGG - Intronic
1133188551 16:4116675-4116697 GGCCCACAGCGCCCGGAGCGCGG - Intergenic
1133283735 16:4681093-4681115 AGCCCCCAGAGGCCCGGGCAGGG + Intronic
1133784597 16:8964119-8964141 GGCCCCCAGGGCCCGGGGGCAGG - Intronic
1134693649 16:16207259-16207281 TGGCACCAGCCCCCTGGGCATGG + Intronic
1134978197 16:18587384-18587406 TGGCACCAGCCCCCTGGGCATGG - Intergenic
1136400697 16:30016470-30016492 GGCCCCCTGCGCCCAGGTCATGG - Intronic
1136516638 16:30772523-30772545 TGACCCCAGGGCCAGGGGAAGGG - Intronic
1136612021 16:31372106-31372128 TGCCCCTGGCCCCCAGGGCAAGG - Intronic
1137787604 16:51151374-51151396 TGCGCGCTGCGCCCGGGGCCGGG - Intergenic
1138108412 16:54304291-54304313 TGTCCCCAGCGCCCAGCACATGG - Intergenic
1138561319 16:57802397-57802419 TCGCCGCAGCGCCCGGGGCTCGG + Exonic
1138595217 16:58026069-58026091 GGCGCCCAGCGCCTGGGGCCCGG - Exonic
1139691880 16:68646363-68646385 CGCCCCCAGCGTCTGGGGCCTGG + Intronic
1139850828 16:69950915-69950937 TCCTCCCAGGGCCCGGGGCTGGG + Intronic
1139879811 16:70173827-70173849 TCCTCCCAGGGCCCGGGGCTGGG + Intronic
1139971938 16:70781783-70781805 AGCCCCCAGCCCCCAGTGCAGGG + Intronic
1140372712 16:74421721-74421743 TCCTCCCAGGGCCCGGGGCTGGG - Intronic
1140869476 16:79093592-79093614 GGCCTCCAGTGCCCGGTGCAGGG + Intronic
1141375511 16:83526639-83526661 AGCCGCCAGCCCCCGGGCCACGG - Intronic
1141900823 16:86989113-86989135 TGCCCCCAGTGCCGGGGGCCGGG - Intergenic
1142159327 16:88548438-88548460 TGGCACCAAAGCCCGGGGCAGGG + Intergenic
1142184781 16:88689515-88689537 TGCCCCCAGAGCATGGGGCAGGG - Intergenic
1142229321 16:88892349-88892371 TGCCCCCAGCCTGCGGGGCCCGG - Exonic
1142518778 17:491118-491140 TGCCGCCAGCGCGCGGGGATCGG - Intergenic
1142743493 17:1943447-1943469 TCCCCGCAGCCCCCTGGGCAGGG + Intronic
1143551541 17:7633311-7633333 TGCCCCCAGAGCCCAGGCAATGG + Exonic
1145056504 17:19706996-19707018 TGGCCCCAGGGCTCAGGGCATGG + Intronic
1145941413 17:28745092-28745114 TGCCCCCAGAGCGCAGGGGAAGG + Intronic
1146560273 17:33862916-33862938 TGCCCCCAGCTCTCAGAGCAGGG + Intronic
1147335917 17:39726946-39726968 TGCCCCCAGCGCCCGGGGCAGGG - Exonic
1147335919 17:39726949-39726971 TGCCCCGGGCGCTGGGGGCATGG + Exonic
1147388166 17:40093801-40093823 TATCCCCAGTGCCCGGTGCAGGG + Exonic
1147743773 17:42683070-42683092 TGCCGCGCGCGCCCGGGGCTGGG + Intronic
1148000878 17:44386182-44386204 TGCTCCCAGCGCCGGCGCCAGGG - Intronic
1148241405 17:46001770-46001792 TGCCCCCAGGGTCCAGGCCAGGG + Intronic
1148561839 17:48610788-48610810 AACCCCCAGCGCCCGGGCTATGG - Exonic
1149568102 17:57653484-57653506 CGCCCCCGGGGCCCGGGGCTGGG - Intronic
1149568109 17:57653491-57653513 TGCACCCCGCCCCCGGGGCCCGG - Intronic
1149610388 17:57954957-57954979 CGCCCCCCGCGCCCGGGGCCCGG + Intronic
1149710922 17:58741442-58741464 TGTCCCCAACCCCCAGGGCACGG + Intergenic
