ID: 1147342640

View in Genome Browser
Species Human (GRCh38)
Location 17:39763082-39763104
Sequence ATAAGCAATCTGGCATAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147342638_1147342640 -6 Left 1147342638 17:39763065-39763087 CCTCTTTCACAAAGGGAATAAGC 0: 1
1: 0
2: 1
3: 19
4: 208
Right 1147342640 17:39763082-39763104 ATAAGCAATCTGGCATAGCTTGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147342640 Original CRISPR ATAAGCAATCTGGCATAGCT TGG Intergenic
900763397 1:4487863-4487885 GGAAGCAATGTGGCACAGCTAGG + Intergenic
906919142 1:50045157-50045179 ATAAAAAATCTGGCATACATAGG - Intergenic
911796425 1:102082234-102082256 ACAGGCAATATGGCACAGCTAGG + Intergenic
918031918 1:180822791-180822813 ATAAATAATTTGGCATCGCTAGG + Intronic
919261995 1:195208374-195208396 ATAAGCAAACTGCCAAAGCTTGG - Intergenic
922912493 1:229229453-229229475 AAAAGGAATCTGGCATTCCTAGG + Intergenic
1064808323 10:19163259-19163281 TTAACCAATCTGTCATTGCTGGG - Intronic
1065187906 10:23187278-23187300 AAAAGCAATCTGCCCAAGCTGGG + Intergenic
1067984767 10:51130415-51130437 ATAAACAGTCTAGTATAGCTCGG + Intronic
1068459984 10:57315969-57315991 AAAAGCAAACTGTAATAGCTTGG - Intergenic
1068733386 10:60385126-60385148 ATATGCCATCTTGCATAGTTTGG - Intronic
1071802831 10:89083715-89083737 ATAGGCAAGCTTGAATAGCTAGG + Intergenic
1071876149 10:89845419-89845441 ATAAACAATATTCCATAGCTTGG + Intergenic
1073467687 10:103703913-103703935 ATAATCTGTCTGGCAGAGCTGGG - Intronic
1077804294 11:5574806-5574828 ATAATTCATCTGGTATAGCTAGG - Intronic
1078855500 11:15203342-15203364 ATAAGCAATCTGGCCTGGAGAGG - Intronic
1080594779 11:33761859-33761881 ATAAGCAAGCTGGCATATTATGG - Intronic
1081966413 11:47172848-47172870 ATGAGAAGGCTGGCATAGCTTGG - Intronic
1083318947 11:61833582-61833604 ATAAGAAATCAGGCGTAGGTTGG - Intronic
1090249457 11:125241238-125241260 TTGAGCAATCCGGCATAGTTGGG - Intronic
1097600050 12:61680259-61680281 TTAGGCAATCTGGTATATCTGGG + Intergenic
1098167399 12:67712245-67712267 AAAAGGAATCTTGCCTAGCTAGG + Intergenic
1098342539 12:69467671-69467693 TTAATCAATGTTGCATAGCTGGG + Intergenic
1098866315 12:75767746-75767768 ATAATCAATATGGCATATTTGGG - Intergenic
1100413863 12:94351585-94351607 ACAAGCAATCTAGCACAGCAGGG + Intronic
1101255889 12:102976096-102976118 ACAAACAATTTGGCATTGCTGGG - Intergenic
1103956516 12:124580119-124580141 ATAGGGAATATGGCAGAGCTAGG - Intergenic
1105640889 13:22263008-22263030 AAAAGCATTCTGGCTCAGCTTGG - Intergenic
1107755487 13:43617203-43617225 ATAAACAATCTGCCAATGCTGGG + Intronic
1108545334 13:51487864-51487886 ATAAGCTATCTGGCACCCCTGGG + Intergenic
1110934552 13:81270812-81270834 ATAAGAAATATGGGAGAGCTGGG - Intergenic
1111297557 13:86302393-86302415 ATAAGCATTCTAGCATAGCATGG + Intergenic
1114711467 14:24782721-24782743 ATAAGGAAGCTGGCCTATCTTGG - Intergenic
1116040605 14:39681887-39681909 ATAAGCAACGTGGCCTAGCTGGG + Intergenic
1117232677 14:53737205-53737227 TTAAGCAATCTGTCATTGTTGGG - Intergenic
1117275109 14:54185755-54185777 ATAATCCATCTGGGATAGCGAGG + Intergenic
1126154466 15:45552522-45552544 ATAAATAATCTGGTATTGCTGGG - Intergenic
