ID: 1147342809

View in Genome Browser
Species Human (GRCh38)
Location 17:39764697-39764719
Sequence CTCCTTGATCAGGCAGGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147342809_1147342814 16 Left 1147342809 17:39764697-39764719 CCGAAGCCTGCCTGATCAAGGAG 0: 1
1: 0
2: 0
3: 13
4: 182
Right 1147342814 17:39764736-39764758 TGTCCCTCCTCACCCCATTCCGG 0: 1
1: 0
2: 2
3: 20
4: 230
1147342809_1147342812 -7 Left 1147342809 17:39764697-39764719 CCGAAGCCTGCCTGATCAAGGAG 0: 1
1: 0
2: 0
3: 13
4: 182
Right 1147342812 17:39764713-39764735 CAAGGAGAACCTCTCAATAGAGG 0: 1
1: 0
2: 0
3: 13
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147342809 Original CRISPR CTCCTTGATCAGGCAGGCTT CGG (reversed) Intergenic
900188952 1:1345307-1345329 CTCCTGGCCCAGCCAGGCTTGGG - Intronic
902190737 1:14761282-14761304 CTCTTTGAAGAGGCAGGATTTGG - Intronic
905514936 1:38555732-38555754 CTCTGTGGTCAGACAGGCTTGGG - Intergenic
907304039 1:53504059-53504081 CTCCTTGAACAGGGATGCTGAGG - Intergenic
907476615 1:54710136-54710158 CTCCTGGATCATGCAGGCACTGG + Exonic
907699877 1:56775433-56775455 CTCATTCATAAGGCAGGCATGGG + Intronic
911092711 1:94030458-94030480 CTCCTGAATAAGCCAGGCTTTGG - Exonic
912429531 1:109621647-109621669 TGCCTTTACCAGGCAGGCTTAGG + Intronic
913064211 1:115235100-115235122 CTCCTTAATCACGCTGGCTCAGG - Intergenic
913209082 1:116568894-116568916 TTCCCTAATGAGGCAGGCTTGGG + Intronic
915245242 1:154551733-154551755 CTCCTTGGCCAGGCCGGCCTGGG - Intronic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
916807862 1:168277324-168277346 CTTCTTGCTCAGGATGGCTTTGG + Intergenic
918401676 1:184169137-184169159 CTCTTTGCTCAGGATGGCTTTGG + Intergenic
918458530 1:184752770-184752792 CTCTGGGATCAGACAGGCTTGGG + Intronic
919910557 1:202108057-202108079 ATCCTTGAACATGCAGGCTCTGG - Intergenic
919955183 1:202407482-202407504 CTCAGTGGTCAGGCAGGCTCTGG - Intronic
921007439 1:211108544-211108566 ATTCTTGATTTGGCAGGCTTGGG + Intronic
921149354 1:212387176-212387198 CTCCTTGGTGAGGCAGGCAAGGG - Intronic
923545187 1:234918695-234918717 CTTCTGGGTCAGGCAGGCTTGGG + Intergenic
1069959670 10:72072395-72072417 CTCCTTGAGCAGCCAGGCCCCGG - Intronic
1070593876 10:77819259-77819281 TTCCATGTCCAGGCAGGCTTGGG + Intronic
1070914585 10:80144727-80144749 CCCACTGATCAGGCAGGGTTGGG + Intronic
1070923034 10:80200924-80200946 CTCCGTGCTCAGGCAGACCTAGG - Intronic
1070956026 10:80464257-80464279 CTCCCTGTTCAGGCCGCCTTGGG + Intronic
1071165441 10:82800927-82800949 CCCCTTAATTAGGCAGTCTTAGG - Intronic
1072227415 10:93383494-93383516 CACCTTGATAAGGGAGGATTGGG + Intronic
1072779654 10:98239103-98239125 CTCCATGATTAGGTAGGCTGAGG - Intronic
1073374485 10:103021235-103021257 CTCCTTCGTCAGGGAGGCTGTGG - Intronic
1073446840 10:103586017-103586039 ATCCCTGAGCAGGCAGCCTTGGG + Intronic
1075177438 10:120178738-120178760 CTCCTTGCTCCGGCAGGCCTAGG - Intergenic