1150125067 17:62629923-62629945 TGTGCCCAGAGCACGGGGCAGGG + Intronic
1151578320 17:74963749-74963771 GGTCCACAGTGCCCGGGGCAGGG - Exonic
1151886118 17:76924244-76924266 GGCCCCCAGCTCCAGGGGTATGG - Intronic
1152036723 17:77877974-77877996 TGCCCTCAGAGCCCCAGGCAGGG - Intergenic
1152587381 17:81195127-81195149 CCTCCCCAGCGCCCGGGGCCAGG + Intronic
1153480474 18:5543071-5543093 CGCCCCGAGCCCCCGGGCCACGG + Intronic
1154161203 18:11981737-11981759 TGCCCGCAGCGCCAGCTGCACGG - Exonic
1156008599 18:32471026-32471048 GGCCGCCAGCGCCCGCGGCTCGG + Intergenic
1156448779 18:37254583-37254605 TGCCGACGGCGCCCGGGGCGAGG - Intronic
1158421049 18:57294665-57294687 GGTCCCCAGCTCCCGGGCCATGG + Intergenic
1159241725 18:65750900-65750922 GGCCCCCGGCGCCCGAGGCCGGG + Exonic
1160222068 18:76984965-76984987 TGCCACCAGGGCCCCGGGGAAGG + Intronic
1160412081 18:78682004-78682026 TGTCCCCAGCACCCGGACCATGG + Intergenic
1160847806 19:1174064-1174086 GGACCCCTGCGCCCGGGGCTGGG - Intronic
1160901845 19:1432723-1432745 TGGCCCCAGGACCCTGGGCACGG + Intronic
1161069683 19:2253843-2253865 TGTCCCCTGCGCCCGGGGAAGGG - Intronic
1161186831 19:2926831-2926853 TCCCACAAGCCCCCGGGGCAGGG - Intergenic
1161219601 19:3112388-3112410 GGCTCCCAGAGCCCAGGGCAAGG + Intronic
1161266450 19:3366791-3366813 TGCCCCCCGCGCCGAGGGCTGGG + Intronic
1161358644 19:3833920-3833942 TGCCCCCTGCCTCCGGGCCAGGG - Intronic
1161401369 19:4067310-4067332 TGCCCCCGACGCCCGGGGCGTGG + Intergenic
1161438944 19:4279761-4279783 AGCCCCCAGCGCGCGGGGTTCGG + Exonic
1161473557 19:4472886-4472908 GGCCCCCAGACCCCGGGGCGCGG - Intronic
1161482735 19:4518915-4518937 TGCCTCCAGCGCACCTGGCACGG + Intergenic
1161569125 19:5020602-5020624 TTCCCCCAGCGCCCGCGGCCTGG - Intronic
1161719315 19:5894425-5894447 TTCCCCCAGTTCCCAGGGCAGGG - Intronic
1162301119 19:9845829-9845851 AGCCCCCAGCGGCCAGGGCTGGG - Intronic
1162734376 19:12737891-12737913 TGAACTCAGCGCCCGGGGGACGG + Intronic
1163426498 19:17243677-17243699 TGGCCCCAGGTCCCGGGTCAGGG - Intronic
1163821649 19:19499585-19499607 TGCCCCCAGCACCTGGGGTTGGG + Intronic
1164858007 19:31539907-31539929 TTCCCCAAGCGCCTGGTGCACGG - Intergenic
1165772592 19:38387793-38387815 GGCGCCCTGGGCCCGGGGCAGGG + Exonic
1166688755 19:44810662-44810684 TGCCTCCAGCACCCTGGGCAGGG - Intronic
1166885897 19:45960838-45960860 TGCCCCCAGCCCGAGGGGCCTGG - Intronic
1167281549 19:48572167-48572189 TGGCCCCATCTCCTGGGGCAAGG + Intronic
1167383382 19:49150815-49150837 CGCCCCCTACCCCCGGGGCACGG - Exonic
1167431648 19:49458664-49458686 TGCCCTCAGGGCCCTAGGCAAGG - Intronic
1167534655 19:50041965-50041987 TCCCCCCAGCTCCCAGGACAAGG - Intronic
1167659759 19:50789802-50789824 TGCCCTGATCACCCGGGGCAGGG - Intergenic
