ID: 1147342832

View in Genome Browser
Species Human (GRCh38)
Location 17:39764802-39764824
Sequence CCTCCCCCTCCCCACAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 672
Summary {0: 1, 1: 1, 2: 13, 3: 70, 4: 587}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147342832_1147342838 21 Left 1147342832 17:39764802-39764824 CCTCTCCTGTGGGGAGGGGGAGG 0: 1
1: 1
2: 13
3: 70
4: 587
Right 1147342838 17:39764846-39764868 TTTTTTGTGGAAAATATCATTGG 0: 1
1: 1
2: 14
3: 170
4: 1236
1147342832_1147342837 8 Left 1147342832 17:39764802-39764824 CCTCTCCTGTGGGGAGGGGGAGG 0: 1
1: 1
2: 13
3: 70
4: 587
Right 1147342837 17:39764833-39764855 TACTTTTTGGACTTTTTTTGTGG 0: 2
1: 1
2: 10
3: 111
4: 1076
1147342832_1147342835 -5 Left 1147342832 17:39764802-39764824 CCTCTCCTGTGGGGAGGGGGAGG 0: 1
1: 1
2: 13
3: 70
4: 587
Right 1147342835 17:39764820-39764842 GGAGGCTGAGCCATACTTTTTGG 0: 1
1: 0
2: 0
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147342832 Original CRISPR CCTCCCCCTCCCCACAGGAG AGG (reversed) Intergenic
900228700 1:1545085-1545107 CCTTCCCTGCCCCACAGCAGAGG + Intronic
900352370 1:2241366-2241388 CCTCCCCCTCAAAATAGGAGAGG - Intronic
900409961 1:2508008-2508030 CCTCCCCCTCAGCCCAGGTGTGG - Intergenic
900429593 1:2595481-2595503 CCAGCCCCTCACCACAGGACAGG - Intronic
900431806 1:2606218-2606240 CCTACCCCTGCCCACCGGCGCGG + Intronic
900462188 1:2807031-2807053 CCACCCCCACCCCGCAGGAGGGG - Intergenic
900500379 1:3001601-3001623 CCACCCCCACCCCTCAGGATCGG + Intergenic
900612101 1:3548588-3548610 CCTGCCCCACACCAGAGGAGGGG - Intronic
901399695 1:9007380-9007402 CCTGCCTCTCCCCACAGAACAGG - Exonic
901641175 1:10693997-10694019 TGTCCCCCGCCCCGCAGGAGCGG + Intronic
901843156 1:11966234-11966256 CTTCCCACTTCCCACAGGACTGG + Exonic
903186897 1:21634051-21634073 CCCCCCCCCCCCCCCGGGAGGGG - Intronic
903321493 1:22546057-22546079 CCTCCCTCTTCCCCCAGGAAAGG + Intergenic
903383632 1:22913218-22913240 CTTCCCCCTCCCAATAGCAGGGG + Intronic
904466597 1:30711776-30711798 TCTCCCCCTCCCCACCTGTGTGG + Exonic
904556692 1:31369552-31369574 CTTCCCCCTACCCTCAGGTGTGG - Exonic
904884518 1:33726267-33726289 CCTCCCCAGCCCCCAAGGAGGGG - Intronic
905466145 1:38155174-38155196 CCTCACCAGCCCCACAGGTGGGG - Intergenic
905749563 1:40450344-40450366 CCTCCTCCTCCCCAAATGAGAGG - Intronic
905856764 1:41319672-41319694 CTTCCCCTCACCCACAGGAGGGG - Intergenic
905971263 1:42144188-42144210 CATCCCCCTCCTCACGGGTGTGG - Intergenic
906380398 1:45328750-45328772 CCAGCCCCTCCCCACCTGAGTGG - Intergenic
906594549 1:47063169-47063191 TCTCCCCCTTCCCCTAGGAGTGG - Intergenic
906678878 1:47711556-47711578 CCTCCTCCTCCTTACAGGTGGGG + Intergenic
908193292 1:61725152-61725174 CTTCCGCCTCCGCCCAGGAGCGG + Intronic
909205772 1:72755786-72755808 CCACCCTCTCCCATCAGGAGAGG + Intergenic
910704872 1:90118037-90118059 TGTCTCCCTCCCCACAGGTGTGG - Intergenic
910892059 1:92028837-92028859 CCTCCCCCTCACCCCAAGACAGG + Intergenic
912472808 1:109917184-109917206 TCTCCCCCTTCCCCCAGGGGAGG - Intronic
915275270 1:154784087-154784109 ACTCCCACCCCACACAGGAGGGG - Intronic
915299724 1:154945112-154945134 CCTCTTCCTCCCCACAGGTCAGG - Exonic
915489971 1:156245499-156245521 CTTCCCCGTCCCCACTGGAGGGG + Intronic
915537183 1:156543937-156543959 CCTCTCCCTCCCAACAGCTGGGG + Intronic
915977626 1:160401082-160401104 CCTTCCCCTCCCCAAAGTTGGGG - Intronic
916314014 1:163427520-163427542 CCTCCCCCTCCTCCCAGGAGAGG + Intergenic
916713901 1:167434466-167434488 ACCCTCCCTCCCCACAGGAGGGG + Intronic
917705059 1:177624201-177624223 ACTCCCCTTCCCCACTGGTGAGG + Intergenic
918011120 1:180587299-180587321 CCTCCACCTCCCTCCAGGAATGG - Intergenic
918171857 1:182004825-182004847 CCTCCCCCTTCCCCTAGGGGTGG - Intergenic
918332351 1:183472379-183472401 CCTCCCCCTCCCCCCCGGGTCGG + Intronic
918798532 1:188939092-188939114 CCTCCTCCTCCTCACTGGAATGG - Intergenic
919194229 1:194263313-194263335 CCCCCCCCCCCCCCCAGTAGCGG + Intergenic
919513606 1:198494908-198494930 CTGCACCCTCCCCACAGCAGTGG + Intergenic
919728486 1:200898600-200898622 CCTCCCCCTCCTCCCAGCAGAGG - Intronic
919937851 1:202266467-202266489 CCACCCCCACCCCACCAGAGTGG + Intronic
920231005 1:204469500-204469522 ACTCACTCTCCCCACAGGAAGGG - Exonic
