ID: 1147340479

View in Genome Browser
Species Human (GRCh38)
Location 17:39750715-39750737
Sequence CACACCTCGGAGGTGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147340479_1147340487 -2 Left 1147340479 17:39750715-39750737 CCCAGGGCCACCTCCGAGGTGTG No data
Right 1147340487 17:39750736-39750758 TGGGTGCCAGAGTTCCAGGCTGG No data
1147340479_1147340490 12 Left 1147340479 17:39750715-39750737 CCCAGGGCCACCTCCGAGGTGTG No data
Right 1147340490 17:39750750-39750772 CCAGGCTGGAGTGAGAGTAAAGG No data
1147340479_1147340492 14 Left 1147340479 17:39750715-39750737 CCCAGGGCCACCTCCGAGGTGTG No data
Right 1147340492 17:39750752-39750774 AGGCTGGAGTGAGAGTAAAGGGG No data
1147340479_1147340486 -6 Left 1147340479 17:39750715-39750737 CCCAGGGCCACCTCCGAGGTGTG No data
Right 1147340486 17:39750732-39750754 GGTGTGGGTGCCAGAGTTCCAGG No data
1147340479_1147340491 13 Left 1147340479 17:39750715-39750737 CCCAGGGCCACCTCCGAGGTGTG No data
Right 1147340491 17:39750751-39750773 CAGGCTGGAGTGAGAGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147340479 Original CRISPR CACACCTCGGAGGTGGCCCT GGG (reversed) Intergenic