1167738752 19:51311852-51311874 CCCCCCCTGCGCCCGGGGCCCGG + Exonic
926197306 2:10771748-10771770 TGCCCCCAGTGCCCGGGTGTGGG + Intronic
928452376 2:31388135-31388157 AGCCCCCACCGCCAGGGACATGG + Intronic
929256549 2:39817086-39817108 TGCCCCCTACGCCCGATGCAAGG - Intergenic
934296799 2:91748945-91748967 CGCCTCCAGCGCGCGGGGCTTGG + Intergenic
934663700 2:96156321-96156343 TGTGCCCAGGACCCGGGGCATGG + Intergenic
934768454 2:96893705-96893727 CGTCCCCAGCGCCTGCGGCACGG + Intronic
934774289 2:96927323-96927345 TGCTCCCAGAGCCAGGAGCAGGG + Intronic
936093354 2:109514818-109514840 TGCCCCCCAGGCCCTGGGCACGG + Intergenic
937287971 2:120765121-120765143 AGCCCTCAGCCCCAGGGGCAGGG - Intronic
938406292 2:131035010-131035032 GGCCCGCAGCGCCCGGGGAGAGG - Intronic
941212105 2:162652712-162652734 GGTCCCCAGCCCCCGGGCCATGG - Intronic
946181344 2:217950907-217950929 TTCCCTCGGAGCCCGGGGCAGGG - Intronic
947669790 2:231928911-231928933 TGCCCCAGGCCCCAGGGGCATGG + Intergenic
947715500 2:232337019-232337041 TGCCCCTTGCACCCAGGGCAAGG + Exonic
947734523 2:232447790-232447812 TGCCCCTTGCACCCAGGGCAAGG + Intergenic
948662930 2:239517857-239517879 TGCCCCAAGTGCCTGGGTCATGG - Intergenic
1170706283 20:18747368-18747390 TGGCCCCAGCAGCCTGGGCAGGG + Intronic
1171346421 20:24469536-24469558 TGCCCCGAGCGCCGGGCGCGGGG - Exonic
1172245697 20:33443734-33443756 CTCCCCCAGCGGCCGGGGTAGGG - Exonic
1174452457 20:50628718-50628740 TGTCCCCAGAGCCCAGGACAGGG + Intronic
1174508809 20:51035362-51035384 CTCCCCCAGCGCCCTGGGAATGG + Intergenic
1175769954 20:61617293-61617315 TGTCCCCAGCACCTGGGGCCTGG + Intronic
1175847030 20:62064847-62064869 GGCCCCCGGCGGCCGGGGCGGGG + Exonic
1175960028 20:62631306-62631328 TGCTCCCAGCTCCCAGAGCACGG + Intergenic
1176076111 20:63248952-63248974 TGCATCCAGCCCCCGGGGGAAGG + Intronic
1176079427 20:63264618-63264640 ACCCCGCAGCGCCCAGGGCAGGG + Intronic
1176190696 20:63808327-63808349 TGCGCTCAGCCCCCGGGGCAAGG - Intronic
1176380625 21:6110797-6110819 TGCCCCCAGCGCCCGGGAGGGGG + Intergenic
1176618206 21:9039211-9039233 TGTCCCCAGGGCCCAGCGCAGGG + Intergenic
1178314799 21:31558980-31559002 CGCCCGCAGCCCCAGGGGCACGG - Intronic
1178365822 21:31987968-31987990 TGCACTCAGTGCCCGGGACACGG - Intronic
1178977350 21:37231428-37231450 TGCCCTCAGAGCCCGGAGAAGGG + Intronic
1179496620 21:41775898-41775920 TGCCCCCAGGTCCTGGGGAACGG + Intergenic
1179742847 21:43427443-43427465 TGCCCCCAGCGCCCGGGAGGGGG - Intergenic
1179922882 21:44516643-44516665 AGCCCCCAGAGCCAGGGGCCGGG + Intronic
1179989626 21:44940281-44940303 TGCCCGCAGAGCCCGAGGGAAGG - Intronic
1180144820 21:45913115-45913137 TGTCCCCAGGGCCCAGGTCAAGG - Intronic
1181055823 22:20260112-20260134 TGGCCCCAGCGGGTGGGGCAGGG + Intronic
1181490128 22:23256383-23256405 TTCCCACAGCACCCCGGGCAAGG - Intronic