920660589 1:207911153-207911175 CCGCCCCCTCCGCCCGGGAGAGG + Exonic
922440813 1:225653504-225653526 CCTCCCGCTCCCCAGAGGCTTGG + Intergenic
922481361 1:225941700-225941722 CCTGCCTCTCCCCACACCAGGGG + Intergenic
922712437 1:227844322-227844344 CCTCCCCTACCCCCCATGAGTGG + Intronic
922728750 1:227939332-227939354 ATTCCCCAGCCCCACAGGAGTGG + Intronic
922731245 1:227949692-227949714 GTGCCCTCTCCCCACAGGAGGGG - Intergenic
923440647 1:234016867-234016889 CCTCCCCCTTCCTCCTGGAGTGG - Intronic
923474610 1:234321040-234321062 CCCCCCCCACCCCAAAGGAATGG + Intronic
923628539 1:235634093-235634115 CCTCACCCTCCCTGGAGGAGTGG - Intronic
923863608 1:237916743-237916765 CCTCGACCTCCTCAGAGGAGAGG - Intergenic
923984532 1:239366105-239366127 CCTCCCCCTCCCCAGAAGTCAGG - Intergenic
1063381914 10:5590953-5590975 CCTCCCCCTGGCCCCTGGAGCGG - Intergenic
1063959869 10:11298197-11298219 CATCCCCCTCGCCACAGGAGAGG - Intronic
1064445125 10:15386230-15386252 CCTTCCCCTCCCACCAGGTGGGG - Intergenic
1064487198 10:15806040-15806062 ACTCCTCCTACCCACAGGATGGG + Intronic
1064757451 10:18584129-18584151 CCCCCTACTCCCCACAAGAGTGG - Intronic
1065029116 10:21567449-21567471 CCTCCCTGTCCCTACTGGAGTGG - Intronic
1066021588 10:31309219-31309241 CCTCCCCCACCCCACACAACAGG + Intergenic
1066084565 10:31963519-31963541 CCTCCCCTTTCCAATAGGAGAGG - Intergenic
1066649853 10:37643725-37643747 CCTCCCCCACTCCCCAGTAGTGG - Intergenic
1066802242 10:39205180-39205202 CCTCATCCTCCCCACAGCAGAGG - Intergenic
1067066014 10:43104808-43104830 CCTCCTCCGCTCCACAGGGGAGG - Intronic
1067094450 10:43289826-43289848 CATCCACCTCCTCACAGGTGAGG - Intergenic
1067428601 10:46227513-46227535 GCTGCCCCTCCCCCGAGGAGGGG + Intergenic
1067434939 10:46270153-46270175 CCTCCCCCTACCCATGGGACAGG - Intergenic
1067803852 10:49379953-49379975 CCTCCTCATCCCCTCTGGAGAGG - Intronic
1068297995 10:55100557-55100579 CCTTCCCCTTCCAACATGAGTGG - Intronic
1069594495 10:69661956-69661978 CCTGTCCCTCCCCAAAGCAGAGG - Intergenic
1070647616 10:78212571-78212593 CCTGCCCCGCCCCCCAGCAGTGG + Intergenic
1071601109 10:86959153-86959175 CCACCCTCTCCACACGGGAGCGG + Intronic
1071604587 10:86976339-86976361 CCTCAGCCTCCCCACAGCACTGG + Intronic
1072231989 10:93421702-93421724 CCTTCCCCTTCCCCCATGAGTGG + Intronic
1072854883 10:98936287-98936309 CATCCCCCTTTCCACAGGAGTGG + Intronic
1074132356 10:110592011-110592033 CCTCCCCCTCCCAAAGTGAGGGG - Intronic
1074533961 10:114315503-114315525 CCTGCCCCTTCCCCAAGGAGAGG + Intronic
1074870627 10:117573145-117573167 ACTCCTCCTCCGCTCAGGAGAGG - Intergenic
1074939772 10:118223306-118223328 CACCCCCATCCCCACTGGAGTGG + Intergenic
1074974973 10:118572687-118572709 CCTCCCCCTCCCTACTGGGGTGG + Intergenic
1076081982 10:127590590-127590612 CCTCCCTCACCACTCAGGAGGGG - Intergenic
1076156109 10:128206975-128206997 CCTCACCCACCTCACTGGAGAGG - Intergenic
1076586548 10:131552275-131552297 CCTCCCCCCACCGACAGCAGAGG - Intergenic
1076723126 10:132401422-132401444 CCTTCCCTTCCCCACAGGCAAGG + Intronic
1077049872 11:561745-561767 CTGCGCCCTCCCCACAGGACAGG + Exonic
1077264161 11:1640813-1640835 CTTCCATCTTCCCACAGGAGTGG + Intergenic
1077412622 11:2410660-2410682 CCGCCCCCTCCCCACTGCACTGG + Intronic
1077556582 11:3228906-3228928 CCTGCTCCTCCCCACATCAGGGG + Intronic
1077599301 11:3562584-3562606 CCCCCTCCTCCCCACAGGAGGGG + Intergenic
1077858750 11:6156748-6156770 CCTCCCCCACCCCCCAGCAGTGG + Intergenic
1077897619 11:6465484-6465506 CCTCACCCTCCCCACAGGGGAGG + Intronic
1079276225 11:19040180-19040202 CAACCCCCTCCCCACGAGAGTGG - Intergenic
1079428174 11:20363690-20363712 CCTCGCCCCGCCCACAGGGGCGG - Intronic
1079449199 11:20584750-20584772 CCTCCCCCAGCCAACAGGAAGGG + Intergenic
1079513661 11:21240757-21240779 CCTCCCCCCCCCCACTAGAAAGG - Intronic
1079854605 11:25586350-25586372 CCTCCCACTCCCAACAGGCCCGG + Intergenic
1081001778 11:37682515-37682537 GCTCCCCCTCCCACCAGGGGTGG - Intergenic
1083132026 11:60633655-60633677 ACTCCTCCTTCCCCCAGGAGTGG - Intergenic
1083163168 11:60867884-60867906 CCACCCCCTCACCACAGAAAAGG + Intronic
1083342517 11:61967743-61967765 CCGCCCCTCCCCCACAGCAGGGG - Intergenic
1083628911 11:64085905-64085927 CCACCCCACCCCCACAGAAGGGG + Intronic
