ID: 1147336654

View in Genome Browser
Species Human (GRCh38)
Location 17:39730362-39730384
Sequence GGCCCGCGGGACCAGGGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147336641_1147336654 -2 Left 1147336641 17:39730341-39730363 CCCGTGGACCCACCTCCGTCCGG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1147336654 17:39730362-39730384 GGCCCGCGGGACCAGGGTGCGGG 0: 1
1: 0
2: 3
3: 23
4: 201
1147336640_1147336654 1 Left 1147336640 17:39730338-39730360 CCTCCCGTGGACCCACCTCCGTC 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1147336654 17:39730362-39730384 GGCCCGCGGGACCAGGGTGCGGG 0: 1
1: 0
2: 3
3: 23
4: 201
1147336645_1147336654 -10 Left 1147336645 17:39730349-39730371 CCCACCTCCGTCCGGCCCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1147336654 17:39730362-39730384 GGCCCGCGGGACCAGGGTGCGGG 0: 1
1: 0
2: 3
3: 23
4: 201
1147336643_1147336654 -3 Left 1147336643 17:39730342-39730364 CCGTGGACCCACCTCCGTCCGGC 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1147336654 17:39730362-39730384 GGCCCGCGGGACCAGGGTGCGGG 0: 1
1: 0
2: 3
3: 23
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147336654 Original CRISPR GGCCCGCGGGACCAGGGTGC GGG Intronic
900146771 1:1162035-1162057 GGCCTGGGGGACCAGGGGTCTGG - Intergenic
900160476 1:1220883-1220905 GGAACGCGGGACCGGGGTGGAGG + Intronic
900169309 1:1258582-1258604 GGCCCGTGGGTGCAGGGTGGGGG - Intronic
900515726 1:3081404-3081426 GGCCGGCCGGGCCAGGCTGCAGG - Intronic
901034605 1:6328857-6328879 GGCCCTCGGGGCCTGTGTGCTGG + Intronic
901427127 1:9189398-9189420 GGCCCCCGAGACCAGGGGCCTGG + Intergenic
902368124 1:15990450-15990472 GGCCTCCTGGGCCAGGGTGCTGG - Intergenic
902401909 1:16162547-16162569 TGCCCGCGGGGCCTGGATGCGGG + Intergenic
902553423 1:17232851-17232873 GGCTGGAGGGACCAGGGAGCGGG - Exonic
902920661 1:19664757-19664779 GGCCCACAGGCCCGGGGTGCCGG + Intergenic
904563352 1:31413197-31413219 GGACCTCGGGATCCGGGTGCCGG - Intronic
905448860 1:38044923-38044945 AGCCTGCGGGTCCAGGGTGGGGG - Exonic
906551321 1:46668420-46668442 GGCGCGCGGAACCTCGGTGCCGG - Exonic
906960795 1:50418603-50418625 GGCCCGCGGGAACAGGGCTGGGG + Exonic
908355389 1:63322315-63322337 GGCCCTGGGGCCCAGGGAGCGGG - Intergenic
908511180 1:64850987-64851009 GGGCCGTGGGACCGGTGTGCGGG + Intronic
909094550 1:71271095-71271117 GGGCCGCGGGTCCAGGCTGGAGG + Intergenic
910676439 1:89821151-89821173 GGGCCGCGGGAGCAGGGTCCAGG + Exonic
920574687 1:207050820-207050842 GTCCAGCCGGACCCGGGTGCGGG - Exonic
922029415 1:221783576-221783598 GGTCTGCAGGACCCGGGTGCGGG - Intergenic
922199954 1:223393382-223393404 GGACCTCGGGACCGGGGGGCAGG + Intergenic
922705159 1:227786837-227786859 AGGCGGCGGGACCAGGGTCCCGG + Intergenic
922937194 1:229431949-229431971 GGCCGGCGGGGCCTGGGGGCCGG + Intronic
924707916 1:246513260-246513282 GGCCTCCTGGGCCAGGGTGCCGG + Intergenic