1181765388 22:25087866-25087888 AGCCCCCAGCACCTGGGGAATGG + Intronic
1182151176 22:28028210-28028232 TGCACCCAGCTCCCTTGGCAAGG - Intronic
1182742630 22:32579697-32579719 TGACCCAAGCGGCTGGGGCAAGG - Intronic
1183299431 22:37051717-37051739 CGCCCCCAGCGCCCGGGAGGAGG + Exonic
1184155074 22:42662171-42662193 GGCTCCCGGCGCCCGGGGCGCGG + Intergenic
1184263920 22:43336477-43336499 TGTTCCCAGCTCACGGGGCAGGG - Intronic
1185056273 22:48580047-48580069 TGCGTCCAGCGGCCGCGGCACGG + Intronic
949919349 3:8988972-8988994 CACCCCCAGCCCCCGGGCCATGG - Intronic
950117104 3:10458211-10458233 TAGTCCCAGTGCCCGGGGCAGGG - Intronic
950195606 3:11007130-11007152 TGAACCCAGACCCCGGGGCAGGG + Intronic
950682420 3:14594315-14594337 TATCCCCAGAGCCCGGGGCAGGG - Intergenic
950766684 3:15278079-15278101 CCCCCACAGGGCCCGGGGCAAGG + Intronic
952942258 3:38453985-38454007 CGGCCCCTGCGCCCGGGGCCCGG + Exonic
953404714 3:42654626-42654648 TGCCCCCGGCGGCCAGGCCAGGG - Intronic
953886095 3:46715133-46715155 TGCCCCCAGTGTCCAGGCCAGGG + Intronic
953901210 3:46845288-46845310 TGAACCCAGGGCCCTGGGCAGGG + Intergenic
954003118 3:47573239-47573261 TTCACCCAGAGCCCAGGGCAGGG - Intronic
954339251 3:49940014-49940036 AGTCCCCTGCGCGCGGGGCACGG + Exonic
954440359 3:50518413-50518435 TGCCCTCAGCGGCCAGTGCAAGG + Intergenic
961322207 3:126083948-126083970 AGCCCCCAGGGCCCGGCGCCCGG + Intronic
961680636 3:128597752-128597774 CGGCCCCAGTGCCCAGGGCATGG - Intergenic
961858189 3:129893459-129893481 CGCCGCCAGCGTCCGGGGCGGGG + Intronic
962007382 3:131361959-131361981 TGGCCCCAGCGCCAGGGCCTCGG - Intergenic
962423373 3:135248072-135248094 TGTCCCCAGCTCCTGGTGCAGGG - Intronic
966913728 3:184573544-184573566 TGGCCCCAGGGCCAAGGGCACGG + Intronic
967037876 3:185661693-185661715 TGTCCCCAGCACCCGGGACCCGG - Intronic
968474805 4:799194-799216 TTCCTCCAGGGCACGGGGCAGGG - Intronic
969075627 4:4575537-4575559 GGCCTCCAGCGCCCGGCGCCCGG + Intergenic
969142859 4:5094958-5094980 AGCCCACAGTGCCCAGGGCAGGG - Intronic
969700074 4:8763046-8763068 TGCCCACAGCGGCCTTGGCAGGG + Intergenic
972324168 4:37999513-37999535 TGCCCCCAGCGCGTGGTGTAGGG + Intronic
972533136 4:39977846-39977868 AGGCCCCGGCTCCCGGGGCACGG - Exonic
977408524 4:96632084-96632106 TGTCCCCAGCCTCCGGGCCATGG + Intergenic
977848243 4:101791227-101791249 TTTCCCCAGCACCCGGGTCAGGG + Intronic
990545533 5:56816658-56816680 CGCCCCCAGCGCCGGCCGCAGGG + Intronic
991245673 5:64506344-64506366 AGCGCCCAGCTCCCGGGACAGGG + Exonic
992081654 5:73239286-73239308 TGCCGCTAGCGCCCGGGACTAGG - Intergenic
996171050 5:120292300-120292322 TGCCCCCAGCACCTGGAGGATGG - Intergenic
996567698 5:124897499-124897521 TGTCCCCAGCCCCCAGGCCATGG + Intergenic
999199368 5:149805018-149805040 TGCCTCCAGCTCGCTGGGCATGG + Intronic