1076621675 10:131792931-131792953 CTCCTTGAGCAAGCGGGGTTTGG + Intergenic
1077418038 11:2434812-2434834 CCCCTGGATCAGCCAGGCTGTGG - Intergenic
1077847341 11:6039749-6039771 CTCCTTATTCAGGAAGGTTTTGG + Intergenic
1078550874 11:12279867-12279889 CACCATGACCAGCCAGGCTTGGG + Intronic
1080689382 11:34543661-34543683 CTCCTTGATCAAGCATGCCCTGG + Intergenic
1083884180 11:65563384-65563406 GTTCTGGATCAGGCAGGCTTGGG - Intergenic
1085337320 11:75706185-75706207 GTCCGTGGTCAGGCAAGCTTTGG - Intergenic
1088142395 11:106633198-106633220 CTCCTTTAACAGTAAGGCTTAGG - Intergenic
1089672868 11:120068517-120068539 CTCCATGTTCTGGCAGGCTCTGG + Intergenic
1090055921 11:123424859-123424881 CTCCTTGTTCAGGAAGTCCTTGG - Intergenic
1091020778 11:132097635-132097657 CTCCTAGGTCAGGCTGGCCTGGG + Intronic
1091537306 12:1423325-1423347 TTCGTTAATCAGGCAGCCTTAGG - Intronic
1092295351 12:7192850-7192872 GTCCCTGATCAGATAGGCTTCGG - Intronic
1093936474 12:25006715-25006737 CTACTTGAGCAGGGAGGCATGGG + Intergenic
1097865521 12:64556545-64556567 CTCCTTGCTCCGTCAGGCTGGGG + Intergenic
1100212590 12:92412602-92412624 GTCCATGATGAGGCAGGCTGAGG - Intergenic
1107285283 13:38783435-38783457 CTACTTGAGCAGGCTGGGTTGGG - Intronic
1107914650 13:45137111-45137133 CTCCTTGAGCAGGTTTGCTTAGG + Intronic
1108560720 13:51641357-51641379 CTCCATGAACAGGCTGGCTGCGG - Intronic
1111295170 13:86268489-86268511 CTCCATGATAAGGGATGCTTGGG - Intergenic
1114212715 14:20629000-20629022 GTCCTTGATGAGGGAGGCTGTGG - Intergenic
1117503383 14:56376124-56376146 CCTCTTGATCAGGCAGGCCCTGG + Intergenic
1118735026 14:68695028-68695050 TCCCTGGATAAGGCAGGCTTCGG - Intronic
1121114651 14:91335211-91335233 CTCGTGCATCAGGCAGACTTGGG + Intronic
1124473367 15:30008797-30008819 CTCAAAGATCAGGAAGGCTTGGG + Intergenic
1124786020 15:32681378-32681400 GTCCTTAATCAGGTAGACTTGGG - Intronic
1126561816 15:50052395-50052417 TTCCATGATGAGGTAGGCTTGGG + Intronic
1127174218 15:56336803-56336825 CTCCTACATCAGCCAGTCTTTGG + Intronic
1129773180 15:78215857-78215879 TTCCAAGATCAGGAAGGCTTGGG + Intronic
1130560688 15:84955885-84955907 TCCCTTGATCAGGAAGGCTGGGG - Intergenic
1132897091 16:2234213-2234235 CTTCTTGAGCAGGTAGGCCTTGG - Exonic
1133045767 16:3087518-3087540 CTCCTTCCTCAGGAAGGCTGGGG - Intergenic
1135123580 16:19787253-19787275 CTCCATGATAAGGGATGCTTGGG + Intronic
1135138095 16:19899383-19899405 CTCCTGGGTCAGGCAGGGATGGG - Intergenic
1137592120 16:49700079-49700101 CTCCTTGATCAGGCAGAAGAGGG + Intronic
1139100330 16:63759181-63759203 CTTTTTGCTCAGGAAGGCTTTGG - Intergenic
1141182346 16:81762746-81762768 CTGCCTGATCAGCCAGCCTTGGG - Intronic
1141993310 16:87622339-87622361 GTCCTTGCTCACGGAGGCTTGGG - Intronic
1142698970 17:1648370-1648392 CTCCTTGAGCAGGAACACTTTGG + Exonic
1142886993 17:2919157-2919179 CACATTTATCAGGCAGGGTTTGG - Intronic
1143103854 17:4518857-4518879 CTCCTTGAAAAGGAGGGCTTTGG - Intronic