1062890690 10:1057238-1057260 TGCCAGAGGGACCAGGGTGCGGG + Intronic
1065021957 10:21508861-21508883 GGCCCGCGGGTCCCGGGCGCCGG - Intergenic
1066321620 10:34308577-34308599 GGCTCGCGGGAGCAGTTTGCGGG + Intronic
1070162345 10:73874032-73874054 GGCGCGTGGGACCTGGGTTCAGG + Intronic
1070850683 10:79559608-79559630 GGCGGGCGAGACCAGAGTGCTGG + Intronic
1070856537 10:79611679-79611701 GGCGGGCGAGACCAGAGTGCTGG - Intronic
1072199555 10:93145906-93145928 GGCCACAGGGACCAGGGAGCTGG - Intergenic
1073325560 10:102642632-102642654 GGCCCGCGGGACCAGCCGGAGGG - Intergenic
1074183742 10:111083946-111083968 GGCCTGAGAGTCCAGGGTGCAGG + Intergenic
1074325586 10:112447479-112447501 GCCCGGCTGGACGAGGGTGCTGG + Intronic
1075581219 10:123620035-123620057 GGTCTGCCGGACCAGGGTTCTGG + Intergenic
1075604694 10:123796091-123796113 GCCCAGCGGGTCCAGGATGCCGG + Intronic
1076538113 10:131195893-131195915 GGCCAGTGGGGACAGGGTGCAGG - Intronic
1076739937 10:132478104-132478126 GGCCCTGGGGCCCAGGGAGCCGG + Intergenic
1076889551 10:133276960-133276982 GGCGCGCGGCACCTGGGGGCGGG + Intergenic
1077051530 11:568913-568935 GGCCCGCGGGACGCGGGTGCGGG - Intergenic
1077137176 11:1006276-1006298 GGGCCGAGGGAGGAGGGTGCTGG + Intronic
1077142567 11:1030953-1030975 GGCCTGCCGGACGTGGGTGCTGG + Exonic
1077218718 11:1405847-1405869 GGCCTGCGGGGCCAAGGAGCAGG - Intronic
1077352585 11:2099780-2099802 GGCCCTCGTGGCCAGGCTGCTGG + Intergenic
1077420995 11:2449905-2449927 GGGCAGCGGGTCCAGGGAGCTGG + Intronic
1077919106 11:6630101-6630123 GGGCCGCGGGCCCAGGCGGCTGG + Exonic
1078432487 11:11298565-11298587 GGCCCTCGGGACCAAGCTCCCGG - Intronic
1081528632 11:43943346-43943368 GTCCCCCGGGAGCAGGGCGCGGG - Intronic
1081867298 11:46366838-46366860 GGCCCCCAGGGCCAGGGTGCTGG - Exonic
1081938179 11:46918680-46918702 GGGTCGGGGGACCAGGGAGCCGG - Intergenic
1081992164 11:47343660-47343682 GGCCTGGGGGAGCAGGGTGCGGG - Intronic
1083720497 11:64601376-64601398 GGCCCCCGAGAGCAGGGTGGTGG + Intronic
1083758282 11:64802819-64802841 CGCCCGCGGGCGCGGGGTGCGGG - Intronic
1084064262 11:66694272-66694294 GCCCAGGAGGACCAGGGTGCAGG - Exonic
1084546576 11:69817924-69817946 GGGCCGCGGGTCCTGCGTGCGGG + Intronic
1084588715 11:70078347-70078369 GGCCCGCGGGACCAGCAGCCGGG + Exonic
1085385090 11:76153048-76153070 GGCCCCAGGGACCAGGCTTCAGG + Intergenic
1089392738 11:118113174-118113196 GGCCCTAGGGATCGGGGTGCTGG - Intronic
1090832396 11:130428418-130428440 GGCCCGCGGGGCCCGGCGGCGGG + Exonic
1092831912 12:12452507-12452529 GGCACTGGGGGCCAGGGTGCGGG + Intronic
1096498399 12:52051498-52051520 CGCACGCGGGACCAGGGACCAGG + Intronic
1102101313 12:110281113-110281135 GGCGCGCGGGAGGAGGGAGCCGG + Intronic
1104906388 12:132215671-132215693 GCCTCGTGGGACCCGGGTGCTGG - Intronic
1106187845 13:27424730-27424752 GGCCGGCGGATCCAGGGCGCCGG - Exonic