999238687 5:150115077-150115099 TGCTCCAAGTGCCCTGGGCAAGG + Exonic
1001450730 5:171822393-171822415 TGTCCCCTGAGCCCAGGGCAGGG + Intergenic
1001601432 5:172931423-172931445 TGTCCCCAGAGCCCCGTGCAGGG - Intronic
1001670068 5:173466525-173466547 TGCCCCCAGTGCCCGGGAGGTGG + Intergenic
1001683552 5:173576168-173576190 TGCCACCAGATCCCGAGGCAGGG - Intergenic
1002181374 5:177432751-177432773 TGCACCCAGCGGCTGGAGCAGGG + Exonic
1002364585 5:178700131-178700153 GGCCCCCGTCGCCCTGGGCATGG + Intergenic
1002471209 5:179437357-179437379 TGCCCCCAGGGCCAGGAGCAAGG + Intergenic
1002888729 6:1316901-1316923 GGCCCCCCGCGCCGAGGGCAGGG + Intergenic
1003139152 6:3456742-3456764 GGGCCGCAGCGCCCGGGGCGCGG - Intronic
1004864214 6:19837631-19837653 TGCCCCGAGCGCGCCGGGCGCGG + Exonic
1006183852 6:32169405-32169427 TGCCCCCAGTGCCCACGGAAGGG - Exonic
1006304076 6:33208503-33208525 GGGCCCCAGCGCCCGGGCCATGG + Exonic
1006429153 6:33984503-33984525 TTCCCCCAGCGCCCCTGGCCTGG - Intergenic
1006454309 6:34123212-34123234 TCACCCCAGCGCCCGCAGCAGGG + Intronic
1006460476 6:34154951-34154973 TGCACCCAGCGGCCGGGCCTGGG + Intronic
1007633058 6:43283427-43283449 AGCCCCCGGGGCCTGGGGCAGGG + Exonic
1007662768 6:43496646-43496668 TTCCAACAGGGCCCGGGGCAGGG - Intronic
1012399270 6:98831528-98831550 GGGCCCCAGAGCCCGGGGCGGGG + Intergenic
1012437125 6:99226515-99226537 AGCCCCCAGACCCCAGGGCATGG + Intergenic
1018013635 6:159693418-159693440 TACACCCCGCGCCCAGGGCACGG + Intronic
1018376404 6:163217534-163217556 GGTCCCCAGCCCCCGGGCCATGG + Intronic
1019486921 7:1293635-1293657 AGCCCCCAGGGTCCGGGCCAGGG - Intergenic
1019685038 7:2377083-2377105 TGCCCCCACCCCCGGGTGCAGGG + Intronic
1019712440 7:2523791-2523813 TGTCCCCAGCCCCCAGGTCAGGG - Intronic
1023119213 7:36892495-36892517 TGCCCCCAGCACCTTGAGCAGGG + Intronic
1023984975 7:45088983-45089005 TGCCCCCACCGCCCGGCCGAGGG - Intergenic
1025262222 7:57426788-57426810 TGCCACCAGAGCCAGGGGCACGG + Intergenic
1025739572 7:64184016-64184038 TGCCACCAGAACCAGGGGCACGG + Intronic
1026000929 7:66558446-66558468 TGCCACCAGAGCTAGGGGCATGG + Intergenic
1026626994 7:72003379-72003401 TGTCCCCAACTCCCGGGCCATGG + Intronic
1026800237 7:73395847-73395869 TACCCTCAGCGCCCAGGGCATGG + Intergenic
1026806928 7:73434562-73434584 TGCCGCCCGCGCCCGGGCCCAGG - Exonic
1030062675 7:105635339-105635361 TGCCCCCAGCCCGAGGGGCCTGG - Intronic
1032467084 7:132152962-132152984 TGCCCCCAGTGTGCTGGGCATGG + Intronic
1033339140 7:140478770-140478792 TGCCTCCGGCTCCCGGGGCTCGG - Intronic
1034553744 7:151837027-151837049 TCCTCGCAGCGCCCAGGGCAGGG - Intronic
1035232857 7:157476783-157476805 TGCCCCCAAAGCCCAGGCCAAGG - Intergenic
1035755323 8:2026732-2026754 GACCCCCAGCCCCCGGAGCAGGG - Intergenic
1036205819 8:6805222-6805244 AGCTCCCATGGCCCGGGGCAGGG - Intergenic