1143633932 17:8153745-8153767 CTCATTGTTCAGGAAAGCTTAGG - Intronic
1144153329 17:12472540-12472562 CTGCCTGACTAGGCAGGCTTTGG + Intergenic
1147342809 17:39764697-39764719 CTCCTTGATCAGGCAGGCTTCGG - Intergenic
1150248636 17:63693974-63693996 CTCCTGGATCTGACAGGCTGGGG - Exonic
1152249604 17:79204841-79204863 CACCGTGGTCAGCCAGGCTTTGG + Intronic
1159769732 18:72535606-72535628 CTCCTTCCTGAGGCAGGTTTTGG + Intergenic
1162344670 19:10112306-10112328 CTCCTTAAGCAGGCTGGCGTTGG + Intronic
1163544107 19:17930810-17930832 CTCTTTGATCACCCAGGCTGTGG + Intergenic
1164383185 19:27752558-27752580 CTCTTTAATTAGGCAGCCTTTGG + Intergenic
1164478444 19:28593036-28593058 CTCCATGGTCAGGCAGGACTAGG + Intergenic
1166373441 19:42314608-42314630 CTCCTTGGCCAGGCAGTCCTGGG - Exonic
1167121645 19:47520941-47520963 CTTCTAGAGCAGGGAGGCTTGGG - Exonic
1167472844 19:49685018-49685040 CACCTTTATGAGGCAGGCGTTGG - Exonic
1168198774 19:54797526-54797548 CTCCTGGACCAGACAGGCTCTGG + Intronic
925897103 2:8480962-8480984 CTCCTTGATGAGACAGGTTTGGG + Intergenic
926285917 2:11488017-11488039 CTCCTTGAGGAGGTTGGCTTGGG + Intergenic
926710046 2:15872034-15872056 CTCCTAGATCAAGCAGGCCCAGG + Intergenic
927207721 2:20620625-20620647 CTCCTCCATCAGGCAGCCTCAGG + Intronic
928776488 2:34770402-34770424 CTTCTTGCTCAGGATGGCTTTGG + Intergenic
929422166 2:41803366-41803388 TTCTTTGGTCAGGTAGGCTTTGG + Intergenic
929433135 2:41905749-41905771 CTCATTGTTCAGGCTAGCTTGGG - Intergenic
929576280 2:43054823-43054845 CTCAATGTTCAGGCAGGCTGTGG + Intergenic
932475597 2:72003901-72003923 CTCCTTGAACAGACAAGCTGTGG + Intergenic
936275272 2:111090718-111090740 CTCTGTGATCAAGCAGGCTTTGG + Intronic
939896843 2:147801754-147801776 TACCATGATCAGACAGGCTTGGG + Intergenic
940218634 2:151327663-151327685 GTCCTTAAGCAGGCAGTCTTAGG + Intergenic
943312812 2:186347994-186348016 CTCCTAAACCAGGCAGACTTTGG - Intergenic
946094162 2:217257994-217258016 CTTCTTTATCATGCAGGCTCAGG - Intergenic
947350457 2:229238565-229238587 CTCCTTGATCAAGGTAGCTTTGG + Intronic
948260676 2:236602182-236602204 CTCCTTGTTTAGGCTGGCTGTGG - Intergenic
948558392 2:238834068-238834090 AGCCTGGAGCAGGCAGGCTTCGG + Intergenic
948751831 2:240137569-240137591 TTCCTTGCTCAGCCAGACTTCGG + Intergenic
1168986384 20:2052559-2052581 CTCCTATATCAGTCAGTCTTCGG + Intergenic
1171141336 20:22746416-22746438 CTCTTTGATCATTCAGGCTGGGG + Intergenic
1171188274 20:23138987-23139009 ATCCTTGATCAGACAGCTTTTGG - Intergenic
1172187747 20:33041855-33041877 CTCCTGCATCAGGGAGGCGTTGG + Intronic
1173184130 20:40827393-40827415 CTCCTCCATCAACCAGGCTTTGG + Intergenic
1178756207 21:35352619-35352641 CTCCTTGATCAGAATGGTTTTGG - Intronic
1180182930 21:46125944-46125966 CTCCTTGATGAGGCGGTCGTAGG - Exonic
1183503983 22:38198751-38198773 CCCCTTGTTCTGGCAGGCTGGGG + Intronic
1184307615 22:43617161-43617183 CTACTTGACCATGCAAGCTTTGG + Intronic
950791583 3:15476659-15476681 CTCCTTCCTCAGTCAGGCTATGG - Intronic