1083648338 11:64185995-64186017 CCTCCCCCGCACCTCAGGATTGG - Intronic
1083656423 11:64231974-64231996 GCTCCCCCTCCCCACCTCAGGGG - Intronic
1083792470 11:64994758-64994780 CCTCCCACCCTCCACATGAGCGG - Intronic
1084418335 11:69047630-69047652 CTCCCCCCTCCCCAAAAGAGGGG + Intergenic
1084603874 11:70161788-70161810 GCTCTCCCTCCCCACAGGTTGGG + Intronic
1084698222 11:70768908-70768930 CCTTCCCCACCCCCCTGGAGTGG - Intronic
1084805009 11:71572696-71572718 CATCCCCAGACCCACAGGAGAGG + Intergenic
1084817546 11:71658109-71658131 CCCCCTCCTCCCCACAGGAGGGG - Intergenic
1084964290 11:72736356-72736378 CCTCCCCCTCCCCAGTAGCGGGG + Intronic
1085051034 11:73380348-73380370 TTGCCCCCTACCCACAGGAGTGG - Intronic
1086401548 11:86465195-86465217 CCTCTCCCTCCACACAGGTTTGG - Exonic
1086437541 11:86797227-86797249 CGACCCCCTCCCCACTGGGGAGG + Intronic
1088743246 11:112784264-112784286 CCTCCCCCTACACACAGGTAAGG - Intergenic
1089603271 11:119627680-119627702 CCTCTCCCTCGCCAAAGAAGGGG - Intronic
1090113604 11:123942668-123942690 CCTCCTCCTCCCCACAGAGAAGG - Intergenic
1090137283 11:124210687-124210709 CCAGCCCCTCCCCACAGCAGTGG + Intergenic
1091853685 12:3721844-3721866 CCTTCCCCTCCCCACAGCCCTGG - Intronic
1091917021 12:4277012-4277034 CCTCCCCCTCCTCACTGGTAGGG + Intronic
1092211714 12:6650796-6650818 CCTAGCCCTCACCACAGGAGGGG + Exonic
1092250225 12:6890997-6891019 CCTCCCCCTGCCCACTAGCGGGG + Intronic
1092425445 12:8371930-8371952 CCCCCTCCTCCCCACAGCAGGGG + Intergenic
1092528538 12:9325796-9325818 CCTCACCCTCCCCGCAGCGGAGG - Intergenic
1093116797 12:15221493-15221515 CCTGCCCCTGCCCCCAGTAGGGG - Intronic
1094656010 12:32419925-32419947 CCTCCCCCTTCTCCCAGCAGTGG - Intronic
1095962379 12:47843848-47843870 CCACCCCCTCCCCAGGGGAGAGG - Exonic
1095989742 12:48026489-48026511 CCTCCCCCTCCCTGCAAGTGGGG + Intergenic
1096024814 12:48351107-48351129 CCGCACCCTCCCCACAGCGGCGG - Intronic
1096071857 12:48779994-48780016 GCTCCCCCTCCCAGCAGCAGGGG + Intronic
1096073653 12:48789172-48789194 CCTCCCCCTCCCCAGAAGTGGGG + Intergenic
1096103578 12:48983859-48983881 CTAACCCCTCCCCACAGGGGAGG + Intergenic
1096747572 12:53738698-53738720 CCTCCCCCGCCGCTCAGGGGAGG + Intergenic
1097090412 12:56500224-56500246 CCTCGACCTCCTCAGAGGAGAGG + Intergenic
1097250111 12:57627853-57627875 CCTCCCTCTCCCTGCAGGTGGGG - Exonic
1098130468 12:67344979-67345001 CCTCCCCCTCCCCTCACCACAGG + Intergenic
1098130472 12:67344984-67345006 CCCTCCCCTCACCACAGGACAGG + Intergenic
1098217551 12:68236174-68236196 CCTCTCCCTCTCCCCAGGCGGGG - Intergenic
1098352441 12:69577985-69578007 CCTCCCCCTCCCCAAAACTGTGG + Exonic
1098503830 12:71226504-71226526 CCTCCCCCATCCCACAGCAGTGG + Intronic
1099129679 12:78811485-78811507 CCTCCCCCGCCCCCCATGACAGG - Intergenic
1099303605 12:80927860-80927882 CCCCCACCTCCCCACAGGCCTGG + Intronic
1100115058 12:91294319-91294341 CAGCCCCCTTCCTACAGGAGTGG - Intergenic
1100504843 12:95209279-95209301 CCTTCTGCTCCCCACTGGAGAGG + Exonic
1100980698 12:100160043-100160065 CCACCCCCCGCCCCCAGGAGCGG + Intergenic
1102609505 12:114099174-114099196 CCTCCCCCTCCCATGAGGGGTGG - Intergenic
1102930925 12:116861550-116861572 CCTCCCCCTCCCGACATCCGGGG - Intronic
1103432892 12:120903691-120903713 CCCCCTCTTCCCCACCGGAGGGG - Intronic
1104021534 12:124995164-124995186 GGTGCCCCTGCCCACAGGAGAGG - Intronic
1104455927 12:128912046-128912068 CCTCCACCTCCACGCAGGGGCGG + Intronic
1104764103 12:131315361-131315383 CCTCTCCCTCCCCCGAGCAGTGG - Intergenic
1104921354 12:132292348-132292370 CTCCCCCCATCCCACAGGAGAGG + Intronic
1105419202 13:20237833-20237855 CCTCTCCCCCCCCAGAGCAGGGG - Intergenic
1106090143 13:26584038-26584060 CCTCCCCCACCTCCCTGGAGGGG + Intronic
1107447089 13:40479391-40479413 CCTCCCGCTGCCCACCGAAGTGG + Intergenic
1107655831 13:42591395-42591417 CCTCACCCTCCCCAGAGGAGAGG - Intronic
1107773333 13:43811591-43811613 CCTCCTCTTCCCCACTGGAGGGG + Intergenic
1108273179 13:48783092-48783114 CCTCCCCCTTCCCCTAGGAATGG + Intergenic
1108572818 13:51767769-51767791 CCCCCCCCCCGCCCCAGGAGAGG - Intergenic
1113281514 13:108793499-108793521 GCTCTTTCTCCCCACAGGAGTGG + Exonic
1113456844 13:110455352-110455374 CCTCCCGCTCCCCACTTCAGGGG + Intronic
