ID: 1147339077

View in Genome Browser
Species Human (GRCh38)
Location 17:39743169-39743191
Sequence CTTGTCCCCAGAGCGGGGTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147339069_1147339077 -8 Left 1147339069 17:39743154-39743176 CCCCTGCTTTTTGCCCTTGTCCC 0: 1
1: 0
2: 4
3: 52
4: 493
Right 1147339077 17:39743169-39743191 CTTGTCCCCAGAGCGGGGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 113
1147339071_1147339077 -10 Left 1147339071 17:39743156-39743178 CCTGCTTTTTGCCCTTGTCCCCA 0: 1
1: 0
2: 4
3: 45
4: 405
Right 1147339077 17:39743169-39743191 CTTGTCCCCAGAGCGGGGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 113
1147339070_1147339077 -9 Left 1147339070 17:39743155-39743177 CCCTGCTTTTTGCCCTTGTCCCC 0: 1
1: 0
2: 3
3: 36
4: 306
Right 1147339077 17:39743169-39743191 CTTGTCCCCAGAGCGGGGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 113
1147339068_1147339077 -1 Left 1147339068 17:39743147-39743169 CCAATAACCCCTGCTTTTTGCCC 0: 1
1: 0
2: 1
3: 25
4: 306
Right 1147339077 17:39743169-39743191 CTTGTCCCCAGAGCGGGGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 113
1147339067_1147339077 19 Left 1147339067 17:39743127-39743149 CCAGGAGATCTGGTTGATCTCCA 0: 1
1: 0
2: 0
3: 8
4: 124
Right 1147339077 17:39743169-39743191 CTTGTCCCCAGAGCGGGGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147339077 Original CRISPR CTTGTCCCCAGAGCGGGGTT TGG Exonic
900532444 1:3161306-3161328 CTTGGCCCCAGAGCCGGGGAGGG + Intronic
901204679 1:7487319-7487341 CATGGCCCCAGAGCTGGGGTGGG - Intronic
903293126 1:22327088-22327110 TTTGTCCCCAGGGAGAGGTTGGG - Intergenic
903567501 1:24279130-24279152 ATTGACCCCATAGTGGGGTTTGG + Intergenic
905788788 1:40779078-40779100 CTTTTCCCCAGATCTGGGTGTGG - Intergenic
906289100 1:44608241-44608263 ATTGTCCCCAGAGTGGTCTTAGG - Intronic
907319440 1:53593570-53593592 CAGGTCCCCAGGGCAGGGTTTGG - Intronic
910757462 1:90707811-90707833 CTTATCCCCAGGGCTGGGTAGGG - Intergenic
919926684 1:202195083-202195105 CCTTGCCCCAGAGCGGGGCTGGG - Intronic
922052043 1:222000927-222000949 CTTGTTTCCAGAGAAGGGTTTGG + Intergenic
922237567 1:223733532-223733554 CTTGTCCTCAGAGGAGGGTCTGG + Intronic
1065168160 10:23002179-23002201 CATGTCCCCAGGGCGGGCCTTGG + Intronic
1065537253 10:26727285-26727307 CTTGAACCCAGAGCTGGGTATGG + Intronic
1067083050 10:43222404-43222426 CTTGTCCCTAGAGCTGGGGGTGG - Intronic
1068017882 10:51541106-51541128 TTTTTCCACAGAGCAGGGTTGGG + Intronic
1070816548 10:79328194-79328216 CCTTTCCCCAGGGTGGGGTTGGG - Intergenic
1071562590 10:86655491-86655513 CTCTTCCCCAGAAAGGGGTTAGG + Intronic
1072895730 10:99365050-99365072 CAGGTCCCCAGAGCGGGCTGAGG - Intronic