1106419331 13:29572468-29572490 GACCCGCGGCACCAGGGCGTGGG + Intronic
1112467625 13:99658040-99658062 GGACCGCGGCACCAGCGGGCAGG - Intronic
1122532480 14:102438228-102438250 GGCGAGCGGGAGCAGGGAGCGGG - Intronic
1122544959 14:102517103-102517125 CGCCCCCGGGGCCAGGGCGCTGG - Intergenic
1123044610 14:105505238-105505260 CGTCCACGGGCCCAGGGTGCTGG - Intergenic
1124640558 15:31393512-31393534 GGACCGAGGGACAAGGGTGCTGG - Intronic
1126348026 15:47717273-47717295 GGGCCGCGGCGCCAGGGTGGGGG + Intronic
1126767089 15:52019714-52019736 GGCGTGCGGGGCCAGGGAGCGGG - Intronic
1129392237 15:75226245-75226267 GTGCTGCGGGACCAGGGAGCTGG + Intergenic
1129746853 15:78028068-78028090 GGCCAGCAGGAATAGGGTGCAGG - Intronic
1133025475 16:2987331-2987353 GGCCTTCTGGACCAGGGTGCAGG + Intergenic
1135407141 16:22206584-22206606 GGCCCGGAGCTCCAGGGTGCAGG - Exonic
1136406840 16:30053196-30053218 TGCCCGCGGCCCGAGGGTGCAGG + Exonic
1136542453 16:30935715-30935737 AGCCCCCGGGAACAGGGAGCTGG - Intronic
1141149362 16:81553304-81553326 GGCAGGCGGGACCTGGCTGCAGG + Intronic
1142226532 16:88880392-88880414 GGCACGCGGGGCCAGAGTCCGGG - Intronic
1142230950 16:88900083-88900105 GGACGGCGGGCCCAGCGTGCAGG - Intronic
1143598520 17:7929587-7929609 GGCCCGCGGGGGCGGGCTGCTGG + Intronic
1144956799 17:19022782-19022804 GGCAGGCAGGGCCAGGGTGCTGG - Intronic
1145760929 17:27425252-27425274 GGCCTCCTGGGCCAGGGTGCCGG - Intergenic
1146160969 17:30559409-30559431 GGCCTCCTGGGCCAGGGTGCCGG - Exonic
1147139588 17:38453786-38453808 GGCCCGCGGCTCCGGGGGGCGGG + Intronic
1147336654 17:39730362-39730384 GGCCCGCGGGACCAGGGTGCGGG + Intronic
1148132604 17:45270993-45271015 GGCCCTGGGGCCCAGGCTGCAGG - Intronic
1148691446 17:49529152-49529174 GGCCCCAGGGCCCAGGCTGCAGG - Intergenic
1149995577 17:61404531-61404553 TGCCCGCGGGAGCAGCGAGCAGG + Intronic
1150211813 17:63446061-63446083 AGCCCTCGGGCCCAGGGTGCGGG + Exonic
1151449017 17:74186007-74186029 GGCCCGGGGGGCCAGGGTTCAGG + Intergenic
1152087957 17:78231861-78231883 GGCCCGCGAGGCCAGTGCGCGGG + Exonic
1152150556 17:78597491-78597513 GGCCAGCAGGCCCAGGGGGCAGG + Intergenic
1152356497 17:79810116-79810138 GGCGCGCGGGCCCCGGGAGCCGG - Intergenic
1152788292 17:82263755-82263777 GGCCTGCGGGAGCCTGGTGCTGG - Intronic
1152801359 17:82332368-82332390 CGCCCGGGGCACCAGGGAGCGGG - Intronic
1154125632 18:11689709-11689731 GCCCCGAGGGAGCAGGGTCCGGG - Exonic
1155902254 18:31406225-31406247 TGCCCGCGGCACCAGAGTCCAGG - Exonic
1156448703 18:37254360-37254382 AGCGCGCGGGCACAGGGTGCCGG + Intronic
1157614004 18:48976169-48976191 GGCCCGCGGGAGCGGGGCGGCGG + Intergenic
1157842069 18:50968050-50968072 GGACAGCTGGGCCAGGGTGCGGG + Exonic
1158931054 18:62325345-62325367 GGCGCGCGGGGCCATGGCGCGGG - Exonic
1160201760 18:76801944-76801966 GGCCAGGGCGAGCAGGGTGCGGG + Intronic
1160744469 19:704152-704174 GGGAGGCGGGACTAGGGTGCAGG + Intergenic