1113631831 13:111893509-111893531 CCTGCCCTTCGCCACGGGAGTGG - Intergenic
1113820433 13:113209234-113209256 GCTCCCGATCCCCTCAGGAGGGG + Intronic
1113855955 13:113445595-113445617 CCCTCCCCTCCCCAAAGGTGGGG - Intronic
1116392712 14:44412982-44413004 CCTCCCCCATCCTACAGCAGTGG + Intergenic
1116671259 14:47845986-47846008 CAGCCCCCTTCCCACAAGAGTGG - Intergenic
1116964263 14:50998227-50998249 CCTCCCTCGCCCCTCAGAAGGGG - Intronic
1118864833 14:69694778-69694800 CTTCCTCCCCCTCACAGGAGAGG - Intronic
1119242689 14:73074565-73074587 CCCCCACCTCCCCACAAGACAGG - Intronic
1119261530 14:73240794-73240816 CCCCCTCCTCCCCAAAGGTGGGG - Intronic
1120857263 14:89223352-89223374 CCTCCCCTTTCCCACAGCAAAGG + Intronic
1122049035 14:99042774-99042796 CCCCCCCCCCCCCACAGTAAAGG + Intergenic
1122211770 14:100178291-100178313 GCTCCCCCTCCTCCCAGGTGGGG - Intergenic
1122377782 14:101277787-101277809 CCTCCCCATCCCTACTGAAGTGG + Intergenic
1122443325 14:101749819-101749841 CCTGCCCCCCCCCAGAGGTGGGG + Intergenic
1122500050 14:102191407-102191429 CATCCCCCGCCCCCCAGAAGAGG + Intronic
1122688083 14:103519356-103519378 CCTCCCCCACCCTGCAGGATGGG + Intergenic
1122931318 14:104933998-104934020 CCTCCCCGTCCCCTCAGCCGCGG - Exonic
1122931334 14:104934033-104934055 CCTCCCCGTCCCCTCAGCCGCGG - Exonic
1123021235 14:105398795-105398817 ACCCCGCCTCCCCACCGGAGAGG + Intronic
1123086661 14:105720052-105720074 CCAACCCCTCGGCACAGGAGTGG + Intergenic
1123991125 15:25684083-25684105 TCTCCCTCTCCCCCCAGCAGAGG - Intronic
1124001991 15:25767619-25767641 CCTGGCCCACCCCACATGAGGGG + Intronic
1124233180 15:27964576-27964598 CCGCCCCCTCCCCAATGGACTGG - Intronic
1124587729 15:31024996-31025018 TCTGCCCCAGCCCACAGGAGGGG - Intronic
1125373147 15:38999994-39000016 CAGCCCCCTCCCCACGAGAGTGG - Intergenic
1125574266 15:40744729-40744751 ACTCCCCCTCCCAAGAGGGGAGG + Intronic
1125610100 15:40963984-40964006 TCTCCCTGTCCCCACAGGAAAGG + Intergenic
1126660846 15:51031530-51031552 CCTCTCCCTCCCCCCAGCACTGG - Intergenic
1126703092 15:51384771-51384793 CCTCCCTCTGCCCTCAGCAGTGG - Intronic
1128263493 15:66249565-66249587 CCTCCCCCTCCCCATCCAAGAGG - Intronic
1129104545 15:73297068-73297090 CATCCCTCTCCTCACAGGTGGGG + Intronic
1129247217 15:74286853-74286875 CCTGCCCCTCCCCTCAGTGGTGG - Intronic
1129281661 15:74489915-74489937 CCTCACCCTCCCCAAATGACAGG - Intergenic
1129385746 15:75195463-75195485 CCTCCTGCTCCCCAGAGTAGGGG - Intergenic
1129703921 15:77783848-77783870 CCTCCCACTCCCGGCTGGAGTGG - Intronic
1129769632 15:78194721-78194743 TCTCCCCCACCCCACAGAGGAGG - Exonic
1130511660 15:84594759-84594781 CCTCCCCCATCCCTCAGCAGTGG + Intergenic
1131106234 15:89736731-89736753 CTTTCCCCTCCCCACACAAGAGG - Intronic
1131570948 15:93535526-93535548 CCCACCCCTCCCCACAGGGCTGG + Intergenic
1131847278 15:96501301-96501323 CCTCCTCCAGCCCCCAGGAGTGG - Intergenic
1131938296 15:97532510-97532532 CTTACCCCTCCCCATAGGAATGG + Intergenic
1132227615 15:100154729-100154751 CCCTCCCCTCCCCAGAGGTGAGG + Intronic
1132642603 16:984644-984666 CCCCACCCGCCCCACAGAAGGGG + Intronic
1132648508 16:1010020-1010042 CGGCCCCCGCCCCACACGAGGGG - Intergenic
1132670523 16:1100568-1100590 CCTCCCGCACCCCCCAGGATGGG - Intergenic
1132689900 16:1177762-1177784 CCTCCACCTCCCACCAGGTGAGG - Intronic
1132745898 16:1436212-1436234 CCCCACCTTCCCCACTGGAGGGG - Intronic
1132843429 16:1989617-1989639 CTTCCCCCAACCCACGGGAGAGG - Intergenic
1132854409 16:2038494-2038516 CCGCCCCCTCCCCTCAGCAGCGG + Exonic
1132858132 16:2056585-2056607 CCAGCTCCTCCCCACAGGAGAGG - Intronic
1133372907 16:5258998-5259020 CCCCCTCCTCCCCACAGGAGGGG - Intergenic
1133780680 16:8936635-8936657 CCTCCCCCATCCCCCAGCAGAGG - Intronic
1133789188 16:8996125-8996147 CCTCCCCCTGGCCACTGGATTGG + Intergenic
1133874457 16:9720692-9720714 CCTCTCCCTCCCCGAAGGAAAGG + Intergenic
1133930019 16:10224417-10224439 CCTCCCACAACCCACAGGTGGGG + Intergenic
1134166826 16:11937018-11937040 TCTCCCTCTCCCCTCAGAAGAGG + Intronic
1134493878 16:14716694-14716716 TCTCCCTCTCCCCTCAGAAGAGG - Intronic
1134499258 16:14755818-14755840 TCTCCCTCTCCCCTCAGAAGAGG - Intronic
1134546598 16:15113923-15113945 TCTCCCTCTCCCCTCAGAAGAGG + Intronic