1128434502 15:67632393-67632415 ATAAAACATCTAGCATAGCTGGG - Intronic
1129206928 15:74042903-74042925 ACTAGCAAGCTGGTATAGCTGGG - Intronic
1133666838 16:7976786-7976808 ATAAGCCAACAGGCATGGCTGGG - Intergenic
1135987270 16:27193166-27193188 AAAAGAAATCTGACATATCTGGG + Intergenic
1140282177 16:73564895-73564917 AAAAGCAAACTGGAATAGATGGG + Intergenic
1140691306 16:77487041-77487063 ATAAGGAATCCAGCATAGCTTGG + Intergenic
1143326569 17:6102754-6102776 ATAAGCGATAAGGCATAGCACGG - Intronic
1144086567 17:11814390-11814412 ATACAAAATCTGTCATAGCTAGG - Intronic
1147342640 17:39763082-39763104 ATAAGCAATCTGGCATAGCTTGG + Intergenic
1149862801 17:60133217-60133239 ATAAGCAATATGGCAAAGTTGGG - Intergenic
1158897711 18:61930746-61930768 ATAAGCAATTTGGAATAATTTGG - Intergenic
1159830589 18:73273523-73273545 TTAAGCAATAAAGCATAGCTAGG - Intergenic
1160143082 18:76343026-76343048 ATAAGATGTCTGGCATAGATAGG - Intergenic
933183730 2:79255666-79255688 AGAAGGAAGCTGGAATAGCTTGG + Intronic
933410726 2:81921704-81921726 ATTCACAGTCTGGCATAGCTGGG + Intergenic
934746952 2:96765546-96765568 AGAAGGACTCTGGCAAAGCTAGG - Intronic
936703502 2:115041457-115041479 ATAAGCAATATCTCATAGTTAGG - Intronic
940477210 2:154178234-154178256 AGAAACAATTTGGCATAGCCTGG - Intronic
943110301 2:183596243-183596265 ATAAGGAATCTGGTATATCATGG + Intergenic
943305337 2:186254824-186254846 AGAAGCAATATGGAATAGTTGGG + Intergenic
944893284 2:204139352-204139374 ATAAGCATCATGGCATAGCCAGG - Intergenic
947364519 2:229380486-229380508 AGAAGCAATCTGGAATAGGGAGG + Intronic
1169359181 20:4933701-4933723 ATAAAAATTCAGGCATAGCTAGG - Intronic
1169775381 20:9246416-9246438 AAAACAAATCTGGTATAGCTGGG - Intronic
1170714024 20:18816929-18816951 AAAAGGAATGTGGCACAGCTGGG - Intronic
1173387527 20:42602806-42602828 ATAAGTAATTTGGCACAGCCAGG - Intronic
1179175097 21:39002527-39002549 TTAAGAACTCTGGCATAGCAGGG - Intergenic
1181291946 22:21801871-21801893 AAAAGCAATCTGCCATAACAGGG + Intronic
1185062890 22:48616197-48616219 ATCAGCAGTCAGGCAGAGCTGGG + Intronic
1185135497 22:49069469-49069491 CTAAGCAATGTGGCACAGCCTGG + Intergenic
952025719 3:29079110-29079132 ATAAGCAAATTGGGATAGTTAGG - Intergenic
952640301 3:35586166-35586188 TCAAGCAATCTAGCATAACTTGG + Intergenic
954282610 3:49593473-49593495 ACAATCAATCTGGAAAAGCTTGG - Intronic
960372670 3:116860226-116860248 TTAACCAATCTGGCATTCCTGGG + Intronic
964303293 3:155313029-155313051 ATCAGCAATCTGGCATTTCCAGG + Intergenic
964847087 3:161055867-161055889 ATAAGCAGTCTGGCATTGTGTGG + Intronic
965627478 3:170695987-170696009 ATAAGCAATCTTATATACCTTGG + Intronic
970716326 4:18929719-18929741 ATTGGCAATCTGCCATGGCTGGG + Intergenic
972037488 4:34544647-34544669 ATGAGCGAACTGGAATAGCTGGG + Intergenic
972051040 4:34733652-34733674 AGCATCCATCTGGCATAGCTGGG + Intergenic
972407255 4:38758591-38758613 ATAAGCAGTCAGGTAGAGCTGGG + Intergenic
976942828 4:90727280-90727302 ATAACCAATTTTGCATAGGTAGG + Intronic
983367337 4:166809794-166809816 AGAAGCACTATGGCTTAGCTGGG - Intronic
983903398 4:173160606-173160628 ATTAGCAAGATGGCATAGTTGGG + Intergenic