1076048770 10:127315706-127315728 CTTTTCCACATAGCTGGGTTGGG + Intronic
1076447986 10:130531571-130531593 CTTGTCAGGAGAGCGGGGTGGGG - Intergenic
1076571916 10:131438698-131438720 AGTGTCCTCAGAGCGGGGCTGGG + Intergenic
1084437397 11:69152014-69152036 TTTGTCCCCAGAGAGGGGGGTGG - Intergenic
1086342049 11:85857027-85857049 CCTGTCCCCAGATCGAGGCTTGG + Intronic
1089343031 11:117772538-117772560 CTTGGCCCCAGCGGGGAGTTTGG - Intronic
1092151724 12:6253554-6253576 CCTGCCCCCAGAGCTGTGTTGGG - Intergenic
1095389839 12:41692733-41692755 CTTGGGCCCAGAGGGGGTTTTGG - Intergenic
1096840080 12:54374673-54374695 TCTGTCCCCAGAGCTGGGCTCGG - Intronic
1102687957 12:114738952-114738974 TTTGTCCCCAGAGCGACCTTGGG - Intergenic
1103072160 12:117953836-117953858 CTTGTCCTCAAAGCGGTGTTGGG - Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1108072925 13:46647949-46647971 CTTTTCCCCAGACCGGGGTGGGG + Intronic
1108594221 13:51936242-51936264 CTTGTCCCCAGAGCCGGCTCAGG - Intronic
1114554231 14:23552212-23552234 ATAGTCCCCTGAGCTGGGTTGGG + Intronic
1118335887 14:64853295-64853317 ATTGTCCCCAAAGAGGGTTTAGG + Intronic
1118920337 14:70144102-70144124 CCTGCCCCCACAGCGGGGTATGG - Intronic
1119618658 14:76115128-76115150 AGTGTCCCCAGAGAGGGTTTTGG - Intergenic
1121241117 14:92430726-92430748 CATGTCCCCAGGGCAGGGGTGGG + Intronic
1121703038 14:95970599-95970621 CTAATCTCCAGAGCGTGGTTGGG - Intergenic
1128789560 15:70423143-70423165 CTCATGCCCAGAGCTGGGTTTGG - Intergenic
1129878807 15:78993987-78994009 CTTGTCCCCAGAGCCTGTGTGGG - Intronic
1130109779 15:80954554-80954576 CATGTCCTCAGGGCTGGGTTGGG + Intronic
1133909338 16:10050727-10050749 TTTTTCCACAGACCGGGGTTGGG - Intronic
1136626479 16:31465012-31465034 CCTGTCACCAGAGTGGGGTGGGG + Intronic
1137599214 16:49744539-49744561 GGTGTCCCCAGCTCGGGGTTGGG + Intronic
1138457138 16:57127667-57127689 CAGGTCCCCAGAGGTGGGTTGGG + Intronic
1141161697 16:81633430-81633452 CTTGTCCCCACAGAGGAATTAGG + Intronic
1143769925 17:9162103-9162125 CCTCTCCCCAGAGCAGGGCTGGG + Intronic
1145901853 17:28494907-28494929 CTGGTCCCCAGAGCCTGGGTGGG - Intronic
1147035078 17:37673800-37673822 CTGGTCCCTACAGCAGGGTTTGG + Intergenic
1147192542 17:38746540-38746562 CTGGTCCCCAGAGCGGACTTTGG - Intronic
1147335991 17:39727284-39727306 CTTGTCCCCAGAGTGGCGGTGGG + Exonic
1147339077 17:39743169-39743191 CTTGTCCCCAGAGCGGGGTTTGG + Exonic
1149772195 17:59331328-59331350 TTTGTCCCCAGGGCAGGGCTGGG - Intergenic
1150031998 17:61748314-61748336 CTTTTCCACAGACCTGGGTTGGG - Intronic
1151493065 17:74443988-74444010 CATGTGGCCAGAGCTGGGTTGGG + Intronic