1160762381 19:791993-792015 GGCCTGAGGGCCCAGGGTGGGGG + Intergenic
1160909317 19:1467554-1467576 AGCCCGGGGGACCAGCGGGCAGG + Exonic
1161006880 19:1941455-1941477 GGCGCCCAGGGCCAGGGTGCAGG - Intronic
1161915604 19:7225755-7225777 GGACCCCTGGACCAGGGTGCTGG - Intronic
1162145339 19:8609616-8609638 GGCCTGCGGGAGGAGGGGGCCGG + Intronic
1162746482 19:12801546-12801568 GGCCCGCACGAGCAGGGGGCGGG + Intronic
1162792909 19:13072216-13072238 GACCAGGGGGACCAGGGTGGGGG + Intronic
1163123416 19:15231729-15231751 GGCCCACGGGACTCGGGGGCAGG - Intronic
1163268450 19:16235084-16235106 GGCCTGCGAGTCCAGGGAGCAGG - Exonic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1163695625 19:18761911-18761933 GCCCCGCGGGCCCAGGGCCCAGG - Intronic
1164722736 19:30444272-30444294 AGCCTGCAGGGCCAGGGTGCAGG - Exonic
1165784462 19:38453041-38453063 GGCCTGTGGGCCCAGGGGGCGGG + Intronic
1166106375 19:40600103-40600125 GGCCCCGGGGGCCAGGGGGCCGG + Exonic
1166386865 19:42387300-42387322 GACCCGCGGGAGCAGGGAGCTGG - Intronic
1166795474 19:45423182-45423204 GGCCTGTGGGACCAGGGTGTGGG - Intronic
1167258259 19:48443557-48443579 GGCCCGGCGGCCCAGGGTGGAGG - Exonic
1167423196 19:49415649-49415671 GGGCTTCGGGGCCAGGGTGCTGG - Intronic
1168134117 19:54338869-54338891 GGGCCCCAGGACCCGGGTGCAGG - Exonic
930719762 2:54627788-54627810 GGCCAGCGGGGCCAGGGTGGGGG - Intronic
932498283 2:72158486-72158508 GGCCCACGGGAACTGGGTCCTGG - Intergenic
932534774 2:72581678-72581700 GGCCAGCAGGGGCAGGGTGCGGG - Intronic
938729043 2:134131700-134131722 GGGGCGGGGGACCAGGGTGGGGG - Intronic
940211658 2:151261620-151261642 GGCGCGACGGGCCAGGGTGCAGG - Intronic
942653704 2:178194264-178194286 ACCCCGCGTGACCAGGGCGCAGG + Intergenic
942681212 2:178480139-178480161 TGCCCGCGGGATGAGTGTGCGGG + Intergenic
944505190 2:200403792-200403814 GGCCTGTGGGTCCATGGTGCTGG - Intronic
946171866 2:217900432-217900454 GGCCCGTGGGGGCAGGGGGCGGG - Intronic
946616671 2:221517538-221517560 GGCCACCTGGACCAGGGTGGAGG + Intronic
947398973 2:229714082-229714104 GGCCGGCGGGAAGAGGCTGCTGG + Intronic
947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG + Intergenic
948625626 2:239266287-239266309 GGCTCCTGGGACCAGGGTCCCGG - Intronic
948711408 2:239827795-239827817 GGCCCGGGGCCCCAGGGTGGTGG - Intergenic
948805755 2:240452967-240452989 GGCGCGCGGGCTCTGGGTGCAGG - Intronic
949000407 2:241610066-241610088 GGCCCTCGGGACCCAGGGGCCGG - Intronic
949040290 2:241844967-241844989 GGGCCGCGGGAGCAGGGAGGAGG - Intergenic
1172474568 20:35226993-35227015 GGCGCGCGGGGCCGGGGCGCGGG + Intronic
1172938419 20:38637768-38637790 GACCAGCGGGACCTGTGTGCTGG - Exonic
1173279957 20:41618722-41618744 GTCCCGCGGGCCGAGGGGGCGGG + Intergenic
1174402952 20:50285729-50285751 GTCCCGGGGGACCAGGAGGCCGG - Intergenic
1174461281 20:50684686-50684708 GGCCGCTGGGACCAGGGTGGAGG + Intronic