1134547083 16:15118406-15118428 TCTCCCTCTCCCCTCAGAAGAGG + Intronic
1135312218 16:21414433-21414455 TCTCCCTCTCCCCTCAGAAGAGG + Intronic
1135365166 16:21846889-21846911 TCTCCCTCTCCCCTCAGAAGAGG + Intronic
1135380557 16:21992868-21992890 CCTCCCTCCCTCCACAGGTGGGG - Intronic
1135446673 16:22524450-22524472 TCTCCCTCTCCCCTCAGAAGAGG - Intronic
1135526582 16:23217726-23217748 CCTCCTCCTCCCCAATGGTGGGG + Intergenic
1135860441 16:26051197-26051219 ACTCCCCACCCCCACAGGAAGGG - Intronic
1136065043 16:27753135-27753157 CCTCCCCCTCCCCACATCTAAGG + Intronic
1136151389 16:28352355-28352377 TCTCCCTCTCCCCTCAGAAGAGG + Intronic
1136167621 16:28466196-28466218 TCTCCCTCTCCCCTCAGAAGAGG + Intronic
1136195355 16:28648819-28648841 TCTCCCTCTCCCCTCAGAAGAGG - Intronic
1136211693 16:28762935-28762957 TCTCCCTCTCCCCTCAGAAGAGG - Intronic
1136229138 16:28876787-28876809 CATCCCCCTCCCCAAAAGTGGGG + Intergenic
1136256414 16:29042886-29042908 TCTCCCTCTCCCCTCAGAAGAGG - Intronic
1136308921 16:29393424-29393446 TCTCCCTCTCCCCTCAGAAGAGG + Intronic
1136322338 16:29494955-29494977 TCTCCCTCTCCCCTCAGAAGAGG + Intronic
1136403628 16:30031140-30031162 CCTCCCCCTCCCCACCGAGGGGG - Exonic
1136437017 16:30234927-30234949 TCTCCCTCTCCCCTCAGAAGAGG + Intronic
1137005766 16:35273338-35273360 CCTCACCCTCCCCACAGCGGAGG - Intergenic
1138376964 16:56570996-56571018 TCTTCCTGTCCCCACAGGAGAGG + Intergenic
1138490564 16:57373856-57373878 CCTCCCCCAATCCACCGGAGAGG - Intronic
1138501990 16:57452295-57452317 CCTTCCCCTCCCCATAGGCACGG - Intronic
1138511594 16:57511768-57511790 CTTCCTCCTCGCCACAGGAGTGG + Intergenic
1138526683 16:57612609-57612631 CCTCCTCCGCCCCACATTAGTGG - Intronic
1138671920 16:58622324-58622346 CCCCCCCCCCCCCACTAGAGTGG - Intronic
1139328577 16:66170318-66170340 CCTCCCTCTCCCAAAAGGAAAGG + Intergenic
1139856624 16:69985857-69985879 TCTCCCTCTCCCCTCAGAAGAGG + Intergenic
1139891038 16:70253474-70253496 CCTACCCCTTCCCAGAGCAGGGG + Intronic
1139938216 16:70586622-70586644 TCTGCCCCTCACCACGGGAGGGG - Intronic
1140125058 16:72111858-72111880 CCCCCTCCTCCCCAGAGGTGAGG + Intronic
1140366105 16:74382200-74382222 TCTCCCTCTCCCCTCAGAAGAGG - Intronic
1140918356 16:79513990-79514012 CCTTCCCCTCACCACAAAAGAGG + Intergenic
1141135121 16:81459988-81460010 ACTTCCCTTCCCCACTGGAGGGG - Intronic
1141988557 16:87595872-87595894 CCCCCCTCTCCCCACTTGAGTGG + Intergenic
1142138282 16:88461321-88461343 CCACCCCATCCCCACCGCAGGGG + Intronic
1142236295 16:88924134-88924156 CCTGCCCCGCCCCACCGCAGGGG - Intronic
1142247592 16:88976984-88977006 CCACCCCCTCCCCAGGGCAGAGG - Exonic
1142259963 16:89038037-89038059 CCTGCCCCTGCCCCCAGGACTGG - Intergenic
1142406656 16:89893958-89893980 CCTGCCCTTCCCAACAGGAAGGG + Intronic
1142671726 17:1490823-1490845 CCCACCCCTCCCCCCAGGAGGGG + Intronic
1143516627 17:7422465-7422487 CCTCCCCCTCCCCTGAGGCAGGG + Intergenic
1143877342 17:10002063-10002085 CTTCCCCCGCCCCACACTAGTGG - Intronic
1144872853 17:18381350-18381372 CCATCCCCTGCCCACAGGACCGG + Exonic
1144996375 17:19272107-19272129 TCACCCCCACCCCACAGGACAGG - Intronic
1145993201 17:29091389-29091411 TCTTCCCCTCCCCCAAGGAGGGG - Intronic
1146063186 17:29617614-29617636 TCTCCCCCTCCCCCCAGGAGAGG - Exonic
1146661205 17:34666240-34666262 CCTCTCCCTACCAGCAGGAGAGG + Intergenic
1146678971 17:34793421-34793443 CCTCCCCCTCGCCTCTGGGGAGG + Intergenic
1147184469 17:38705841-38705863 CCTCCCCCACCCCACCTGAAGGG + Intronic
1147250487 17:39150406-39150428 CCTCCCTCACCCCACCTGAGGGG + Intronic
1147312571 17:39604176-39604198 CCCACCCCTCACCCCAGGAGGGG + Intronic
1147342832 17:39764802-39764824 CCTCCCCCTCCCCACAGGAGAGG - Intergenic
1147917397 17:43896913-43896935 CCACCTCCCCCCCTCAGGAGAGG + Intronic
1147924023 17:43935789-43935811 CCACCCCCTCCCCATGGCAGCGG + Intergenic
1148332246 17:46819740-46819762 CCCACCCCTCCCCACAGGAAAGG + Intronic
1148760097 17:49995121-49995143 CCTCCCCCTCCCCCCAGACGCGG - Exonic
1148847554 17:50538214-50538236 CCATCCCCTCCCCACCGCAGTGG - Intronic
1148906076 17:50913121-50913143 CCCTCCACTCCCCACAGGGGAGG + Intergenic
1149633090 17:58142737-58142759 CCCCCACCTCCCCCCAGGATGGG - Intergenic
1150614209 17:66756331-66756353 CCTCTCCCACCCAAGAGGAGAGG + Intronic
