ID: 1147341704

View in Genome Browser
Species Human (GRCh38)
Location 17:39756323-39756345
Sequence CTGGCCCAAGGGATGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147341704_1147341711 -5 Left 1147341704 17:39756323-39756345 CCCTCCACCATCCCTTGGGCCAG No data
Right 1147341711 17:39756341-39756363 GCCAGTGTTTCTGGTCTTCCTGG No data
1147341704_1147341715 27 Left 1147341704 17:39756323-39756345 CCCTCCACCATCCCTTGGGCCAG No data
Right 1147341715 17:39756373-39756395 CTCCACTCTTCCTCAGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147341704 Original CRISPR CTGGCCCAAGGGATGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr