ID: 1147338848

View in Genome Browser
Species Human (GRCh38)
Location 17:39742201-39742223
Sequence AACCGCCGTGTGAGGTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147338839_1147338848 22 Left 1147338839 17:39742156-39742178 CCAGTTAGAGCAGTGAGGTGCTA 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1147338848 17:39742201-39742223 AACCGCCGTGTGAGGTCAGGAGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147338848 Original CRISPR AACCGCCGTGTGAGGTCAGG AGG Intronic
900365590 1:2310797-2310819 GGCCCCCCTGTGAGGTCAGGTGG - Intergenic
901201776 1:7471364-7471386 AACCACCATGTGAGGTCACCAGG + Intronic
906757270 1:48330363-48330385 CACTGCTGTGTGAGGTCAGCTGG + Intronic
910198942 1:84677753-84677775 AACTGACGTCTGAGGTCAGCAGG + Intronic
1067541456 10:47157802-47157824 AAACGCCATGTGAGGACAGCAGG - Intergenic
1074285635 10:112095260-112095282 ACCCGCCTTGGGAAGTCAGGGGG - Intergenic
1077472416 11:2770239-2770261 GACCGCCCTGTGAAGTCTGGAGG - Intronic
1083756286 11:64793405-64793427 AACAGCCCTGTGGGGCCAGGGGG + Intronic
1083857649 11:65401035-65401057 AGCTGCCCTGGGAGGTCAGGAGG + Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1090863265 11:130673082-130673104 AGCCGTCCTGTGAGCTCAGGTGG + Exonic
1104721589 12:131047571-131047593 CACCGCCCTGTGAGCTCACGTGG + Intronic
1106269511 13:28139189-28139211 GACCGCCTTGGGAGGTGAGGGGG - Intronic
1114072839 14:19128308-19128330 AAACGCCATGTAAGGTTAGGTGG + Intergenic
1114089422 14:19271664-19271686 AAACGCCATGTAAGGTTAGGTGG - Intergenic
1120930459 14:89842709-89842731 AAGGGCTGTGTGAGTTCAGGAGG - Intronic
1121804859 14:96809020-96809042 AACCTACATGTGGGGTCAGGAGG + Intronic
1121804871 14:96809123-96809145 AACCTACATGTGGGGTCAGGAGG + Intronic
1131833115 15:96366730-96366752 AACCAGCGTGTCGGGTCAGGAGG - Intergenic
1136272918 16:29159063-29159085 CACCCTCGGGTGAGGTCAGGCGG - Intergenic
1142076475 16:88120875-88120897 CACCCTCGGGTGAGGTCAGGCGG - Intergenic
1144627259 17:16850526-16850548 GAACGCCCTTTGAGGTCAGGTGG - Intergenic
1144879180 17:18422186-18422208 GAACGCCCTTTGAGGTCAGGTGG + Intergenic
1145153055 17:20522201-20522223 GAACGCCCTTTGAGGTCAGGTGG - Intergenic
1145881515 17:28356179-28356201 AAGTGCTGTGGGAGGTCAGGAGG - Intronic
1146162769 17:30568949-30568971 AAACGCCCTGCGAGGCCAGGTGG - Intergenic
1147338848 17:39742201-39742223 AACCGCCGTGTGAGGTCAGGAGG + Intronic
1159247898 18:65834039-65834061 ACACGCCGTGGGAGGGCAGGGGG - Intronic
1166342104 19:42144372-42144394 TCCCGCCTTGTGAGGCCAGGTGG - Intronic
929241960 2:39663066-39663088 AACTGCCGTGGGGAGTCAGGTGG - Intergenic
944567721 2:201007720-201007742 AACTGCCGTGTGATTTAAGGTGG + Intronic
945040736 2:205741834-205741856 AACAACCCTGTGAGGTAAGGTGG + Intronic
1170577202 20:17673323-17673345 CACTGCCCTGTCAGGTCAGGAGG - Intronic
1174806572 20:53608705-53608727 ACCCGCTGTGTGAGGGCTGGGGG - Intronic
1175269828 20:57725876-57725898 CACAGCTGTCTGAGGTCAGGGGG + Intergenic
1179802046 21:43815608-43815630 AACGGCCCTGTGAGGACACGGGG - Intergenic
1180491284 22:15850683-15850705 AAACGCCATGTAAGGTTAGGTGG + Intergenic
1181593165 22:23896839-23896861 ACCTGCTGTGTGAGGGCAGGAGG + Intronic
950426644 3:12928016-12928038 AGCCCCAGTGTGAGGTCAAGAGG + Intronic
950935599 3:16835780-16835802 AACAGCCGTGTGAGGCCTGGTGG - Intronic
955815425 3:62837370-62837392 ACCCGTCCTGTGAGGTCAGTGGG - Intronic
961201725 3:125050731-125050753 AAGAGCCGTGTGAGGTGATGAGG - Intronic
999723530 5:154416660-154416682 ATCCGGCTTGTGAGCTCAGGAGG + Intronic
1007049255 6:38809493-38809515 AACTTACTTGTGAGGTCAGGTGG + Intronic
1007748938 6:44060242-44060264 ACTTGCCCTGTGAGGTCAGGAGG + Intergenic
1018708435 6:166479511-166479533 AACTGCCAGGTGAGGTGAGGTGG + Intronic
1018998861 6:168730155-168730177 AAATGCCGTGTGAGGAAAGGGGG - Intergenic
1020617312 7:10476098-10476120 AACCGCCCTGTGAGGTTGGTAGG - Intergenic
1034063919 7:148118706-148118728 GACATCCGTGTGAGTTCAGGAGG + Intronic
1035273983 7:157736472-157736494 AAAGGCCGTGTGAGGACATGGGG + Intronic
1037906494 8:22718717-22718739 AACCACCATGGGAGGTCACGAGG + Intronic
1044475085 8:92616624-92616646 AAAGGCCGTGTGAGGACACGGGG - Intergenic
1053044106 9:34899668-34899690 ATCCGCTGTGTGAGCTCTGGTGG - Intergenic