953607387 3:44420675-44420697 CTCCTTGATCAGGCTGGTTGAGG - Intergenic
954111106 3:48433642-48433664 CTCCATGATCTGCCAGGCTAGGG + Intronic
954317333 3:49808228-49808250 CCTCTTGATCAGACAGGCTGAGG + Intronic
954465185 3:50650212-50650234 CTCCTTCCTGAGGCAGACTTGGG - Intergenic
958952280 3:100429531-100429553 CTTCATCATCAGGCAGCCTTGGG - Intronic
959693685 3:109226663-109226685 CACCGGGATCAGGTAGGCTTGGG - Intergenic
960347494 3:116552360-116552382 CTCGTTATTCAGGCAGTCTTGGG + Intronic
961832274 3:129629352-129629374 CTCCTTGAGAAGGCAGCTTTGGG + Intergenic
962047326 3:131774594-131774616 CTTCATGATCAGTCAGGCCTGGG - Intronic
962864830 3:139439571-139439593 CTTATTGACCAGGCAGCCTTGGG + Intergenic
964127263 3:153248148-153248170 TTCCTTGATCCAGCAGGCTTGGG + Intergenic
969491889 4:7504153-7504175 CTCCTTGCTCAGGGACCCTTGGG + Intronic
970237459 4:13973088-13973110 CTCGCTGATCAGACAGGCCTGGG + Intergenic
971159449 4:24119044-24119066 TTCCTTTATCAGGCAGTCATTGG + Intergenic
972029140 4:34430179-34430201 CTCCTTAAGTAGACAGGCTTAGG + Intergenic
975666088 4:76736284-76736306 TTCCCTGATCTGGCTGGCTTGGG + Intronic
978684546 4:111423771-111423793 CTCCTAAATCATGCACGCTTGGG - Intergenic
980088667 4:128418285-128418307 ATCCTGAAACAGGCAGGCTTGGG + Intergenic
984882845 4:184425567-184425589 CTCCTTCATCAGCCTGGCTCAGG + Intronic
985312735 4:188619672-188619694 CCCCTTCCTCAGGCAGGCTTCGG - Intergenic
986890315 5:12296121-12296143 CTTTTTGATCAGGATGGCTTTGG + Intergenic
987264286 5:16235909-16235931 CCCCCTCAGCAGGCAGGCTTTGG + Intergenic
988160563 5:27514982-27515004 CTCCTTGGGCATGAAGGCTTGGG - Intergenic
992171777 5:74109178-74109200 CTCCTAAATCAGTCAGGGTTTGG + Intergenic
992622346 5:78606546-78606568 CTCCATGATCAGACAGTCTCTGG + Intronic
993687946 5:90963790-90963812 ATACTTGATCAGGCAGGCACAGG + Intronic
995322226 5:110848693-110848715 CTTCTTGTTCAGGATGGCTTTGG + Intergenic
997845060 5:137278593-137278615 CTCCTTGACCCCGCAGCCTTTGG - Intronic
998018652 5:138752704-138752726 GTCCTTGATCAAGAGGGCTTCGG + Intronic
998173039 5:139883438-139883460 CTCCTGGCACAGGAAGGCTTGGG + Intronic
1002088317 5:176789772-176789794 CTCCTGGTTGAGGCTGGCTTTGG + Intergenic
1002154514 5:177265930-177265952 CTCCTTTATGAGGCAGGCGTTGG + Intronic
1002329224 5:178429976-178429998 TTCCTTGTCCAGGCAGGCTCTGG + Intronic
1002575606 5:180172223-180172245 CTGAGTGCTCAGGCAGGCTTGGG - Intronic
1006774793 6:36583949-36583971 CTCCGTGATCCGCCCGGCTTCGG + Intergenic
1007529961 6:42533251-42533273 ATCCTCAATCAGACAGGCTTGGG + Intergenic
1008038996 6:46776005-46776027 CTCTTTGATCAGGCTGACTTGGG - Intergenic
1013420649 6:109963662-109963684 CTCCTACCTCAGGCAGGCCTTGG - Intergenic
1013432017 6:110063914-110063936 CTTCTGAATCAGGCAGGCTCTGG - Intergenic
1018798744 6:167206907-167206929 CTCCCTGATCAGCCAGGCTGGGG + Intergenic
1018813953 6:167317231-167317253 CTCCCTGATCAGCCAGGCCAGGG - Intergenic