1037815215 8:22108387-22108409 TGCCCCCTGGTCCCGGGGCGAGG - Intronic
1040567579 8:48581643-48581665 TGTCCCAAGCGCCCGGAGCCCGG - Intergenic
1041260709 8:56018755-56018777 GGCCCCCAGGGCCCGGGGCAAGG + Intergenic
1042526140 8:69766834-69766856 TGTCCCCAGTGCCCTGCGCATGG + Intronic
1042876945 8:73448862-73448884 GGCCCCTAGCGCCCACGGCAGGG - Intronic
1048872744 8:138812609-138812631 TGCCACCAGCGCCCAGAGGAGGG - Intronic
1049257958 8:141623921-141623943 TTCCGCCAGCGCCCAGGACAAGG + Intergenic
1049406948 8:142455827-142455849 TGCCCCCAGGGCCCGGTGGTCGG - Intronic
1049620938 8:143598010-143598032 CGCCCCCCGCGCCCGGGCCGCGG + Exonic
1053312912 9:37030572-37030594 TGCCCCCAGCGCCTAGCACAGGG - Intronic
1055030534 9:71768609-71768631 TGCCCCGAGCCTCGGGGGCAGGG + Exonic
1057684506 9:97220960-97220982 TGCCCGCAGCGCCTGAGGCGGGG - Intergenic
1057869693 9:98708618-98708640 TGCCTCTGGCGCCCGGGGCCTGG - Exonic
1058923492 9:109640311-109640333 TGCCCCCAGTGGGCTGGGCATGG - Intergenic
1059459957 9:114423398-114423420 AGCCCCCAGGCCCCGGGGCTGGG - Exonic
1059691116 9:116687197-116687219 GGCCCCAAGCGCGCGGGGCAAGG - Intronic
1060481349 9:124018363-124018385 CGCCCCCAGTGCCCGGGGGCGGG - Intronic
1060572668 9:124656877-124656899 TGTCCCCAGGGCCTGGGGGAGGG + Intronic
1060588119 9:124799461-124799483 TGCTACCAGTGCCCGTGGCAGGG - Exonic
1060670814 9:125467703-125467725 TGCCCCCAGCTCCCGGGGCTGGG + Intronic
1061158942 9:128882327-128882349 TGCCCCGGGCGCCCCGGGCCGGG - Intronic
1061165009 9:128917213-128917235 TGCACCCTGCGCCCAGGGAAAGG - Exonic
1062665722 9:137670440-137670462 TGCACCCAGCACCGGGGGGAGGG - Intronic
1185503993 X:619018-619040 CCCCCGCAGCGCACGGGGCAGGG - Intergenic
1185747404 X:2583969-2583991 CGCCCCCAGCGCCAGGGCCATGG - Intergenic
1187525858 X:20054525-20054547 AGCACCCAGGGCCCGGGCCAGGG - Intronic
1188085278 X:25895494-25895516 GGTCCCCAGCGCCCAGGGAAAGG + Intergenic
1189720126 X:43907285-43907307 TTCACCCAGCACCAGGGGCAAGG - Intergenic
1190101711 X:47527160-47527182 TGCTGCCTGGGCCCGGGGCAGGG - Intergenic
1190911532 X:54776074-54776096 TGCCCCCAGCAGCTGAGGCACGG + Intronic
1194623527 X:96201785-96201807 TGCCCCCACACCCCAGGGCATGG - Intergenic
1195473696 X:105260811-105260833 AGCTCCCAGGGCCGGGGGCAGGG - Intronic
1196747203 X:119081726-119081748 TGGCCACAGGGCCCTGGGCATGG + Intronic
1197720565 X:129742187-129742209 TGCCCCCTGCCCCCCGCGCACGG + Intronic
1200012973 X:153133986-153134008 TGCCCCCAGCGCCTAGGCCAAGG - Intergenic
1200026628 X:153265937-153265959 TGCCCCCAGCGCCTAGGCCAAGG + Intergenic
1200092836 X:153643892-153643914 TGGCCCCAGCCCCCAGTGCAGGG - Intronic
1201151595 Y:11098048-11098070 TGTCCCCAGGGCCCAGCGCAGGG + Intergenic
1201565815 Y:15364441-15364463 TGCCCCAAGCACCTGGGTCATGG - Intergenic