1151819599 17:76490421-76490443 GCTGTCCCCAGAGCAGGCTTAGG - Intronic
1161790691 19:6358081-6358103 CTTCTCCCCAGGGCGGGGGCAGG + Intergenic
1162540390 19:11292261-11292283 CTTGTCCCCAGTGAGGGCTGAGG + Intergenic
1162643953 19:12035369-12035391 CTTGGCCCCACAGTGGGGCTGGG - Intronic
1163328994 19:16624218-16624240 CTTGTCCACAGGGTGGGATTGGG - Intronic
1163433632 19:17282579-17282601 CAGGTCCCCAGAGCGGAGATCGG + Intronic
1164717486 19:30404180-30404202 CTTGTGCTCAGACCTGGGTTGGG + Intronic
1165922413 19:39307437-39307459 CCCGTGCCCAGGGCGGGGTTCGG - Exonic
1166268156 19:41697414-41697436 CCTGTCCCCTGAGAGGTGTTGGG + Intronic
1167159332 19:47756877-47756899 CCTGAAACCAGAGCGGGGTTGGG + Intronic
1168134102 19:54338816-54338838 CTTGTCCCCAGAGAGGAGGAGGG + Intronic
1168692914 19:58387519-58387541 CTTTTCCCCATAGCGGGGCTTGG + Exonic
925595226 2:5549122-5549144 CTTGTGCTAGGAGCGGGGTTTGG - Intergenic
930380585 2:50622846-50622868 CTTGTCCCCATTTTGGGGTTGGG + Intronic
935307089 2:101747487-101747509 CTGGTCCCCATAGCAGGGGTAGG + Intronic
943783213 2:191847194-191847216 CCTGTGCCCAGAACGCGGTTAGG - Exonic
946175982 2:217922281-217922303 CCAGTCCCCAGAGCAGGGTTTGG - Intronic
946463461 2:219890547-219890569 GTTGTCCACAGAGCTGGGTGTGG + Intergenic
948368698 2:237474448-237474470 CTTGGCCCCAGAGCGGGGCAGGG + Intergenic
948515404 2:238500255-238500277 CTTGCCCCCAAAGTGGGGCTGGG - Intergenic
948859814 2:240747357-240747379 CTTGTCCCCTGAGGTGGGTGTGG + Intronic
1169194174 20:3674498-3674520 GTGGTCCCCAGAGCAGGGTCAGG - Exonic
1175784121 20:61701450-61701472 CTTGTCCACATAGGTGGGTTTGG + Intronic
1176310073 21:5144825-5144847 CCCTTCCCCAGGGCGGGGTTGGG + Intronic
1179846983 21:44117207-44117229 CCCTTCCCCAGGGCGGGGTTGGG - Intronic
949511039 3:4767379-4767401 GTTGTCCCCTGGGCGGGGTTGGG + Intronic
952009820 3:28887584-28887606 CTTGTCTCCAAAGTGGGATTTGG - Intergenic
953455323 3:43036140-43036162 CTTGTCCCCACAGCAGGGGTTGG - Intronic
953858045 3:46516808-46516830 CATGTCCCCAGCGAGGGGGTTGG - Exonic
954876308 3:53805204-53805226 CCGGCCCCCAGAGCGGGGGTTGG - Intronic
955751533 3:62189360-62189382 CCTGTCCCCAGAGCTGCCTTGGG + Intronic
962250012 3:133830290-133830312 ATTGTCACCAGAGCTGGCTTTGG - Intronic
964792015 3:160461173-160461195 TTTGTCCACAGATCAGGGTTGGG - Intronic
967113909 3:186319408-186319430 CTTGTCCCCAGCGCTGGTCTAGG - Intronic
969407111 4:7000881-7000903 CTTGGCCCCAGAGCGTGCCTGGG + Intronic
969423309 4:7109594-7109616 TCTGTCCCCTGAGCAGGGTTAGG + Intergenic
971334829 4:25712715-25712737 CTTGTTTCCAGACCAGGGTTTGG - Intergenic
979489502 4:121308994-121309016 CTGGTCCCCAGCCCGGGGGTTGG - Intergenic