1174507002 20:51023294-51023316 GGCCCCCGGATCCAAGGTGCGGG - Intergenic
1175519111 20:59588402-59588424 GGCCCCAGGGACCAGGGGGACGG - Intronic
1175561544 20:59934113-59934135 GGACCGGGGGACCAGGGCGCCGG + Intronic
1175900839 20:62359339-62359361 GGCCCGCTGGGCTAGCGTGCTGG + Intronic
1175958800 20:62624607-62624629 GGGACGCGGGACCAGGGCCCTGG + Intergenic
1176125558 20:63473057-63473079 GGCCCGCGGGACCAGAGCTCTGG + Intergenic
1176146389 20:63567386-63567408 GGCCCGTGAGCTCAGGGTGCCGG - Exonic
1176217878 20:63956773-63956795 GCCACTCGGGACCAGGGCGCGGG + Exonic
1176270584 20:64233833-64233855 GGCCCGCTGGACAAGGTTGGAGG + Intronic
1179457085 21:41507494-41507516 GGACCGCTGGGCCAGGCTGCTGG - Intronic
1179576311 21:42310532-42310554 GGCCGGGGGGACCACAGTGCAGG + Intergenic
1179893674 21:44350204-44350226 GCCCCGCGGGGCCAGGGCGGCGG + Intronic
1180954855 22:19737021-19737043 TGCCCAGGGGTCCAGGGTGCCGG + Intergenic
1183455680 22:37921986-37922008 AGCCCCAGGGAGCAGGGTGCTGG - Exonic
1183521492 22:38298396-38298418 GGCCCGAGGGGCCATGGTGCAGG + Intronic
1183692745 22:39400026-39400048 GGCCCCCGGGTCAAGGGCGCCGG + Intronic
1184842252 22:47058863-47058885 GGCCCGCTGGACCCAGGTGAAGG + Intronic
1185095749 22:48805092-48805114 GGCCTCCTGGACCACGGTGCTGG + Intronic
950542964 3:13623079-13623101 GGCACACGGGCCCATGGTGCTGG + Intronic
951411600 3:22372828-22372850 GGCCCGCGGCCTGAGGGTGCCGG + Intronic
959926504 3:111927471-111927493 GGCCCGCGTGCCTAGAGTGCTGG + Intronic
961551497 3:127672714-127672736 CGCCCGCGGGGCCGGGGTTCAGG - Exonic
961665910 3:128492981-128493003 GGCTCGCGGGACCTGGGCGCGGG + Exonic
963827309 3:149970280-149970302 GGCGCGCGGGCCCCGGGTGGAGG - Intronic
966516689 3:180828441-180828463 GGCCCGCCGGCCCTGGGTGATGG + Intronic
966874526 3:184314772-184314794 GGGCCGCGGGGCCAGGGCGCCGG - Intronic
968077861 3:195826182-195826204 GGCCAACGGGCGCAGGGTGCTGG + Intergenic
968519829 4:1030285-1030307 GTCCCGGGGGACAAGAGTGCTGG + Intergenic
968619825 4:1599068-1599090 GGCCAGGGGATCCAGGGTGCCGG + Intergenic
968619846 4:1599134-1599156 GGCCAGGGGATCCAGGGTGCTGG + Intergenic
968619868 4:1599200-1599222 GGCCAGGGGATCCAGGGTGCCGG + Intergenic
968619887 4:1599266-1599288 GGCCAGGGGATCCAGGGTGCCGG + Intergenic
968668826 4:1836858-1836880 GGCCCCCGAGCCCAGAGTGCTGG - Intronic
968690599 4:1987889-1987911 GGCTCACGGCACCAGGGTGGGGG + Intronic
968809368 4:2793099-2793121 GGCCCGCGGGCCCTGGGTCGAGG - Intronic
969456138 4:7300744-7300766 GGCCAGCGGGACCAGGGTCACGG - Intronic
973774965 4:54233803-54233825 CGCCCGCGGGGCAAGGGAGCTGG - Intronic
978382069 4:108139560-108139582 GGCCAGCAGGGCCAGGGTGGAGG - Intronic
985145162 4:186889054-186889076 GGCCCCGGGGCCCACGGTGCTGG + Intergenic
985644628 5:1079101-1079123 GCCCCGCGGGCCCAGCCTGCCGG + Intronic
985969867 5:3366387-3366409 GGACCGGGTGGCCAGGGTGCTGG - Intergenic
997309405 5:132867048-132867070 GGCCCGCGGGAGCGGGAGGCTGG + Intronic
