ID: 1147340480

View in Genome Browser
Species Human (GRCh38)
Location 17:39750716-39750738
Sequence CCACACCTCGGAGGTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147340480_1147340487 -3 Left 1147340480 17:39750716-39750738 CCAGGGCCACCTCCGAGGTGTGG No data
Right 1147340487 17:39750736-39750758 TGGGTGCCAGAGTTCCAGGCTGG No data
1147340480_1147340490 11 Left 1147340480 17:39750716-39750738 CCAGGGCCACCTCCGAGGTGTGG No data
Right 1147340490 17:39750750-39750772 CCAGGCTGGAGTGAGAGTAAAGG No data
1147340480_1147340491 12 Left 1147340480 17:39750716-39750738 CCAGGGCCACCTCCGAGGTGTGG No data
Right 1147340491 17:39750751-39750773 CAGGCTGGAGTGAGAGTAAAGGG No data
1147340480_1147340486 -7 Left 1147340480 17:39750716-39750738 CCAGGGCCACCTCCGAGGTGTGG No data
Right 1147340486 17:39750732-39750754 GGTGTGGGTGCCAGAGTTCCAGG No data
1147340480_1147340492 13 Left 1147340480 17:39750716-39750738 CCAGGGCCACCTCCGAGGTGTGG No data
Right 1147340492 17:39750752-39750774 AGGCTGGAGTGAGAGTAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147340480 Original CRISPR CCACACCTCGGAGGTGGCCC TGG (reversed) Intergenic