1151071055 17:71212057-71212079 CCTCCCACTCCCCACTGAGGAGG + Intergenic
1151078896 17:71305232-71305254 TCTCCCCCTTCCCCCAGGAATGG - Intergenic
1151086205 17:71384041-71384063 CCTCCCCATCCCCACAGGGAAGG - Intergenic
1151124124 17:71826735-71826757 CCTCCCTCTCTCCACAGGTGGGG + Intergenic
1151215929 17:72576346-72576368 CCTCCCCCTCCCCCCTCGAAGGG + Intergenic
1151315658 17:73320590-73320612 CCTCACTCTCCCCACAAGAAGGG - Intergenic
1151364171 17:73606367-73606389 CCTGCCCCCCCTCAGAGGAGGGG - Intronic
1151445190 17:74159125-74159147 GCTCCCCCTGCCCACAGCAGTGG + Intergenic
1151783260 17:76261745-76261767 TCTCCCCATCCCCACAGAGGCGG + Intergenic
1152252314 17:79218521-79218543 ACTCCCCCTCTCCCCAGCAGGGG - Intronic
1152461212 17:80443528-80443550 CCTTCTCCTCCCTACAAGAGAGG + Intergenic
1152781146 17:82227979-82228001 CCTCCCCTTGCCCTCTGGAGGGG + Intergenic
1152795381 17:82303844-82303866 CCTCCCCTGCCCCACAGAAGTGG - Intergenic
1152879778 17:82808392-82808414 CCTCATCCTCTCCACAGCAGGGG - Intronic
1153201925 18:2655822-2655844 CGTCCCCTTCTCCTCAGGAGTGG + Exonic
1153229151 18:2920241-2920263 GGTCCCCCTCCCCACAGCAAGGG - Exonic
1153619303 18:6962054-6962076 CATGCCCTTCCCTACAGGAGAGG - Exonic
1153647069 18:7204915-7204937 CCTCTTCCTCCTCACAGGAAAGG - Intergenic
1154118099 18:11629122-11629144 TCTCCCTCTCCCCTCAGAAGAGG + Intergenic
1154501929 18:15001524-15001546 CACCCCCATCCCCACGGGAGGGG - Intergenic
1157867259 18:51197424-51197446 CCGCCGCCTCCCCAGAGGAAAGG - Intronic
1157954428 18:52081362-52081384 CCTCTCCGTACCCACAGCAGTGG + Intergenic
1158236508 18:55321882-55321904 CCTCCCCCGCCCGCCAGGAATGG - Intronic
1159387233 18:67742144-67742166 CAGCCCCCTTTCCACAGGAGTGG - Intergenic
1159937862 18:74382891-74382913 CCTGCACCTCCCCAGGGGAGTGG - Intergenic
1160132334 18:76237239-76237261 CCTTCCCCTCCCCACAGTCATGG + Intergenic
1160293575 18:77617301-77617323 TCTTCCCCTCCCCACAGTAGAGG - Intergenic
1160524245 18:79525765-79525787 CCTCCCTTCCCCCACAGGTGGGG + Intronic
1160828463 19:1091569-1091591 CCTCCCCCAGCTCTCAGGAGGGG - Intronic
1160896976 19:1407678-1407700 CGTCGCCCTCCCCACAGCCGCGG - Exonic
1161122186 19:2534918-2534940 CCTCCCCCTCCCCAATGTGGGGG - Intronic
1161407266 19:4097652-4097674 CCTCCCCCTGCCCTCCAGAGAGG - Intronic
1161601442 19:5186170-5186192 CCTCAGCCTCCCCACAGGGCTGG + Intronic
1161702917 19:5804946-5804968 CCTCCCCGCCCCCGCCGGAGGGG - Intergenic
1161736884 19:5997001-5997023 CCGCCCTCTCCCCACAGGCCCGG + Intronic
1162066529 19:8129148-8129170 CCACCCCCACCCCACAGACGTGG - Exonic
1162491547 19:10995495-10995517 CTTCCCCCTCCTCACTGTAGCGG - Intronic
1162751638 19:12833396-12833418 CATCCCCCTCCCCACGAAAGAGG - Intronic
1162918017 19:13884674-13884696 CCTCCCCCACCCCACAGAACAGG + Intronic
1162995653 19:14333539-14333561 GCTCCCCCTCCCCTAAAGAGCGG - Intergenic
1163111005 19:15161007-15161029 CCCCCGTCTCCCCGCAGGAGCGG - Exonic
1163365453 19:16873520-16873542 CCTCCCCCCCCCCCCAGGCTGGG + Intronic
1163826687 19:19528154-19528176 CCTGCCCCTCCCCACTGGGACGG + Exonic
1164084509 19:21889039-21889061 CCTCGACCTCCTCAGAGGAGAGG + Intergenic
1164312864 19:24061449-24061471 CTGCACCCTCCCCACAGGAAAGG + Intronic
1165253227 19:34557134-34557156 CCTCACCCTCCCCACAGCGGAGG - Intergenic
1165758831 19:38309052-38309074 TCTCCCCATCCCCGCAGGACTGG - Exonic
1166046320 19:40233012-40233034 CCTCCACCCCCGCAGAGGAGAGG + Exonic
1166219043 19:41353678-41353700 CCTCCCCCTCCTCCCCGCAGTGG + Exonic
1166361847 19:42255734-42255756 AGACCCCATCCCCACAGGAGCGG - Intergenic
1167071075 19:47222243-47222265 CCTGCCCCTCCCTACAGGGCTGG + Intronic
1167736089 19:51295345-51295367 CCACCCCCTCCCCACAGGTCAGG + Intergenic
1168281901 19:55310435-55310457 CCTCACCTTCCCCACAGCACAGG + Intronic
1168349675 19:55668864-55668886 CCGCCCCGTCCCCTGAGGAGGGG - Intronic
925125810 2:1455129-1455151 TCTCCACCTCCCGTCAGGAGAGG + Intronic
925208466 2:2026855-2026877 CCTGCCCCTCTCCTCGGGAGTGG + Intronic
926890734 2:17637123-17637145 CCTTCCCCTTCCCACAGGGAAGG + Intronic
926990702 2:18676860-18676882 CCTCACCCTCCCCCAATGAGAGG - Intergenic
927897720 2:26795335-26795357 CCTCCTCCTCCCTCCCGGAGGGG + Intronic
929588597 2:43131225-43131247 CCTCCCCAGCCCCACAGGCTGGG - Intergenic
