ID: 1147340486

View in Genome Browser
Species Human (GRCh38)
Location 17:39750732-39750754
Sequence GGTGTGGGTGCCAGAGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147340479_1147340486 -6 Left 1147340479 17:39750715-39750737 CCCAGGGCCACCTCCGAGGTGTG No data
Right 1147340486 17:39750732-39750754 GGTGTGGGTGCCAGAGTTCCAGG No data
1147340477_1147340486 3 Left 1147340477 17:39750706-39750728 CCATGGGTGCCCAGGGCCACCTC No data
Right 1147340486 17:39750732-39750754 GGTGTGGGTGCCAGAGTTCCAGG No data
1147340480_1147340486 -7 Left 1147340480 17:39750716-39750738 CCAGGGCCACCTCCGAGGTGTGG No data
Right 1147340486 17:39750732-39750754 GGTGTGGGTGCCAGAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147340486 Original CRISPR GGTGTGGGTGCCAGAGTTCC AGG Intergenic
No off target data available for this crispr