980823870 4:138050873-138050895 CTTGTCCACAGCTCGGGGGTTGG + Intergenic
986273449 5:6253717-6253739 CATGTCCCCAGGGCAGGGTCTGG + Intergenic
994077952 5:95674366-95674388 CTTATCCCTAGAGCTGGGGTTGG - Intronic
994482918 5:100358784-100358806 CTTGTCCCAAGAGCGGTTCTTGG - Intergenic
998139553 5:139692189-139692211 CAGGGCCCCAGAGTGGGGTTGGG - Intergenic
999745757 5:154590577-154590599 CTTGCCCCCAGTGTGGGGTCTGG + Intergenic
1001088286 5:168717683-168717705 CTTGGCCACAGAGCGAGATTCGG - Intronic
1002559018 5:180068167-180068189 TTTGGCCCCAGAGTGGGGGTTGG - Intronic
1007697828 6:43744795-43744817 CCTGTCCCCAGAGCTGGGAGGGG - Intergenic
1010153294 6:72762025-72762047 CTTATCGCTAGAGCTGGGTTAGG + Intronic
1011260845 6:85468361-85468383 CCTGACCCCAGGGTGGGGTTGGG - Intronic
1016336265 6:143008346-143008368 CTTTTCTCCAGGGCTGGGTTGGG - Intergenic
1017770703 6:157642360-157642382 CCTGTCCCCAGTGCAGGGCTGGG + Intronic
1019287358 7:230354-230376 CTTGTCCCCAGGACGGGGTGGGG + Intronic
1019508584 7:1405706-1405728 CGTGTCCCCAGAGCGGGGCAGGG + Intergenic
1019612857 7:1945753-1945775 CTGGGCCGCAGACCGGGGTTAGG + Intronic
1019620292 7:1988473-1988495 CTTGTCCCCAGGCCTGGCTTTGG - Intronic
1021253043 7:18355702-18355724 CTTTTCCCCAGAGTTTGGTTTGG + Intronic
1024668411 7:51567786-51567808 CATGCCCACAGAGGGGGGTTAGG - Intergenic
1025638967 7:63349780-63349802 CTTGTCTCCAGGGCGGCGTTGGG - Intergenic
1025643732 7:63398312-63398334 CTTGTCTCCAGGGCGGCGTTGGG + Intergenic
1034214546 7:149395021-149395043 CTTGTCCAGACAGTGGGGTTGGG - Intergenic
1035970222 8:4239504-4239526 CTGGTCCTCAGAGCTGGTTTTGG + Intronic
1041250540 8:55930113-55930135 TTTTTCCACAGAGCGGGGTCAGG - Intronic
1044064954 8:87687946-87687968 CTTTTCCACAGATGGGGGTTGGG + Intergenic
1045884060 8:107075508-107075530 CTTGTCACCAGAGAGTGGTGAGG - Intergenic
1047317049 8:123744552-123744574 CTTGTCACCATAGCTGGGGTGGG + Intergenic
1056081990 9:83104948-83104970 CTTGTCACCAAAGTGAGGTTTGG - Intergenic
1056578057 9:87870806-87870828 CGTGACCCCAGAGCAGGGTATGG + Intergenic
1057076884 9:92142523-92142545 CCTTTCCCCAGAGCGGGGCTGGG - Intergenic
1057559710 9:96117597-96117619 ATTGTCCCCAGTGCGGGGTGAGG + Intergenic
1061570742 9:131476157-131476179 CTTGTCCCCAGAACACAGTTTGG - Exonic
1062500173 9:136848819-136848841 CTTGTACCGGTAGCGGGGTTGGG + Intronic
1187093465 X:16121731-16121753 CTTCACTCCAGAGAGGGGTTGGG + Intergenic
1188836931 X:34969393-34969415 CTTGTGCCCAGAGCAGTGCTGGG - Intergenic
1189245196 X:39557949-39557971 CTTGTGCCCAGGGCTGGGCTGGG + Intergenic
1192562287 X:72135054-72135076 CTTGTGCCCAGAGCTGGGTTTGG + Intronic
1201291539 Y:12425229-12425251 CTGGTTCACATAGCGGGGTTGGG - Intergenic