930715236 2:54587830-54587852 CCTTCCACTCCCCAGCGGAGTGG - Intronic
931017775 2:58005847-58005869 CCTCCCCAGCCCTACTGGAGGGG + Intronic
931614592 2:64143835-64143857 CCTCCCCCTCCGCCCGGGAGCGG - Intronic
932084567 2:68746708-68746730 CCTCCCCATCCCCACAGGGCCGG + Intronic
932772279 2:74507296-74507318 ACTCCCCCTCCGCCCAGCAGAGG + Intronic
933053990 2:77638341-77638363 CCTCCCCCTTCTCCCAAGAGTGG + Intergenic
933624200 2:84580206-84580228 CCTCCACCTCCCCACTTAAGCGG - Intronic
933789963 2:85875931-85875953 TGCTCCCCTCCCCACAGGAGAGG + Intronic
934714854 2:96537518-96537540 CCGCCGCAGCCCCACAGGAGAGG + Intronic
935823550 2:106918253-106918275 CCTCCCCCTCCCCCCAGCAAGGG + Intergenic
935848131 2:107188342-107188364 CCTCCCCCTCCCCAGTACAGTGG + Intergenic
936152961 2:110031717-110031739 CCTCACCCTCCCCACACAGGTGG + Intergenic
936191719 2:110339695-110339717 CCTCACCCTCCCCACACAGGTGG - Intergenic
936500442 2:113062209-113062231 CCTGCCCCACCCCACATGACAGG - Exonic
937015084 2:118597688-118597710 ACTCCCCGACCCCACAGCAGGGG + Intergenic
937086341 2:119174403-119174425 CCTCCCGCTTCCCTGAGGAGGGG - Intergenic
937125403 2:119472253-119472275 TCTTCCCCTCCCCACGGGAAGGG - Intronic
937207556 2:120246265-120246287 CCTCCTCCAGCCCTCAGGAGGGG - Intronic
937910410 2:127073020-127073042 CCACCTCCCCCCCACAGCAGGGG + Intronic
938301104 2:130213639-130213661 CCGCCCCCTCCCCTCCGGCGAGG - Intergenic
938365214 2:130728463-130728485 CCTCCTCCTCCCCAGAGGAAGGG + Intergenic
938501109 2:131831693-131831715 CACCCCCATCCCCACGGGAGGGG - Intergenic
939156756 2:138534764-138534786 TTTCCCCCTCCCCACAGGTCTGG + Intronic
941390032 2:164900770-164900792 GCACCCCCTCCCCACTGCAGAGG + Intronic
941509091 2:166383857-166383879 CCTCCCTCTCTCAACAGGTGGGG - Intergenic
941985937 2:171511856-171511878 ACTCTCCCTCCCAGCAGGAGAGG + Intergenic
942171270 2:173291772-173291794 CCCCCCCCCCGCCTCAGGAGTGG + Intergenic
943915535 2:193627584-193627606 CCTTCCCCACCCCACAGCAGAGG + Intergenic
945143818 2:206715330-206715352 CCTCCCCCTCGCCTCTGGGGAGG - Intronic
945333644 2:208566938-208566960 TCTTCACCTCCCCACAGAAGTGG - Intronic
945714067 2:213336352-213336374 CAGCCCCCTTCCCACAGGAGTGG - Intronic
946131164 2:217608081-217608103 ACTGCTCCTCCCCAGAGGAGAGG + Intronic
946171708 2:217899587-217899609 CCTCTCCCTCAGCACAGGAAGGG + Intronic
947531597 2:230912088-230912110 CTTCCCTCTCCCCACATGTGAGG + Intronic
948132678 2:235612292-235612314 CCGCCTCCACGCCACAGGAGGGG - Intronic
948496513 2:238353405-238353427 CCTCCCCCTCCTCTAAGGATGGG - Intronic
948777420 2:240296921-240296943 GATCCCCCTTCCCAAAGGAGTGG + Intergenic
948894787 2:240923065-240923087 CCTCCCCCGCTCCACAGGCCAGG + Intronic
949055757 2:241927598-241927620 CCTCCCACTCCTCACAGTGGTGG + Intergenic
1169623806 20:7540141-7540163 CCTCCCCCACCCACCAGCAGTGG + Intergenic
1169770917 20:9199319-9199341 CCTCCCCATCCCAACAGTGGTGG + Intronic
1172167787 20:32909477-32909499 CCTCCCCCTTGCCCCAGGCGAGG - Intronic
1173362903 20:42360321-42360343 CCTCCCCTGCCTCACATGAGAGG + Intronic
1173654469 20:44690174-44690196 CCTCCCCTCCCCCACAAGTGGGG - Intergenic
1174852510 20:54008373-54008395 CCTCCCTCTCCCCACTGGGGTGG + Intronic
1175323707 20:58107781-58107803 CCTCTCCCTCCACACAGTGGTGG + Intergenic
1175465088 20:59185455-59185477 CCTCCCCCTACCCCCAGGTTGGG + Intergenic
1175710581 20:61217261-61217283 CTTCCCCCACCCCAAAGCAGTGG - Intergenic
1175798102 20:61785053-61785075 CCTCCTGCTCCCCAAAGGCGGGG + Intronic
1175904864 20:62374776-62374798 TCTCCCCCTCCACACTGGCGAGG - Intergenic
1176070178 20:63222161-63222183 CCTCCCCCCACCCCCAGGAATGG - Intergenic
1176146513 20:63567935-63567957 CCTCCCACTCCCCACTGGGCAGG + Intronic
1176548679 21:8212475-8212497 CCGCCCCCCCCCAAGAGGAGAGG - Intergenic
1176549274 21:8214455-8214477 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1176556573 21:8256683-8256705 CCCCCCCCGCCCAAGAGGAGAGG - Intergenic
1176557167 21:8258678-8258700 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1176567610 21:8395510-8395532 CCGCCCCCCCCCAAGAGGAGAGG - Intergenic
1176568206 21:8397493-8397515 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1176575512 21:8439725-8439747 CCCCCCCCGCCCAAGAGGAGAGG - Intergenic