985106706 4:186506731-186506753 ATCAGGAATCAGGCTTAGCTGGG + Intronic
986191678 5:5502374-5502396 AAAAGAAATCTGCCATAGATGGG + Intergenic
986296282 5:6441362-6441384 TTATGCAATCTGTCATAGATGGG + Intergenic
988520737 5:31943363-31943385 CTAGGCACTCTGGCAGAGCTGGG + Intronic
990010835 5:50995319-50995341 ATATGCAAGCAGACATAGCTTGG + Intergenic
990620886 5:57557374-57557396 ATAAGCACTCTGGTATGGTTGGG + Intergenic
994702036 5:103145929-103145951 ATAATCAAACTGGAATAGTTGGG - Intronic
994829881 5:104766927-104766949 GTCAGTAATCTGGCATAGCATGG - Intergenic
999274518 5:150320386-150320408 ATAATCACTGTGGCTTAGCTGGG - Intronic
1012843422 6:104359602-104359624 ATAAAAAATCTGGGATAGCAGGG - Intergenic
1013435095 6:110096283-110096305 ATAAGCTATATGGCACAACTTGG + Intergenic
1018649735 6:165983391-165983413 ATGAGCACTCTGGCATGGATTGG + Intronic
1020806509 7:12796403-12796425 AGCAGGAAACTGGCATAGCTGGG - Intergenic
1024965033 7:55016945-55016967 ATAAGTAGCCTGGCATAGTTAGG - Intergenic
1028223722 7:88225542-88225564 ATAATCTAACTGGCATGGCTGGG - Intronic
1033178384 7:139149003-139149025 ATTAGAAACCTGGCATATCTGGG + Intronic
1034782160 7:153890479-153890501 CTAAGCAATGTGGCATGGCAAGG - Intronic
1036159787 8:6376528-6376550 ATAAAAAATCTGGCCTGGCTGGG + Intergenic
1038634607 8:29275527-29275549 AAAAGAAATCTGGCAGAGGTAGG + Intergenic
1038657754 8:29469593-29469615 ATAAATAAACTGGCAGAGCTAGG + Intergenic
1040015808 8:42698917-42698939 ATAAGAAAACTGGAATTGCTTGG + Intronic
1042257649 8:66821903-66821925 AAAAGCAATCTGGCAATACTTGG - Intronic
1042741241 8:72049561-72049583 ATAAGCAATCTGGGAAAGTTGGG - Intronic
1043665921 8:82813346-82813368 ATAGGCAATCTGGTATATGTCGG + Intergenic
1044974574 8:97650888-97650910 CTAAACAATATGGCATAGCCAGG - Intronic
1048752309 8:137693143-137693165 ATAAGAATTCTAGCAAAGCTTGG - Intergenic
1053549547 9:39061781-39061803 ATAAGCGATCTTGGAGAGCTAGG + Intergenic
1053813660 9:41881856-41881878 ATAAGCAATCTTGGAGAGCTAGG + Intergenic
1054616936 9:67305583-67305605 ATAAGCAATCTTGGAGAGCTAGG - Intergenic
1055590860 9:77812498-77812520 AGAAGCAATCAGGCAAATCTAGG + Intronic
1057073081 9:92117332-92117354 ATAAGCAAGCTGGCAGTGCACGG + Intergenic
1057403323 9:94743846-94743868 AAATGCAAGCTGGCATACCTGGG + Intronic
1185872619 X:3676676-3676698 ACAAGGAATCTGACATGGCTTGG + Intronic
1188102482 X:26106864-26106886 ATCAGCAATCTGGCAGAGTATGG - Intergenic
1188728041 X:33609002-33609024 ATAAGCAATCAGCCATAGGAAGG + Intergenic
1191975215 X:66863980-66864002 ATAAGCATTCTGGGAAACCTAGG - Intergenic
1192551679 X:72059466-72059488 ATAAGTGATCTGGTATAGCCAGG - Intergenic
1195245948 X:102995363-102995385 ATCAACAATTTGGCATGGCTTGG + Intergenic
1195363793 X:104108557-104108579 ATAAGCAATCTAGGAGAGCCTGG + Intronic
1196529653 X:116770707-116770729 AGAAGCAATCTGCAATAACTGGG + Intergenic
1199665179 X:150090769-150090791 ATAAGGGATATGGCATTGCTGGG + Intergenic
1199702658 X:150395251-150395273 ATAATCAGTCTTGCATACCTAGG + Intronic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1200791308 Y:7301984-7302006 ACAAGGAATCTGACATGGCTTGG - Intergenic