1024970301 7:55063067-55063089 GTCCTGGAGCAGGCAGACTTTGG - Intronic
1030398211 7:109014844-109014866 CACCATGATCAAGTAGGCTTGGG + Intergenic
1030512171 7:110496215-110496237 CTTTTTGATCAGGAAAGCTTTGG + Intergenic
1034715418 7:153237018-153237040 CTCCTTGATCCAGCACCCTTGGG - Intergenic
1035377692 7:158416226-158416248 CTCCATAGTCAGCCAGGCTTGGG + Intronic
1035388435 7:158489769-158489791 CTCCTCGAGCAGGCAGCCTGCGG + Exonic
1035482456 7:159198245-159198267 CTCCATGCTCAGCCATGCTTGGG - Intergenic
1035786616 8:2266231-2266253 CGGCTGGAGCAGGCAGGCTTGGG + Intergenic
1035806191 8:2455485-2455507 CGGCTGGAGCAGGCAGGCTTGGG - Intergenic
1037244035 8:16811077-16811099 CTCCTTCATCAGTCAGACTCGGG - Intergenic
1037620194 8:20556735-20556757 CTTGGTGACCAGGCAGGCTTGGG - Intergenic
1039254893 8:35708197-35708219 CTCCATGAGCAGGCAGGCAGAGG + Intronic
1055061820 9:72076747-72076769 CTCCATCATCAGCCAGGCATGGG + Intergenic
1056235408 9:84588938-84588960 TTCCTGGATCAGTCAGACTTGGG + Intergenic
1058732445 9:107863173-107863195 CTTCTTGCACAGGCAGGCTATGG + Intergenic
1059696370 9:116733696-116733718 TTCCTGAATCAGGCAGGCTGGGG + Intronic
1188250825 X:27892211-27892233 CACCTTGGTCAGCCAGGTTTTGG - Intergenic
1188766172 X:34094720-34094742 CTTTTTGATCAGGGTGGCTTTGG - Intergenic
1195482235 X:105359016-105359038 TTCCTTCATCAGGCAGTCTTTGG + Intronic
1196721442 X:118858145-118858167 GTTCTGGATTAGGCAGGCTTTGG - Intergenic
1197036099 X:121875675-121875697 CTACTTCATCAGGAAGGCTATGG - Intergenic
1197887739 X:131235922-131235944 CTCCTCCAGCAGGCAGTCTTAGG + Intergenic
1198625948 X:138574167-138574189 CTTCTTGCTCAGGGTGGCTTTGG + Intergenic
1200255607 X:154580979-154581001 CCCCTTGACCAGTCAGGTTTGGG + Intergenic
1200262162 X:154623425-154623447 CCCCTTGACCAGTCAGGTTTGGG - Intergenic
1200686451 Y:6263937-6263959 CTCCTTGATCTGGCAGGTGGAGG - Intergenic
1200917107 Y:8580877-8580899 CACATTCATAAGGCAGGCTTGGG - Intergenic
1200960457 Y:8991593-8991615 CCCATTCATGAGGCAGGCTTAGG - Intergenic
1200989325 Y:9334854-9334876 CTCCTTGATCCGGCAGGTGGAGG - Intergenic
1200991994 Y:9355184-9355206 CTCCTTGATCCGGCAGGTGGAGG - Intergenic
1200994648 Y:9375464-9375486 CTCCTTGATCCGGCAGGTGGAGG - Intronic
1200997311 Y:9395810-9395832 CTCCTTGATCCGGCAGGTGGAGG - Intergenic
1200999826 Y:9464347-9464369 CTCCTTGATCCGGCAGGTGGAGG - Intergenic
1201002484 Y:9484656-9484678 CTCCTTGATCCGGCAGGTGGAGG - Intronic
1201005144 Y:9504943-9504965 CTCCTTGATCCGGCAGGTGGAGG - Intergenic
1201007802 Y:9525270-9525292 CTCCTTGATCCGGCAGGTGGAGG - Intergenic
1201010418 Y:9545460-9545482 CTCCTTGATCAGGCAGGTGGAGG - Intergenic
1202125452 Y:21565446-21565468 CGCATTCATGAGGCAGGCTTGGG - Intergenic
1202128464 Y:21589107-21589129 CACATTAATGAGGCAGGCTTGGG - Intergenic
1202153556 Y:21863946-21863968 CGCATTCATGAGGCAGGCTTGGG + Intergenic
1202579424 Y:26363671-26363693 CTCAGTGGTCAGGCAGGCTCTGG + Intergenic