1001845617 5:174918219-174918241 GGCCAGCGGGGACAGGGTGCAGG - Intergenic
1002293445 5:178214920-178214942 GGCCTGAGGGGCCAGGGTGCTGG + Intronic
1003871336 6:10405097-10405119 GGACCACGGGTTCAGGGTGCAGG + Intronic
1004861037 6:19804909-19804931 GGCGCGCGGGAGCTGGGTGCAGG + Intergenic
1006472964 6:34238267-34238289 GGCCGGCGGGACCCGGGGCCAGG - Intronic
1007776484 6:44227076-44227098 GGCCTGCTGGGCCAGGGGGCTGG + Intronic
1010244857 6:73653689-73653711 GTCCCGCCGGCGCAGGGTGCGGG + Intronic
1010569972 6:77464140-77464162 CTCCCGTGGGACCAGGGTGGCGG - Intergenic
1013458976 6:110357866-110357888 GGCCTGCGGGACCTGAGCGCCGG + Intronic
1016713976 6:147203652-147203674 GGCCTGCTGGGCCAGGGTGGGGG + Intergenic
1018651046 6:165991442-165991464 AGCCAGTGGGACGAGGGTGCTGG + Intergenic
1019409703 7:901165-901187 GGCCCTCTGTTCCAGGGTGCTGG - Intronic
1020083970 7:5300667-5300689 GGCCCGCGGGACGTGGGGGTGGG + Intronic
1022020942 7:26398813-26398835 GGCTCCCGGGACCAGCGGGCGGG - Intergenic
1024499810 7:50093117-50093139 GGCCCGAGAGAGCAGGGAGCCGG + Exonic
1024676966 7:51645879-51645901 GGCCCGCGGGGCCAGGACGGTGG - Intergenic
1025210302 7:57016523-57016545 GGCCCGCGGGACATGGGGGTGGG - Intergenic
1032117063 7:129126502-129126524 GGCCCGCGGAGCCCGGATGCTGG + Intergenic
1034472445 7:151262666-151262688 GCCCCGCGGGAGCAGGGAGGAGG + Intronic
1034895389 7:154873052-154873074 GACCCACGGGCTCAGGGTGCGGG - Intronic
1034983230 7:155491432-155491454 GGCTCCCGGGACCAGGGTGCAGG + Intronic
1038421662 8:27437693-27437715 GAGCCAGGGGACCAGGGTGCTGG - Intronic
1038540243 8:28385575-28385597 GGCGCGCGAGGCCAGGCTGCGGG - Intronic
1040386175 8:46916396-46916418 AGCCAGCGGGGCCAGGGTGTGGG + Intergenic
1042591356 8:70402419-70402441 GGCCTGCGGGACCGAGGGGCGGG - Intronic
1047411352 8:124627149-124627171 GGCCAGAGGTACCAGGTTGCAGG - Intronic
1048161337 8:132024609-132024631 GGGCTGCGGGCACAGGGTGCAGG + Exonic
1049593436 8:143472784-143472806 GTCCCGCGGGTGCACGGTGCAGG + Intronic
1051482910 9:17578962-17578984 GGCGCGCGGTACCTGGATGCTGG - Intergenic
1053022026 9:34701606-34701628 GGACGGCGGGGCCAGGGAGCCGG - Intergenic
1054764987 9:69035850-69035872 CGGCCGCGGGACCCGGGTGAGGG - Exonic
1056406755 9:86282469-86282491 GGCCCGAGGCACCGGGGCGCCGG - Exonic
1056711015 9:88991715-88991737 GGGGCGCGGAACCAGGGTGGGGG + Intronic
1057516867 9:95729271-95729293 AGCCCGCGGGACCCGGGCGGTGG - Intergenic
1058824491 9:108762504-108762526 GGCCCGGGGAAGCAGGGGGCTGG + Intergenic
1061942452 9:133891145-133891167 GGCCCGGGGGACAAGGGTGCAGG + Intronic
1062010615 9:134264810-134264832 AGCCCCCGGGACAAGGATGCAGG - Intergenic
1196723969 X:118879177-118879199 GGCCCGGCGCACCATGGTGCTGG - Intergenic
1199500281 X:148500347-148500369 GGCTGGCGGGACCAGGACGCGGG - Intergenic
1200247581 X:154534301-154534323 GGGCCGGGGGACCAGGGTGGGGG - Intronic