ID: 1147337241

View in Genome Browser
Species Human (GRCh38)
Location 17:39734571-39734593
Sequence TCCTGGCCTCTTATTAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147337235_1147337241 19 Left 1147337235 17:39734529-39734551 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 1147337241 17:39734571-39734593 TCCTGGCCTCTTATTAATGGTGG No data
1147337238_1147337241 -8 Left 1147337238 17:39734556-39734578 CCACTGCGCGCGGCCTCCTGGCC No data
Right 1147337241 17:39734571-39734593 TCCTGGCCTCTTATTAATGGTGG No data
1147337230_1147337241 29 Left 1147337230 17:39734519-39734541 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 1147337241 17:39734571-39734593 TCCTGGCCTCTTATTAATGGTGG No data
1147337232_1147337241 23 Left 1147337232 17:39734525-39734547 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1147337241 17:39734571-39734593 TCCTGGCCTCTTATTAATGGTGG No data
1147337234_1147337241 20 Left 1147337234 17:39734528-39734550 CCCAAAGTGCTGGGATTACAGGT 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
Right 1147337241 17:39734571-39734593 TCCTGGCCTCTTATTAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147337241 Original CRISPR TCCTGGCCTCTTATTAATGG TGG Intergenic
No off target data available for this crispr