1176576109 21:8441713-8441735 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1179583863 21:42362493-42362515 CCTCCCCCTCACCCCTGTAGAGG - Exonic
1179711176 21:43264070-43264092 CCTCCCCTTCCCCTGGGGAGGGG + Intergenic
1179711178 21:43264074-43264096 CCTTCCCCTCCCCAGGGGAAGGG - Intergenic
1179805651 21:43835459-43835481 CATCCCCCTGAACACAGGAGGGG + Intergenic
1179950856 21:44708178-44708200 CCTCCCCCAGCCCCCAGCAGGGG + Intronic
1180041919 21:45284473-45284495 CCTTCCCCACCTCACAGGCGAGG + Intronic
1180155952 21:45977536-45977558 CCTCCCCCCACACACAGGCGGGG + Intergenic
1180875612 22:19173900-19173922 CCTGTCCCTCTCCACAGGAAGGG - Intergenic
1181000947 22:19987427-19987449 CCTCCCCCTCCCTGCGGCAGGGG + Intronic
1181513370 22:23398699-23398721 CCTCCCCTACCCCACAGGGTAGG - Intergenic
1181628046 22:24134620-24134642 CATGCATCTCCCCACAGGAGGGG - Intronic
1181786838 22:25233412-25233434 TATCCCCTTCCCCACAGGTGGGG + Intergenic
1181818873 22:25460259-25460281 TATCCCCTTCCCCACAGGTGGGG + Intergenic
1182418820 22:30238709-30238731 CCTCCCCCACCGCCCAGGAGTGG - Intergenic
1182522352 22:30891643-30891665 CCTCCCCCTTCCCCCAGGTCTGG - Intronic
1183408146 22:37640331-37640353 CCTCCCCCTCCCCCCAGCCCAGG + Intronic
1183606054 22:38867196-38867218 CCTCCCTCTGCCCGCAGGCGCGG - Exonic
1183606370 22:38868776-38868798 CCTCCCACTCCCCACAGCATTGG + Intronic
1184073215 22:42159819-42159841 ACTCCACCTGCCCAGAGGAGTGG + Intergenic
1184102284 22:42347213-42347235 TCTCCGTCTCCCCACAGCAGGGG + Intergenic
1184279024 22:43426663-43426685 GCTCCCTCTCCCCACAACAGAGG - Intronic
1184344199 22:43903082-43903104 CCTCCTCCTCCCCACAGCCGTGG + Intergenic
1184405426 22:44298090-44298112 CATGCCCATCCCCACAGAAGAGG - Intronic
1184807610 22:46805619-46805641 GCTCCCCCTACCACCAGGAGTGG - Intronic
1184828616 22:46970068-46970090 CCTCGCCCTCCCCACAGCCCAGG + Intronic
1185330203 22:50248983-50249005 CTTCCCCAGCCACACAGGAGTGG + Intronic
1203253562 22_KI270733v1_random:128780-128802 CCCCCCCCGCCCAAGAGGAGAGG - Intergenic
1203254159 22_KI270733v1_random:130771-130793 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1203261617 22_KI270733v1_random:173858-173880 CCCCCCCCGCCCAAGAGGAGAGG - Intergenic
1203262215 22_KI270733v1_random:175850-175872 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
950041130 3:9920158-9920180 CACACCCCTCCCCACAGAAGTGG - Intronic
951900986 3:27657332-27657354 TCTCCTCCTCCTCTCAGGAGGGG - Intergenic
952192992 3:31043289-31043311 TCTCCTCCTCCCCACACCAGGGG + Intergenic
952527150 3:34222611-34222633 CAGCTCCCTCACCACAGGAGCGG - Intergenic
952966376 3:38623548-38623570 CCTACCCAGCCCCAGAGGAGTGG + Intronic
953413319 3:42702118-42702140 ACTGCCCCTGCCCACAGCAGAGG + Intronic
953660601 3:44888842-44888864 CCTCCCTCTTGCCACAAGAGGGG + Intronic
954300764 3:49699651-49699673 CCTCCCCCTCCACACAGGAGGGG + Exonic
954401302 3:50321226-50321248 CCGCCCCCGCCCCACACGTGGGG + Exonic
955067328 3:55544484-55544506 CCTCCCCCACCCCATATCAGTGG + Intronic
955582296 3:60437060-60437082 CTTCCCCCTGTTCACAGGAGAGG + Intronic
956072327 3:65466663-65466685 CCTCTTCCTCCCCACTGGTGTGG - Intronic
956141723 3:66153064-66153086 CTTCTCACTCCCCAGAGGAGGGG + Intronic
956826016 3:72997203-72997225 CCTCCACCTCCCCAGGGGCGGGG + Intronic
957070148 3:75561434-75561456 CCCCCTCCTCCCCACAGGAGGGG + Intergenic
957426841 3:80051028-80051050 CCGCCTCCTCCCCACAGTGGTGG - Intergenic
959063506 3:101636013-101636035 CCTCACCCTCCCCGCAGCGGAGG + Intergenic
959775148 3:110150577-110150599 CCTCCCCCTCCCCCCTTGATAGG + Intergenic
960076817 3:113495565-113495587 CTTCCCCAGCCCCACAGGGGTGG + Intronic
960523361 3:118681256-118681278 CCTTCCCCTTCCCCCACGAGTGG + Intergenic
960597664 3:119421416-119421438 CCTCCCCCTCCCCACCTTTGTGG - Intergenic
960808460 3:121606525-121606547 GCTTTCCCTCCCCACATGAGAGG - Intronic
961013092 3:123448700-123448722 CCTCCTCCTCCGCTCAGGACGGG - Exonic
961283963 3:125785297-125785319 CCCCCTCCTCCCCACAGGAGGGG - Intergenic
961509265 3:127391116-127391138 CCTCCTCCTCCCCACTGGCCAGG - Intergenic
961810557 3:129519328-129519350 GCTCCCACACCCCACAGGAAGGG - Intronic
962745754 3:138396380-138396402 GCTCCCCTGCCTCACAGGAGAGG + Intronic
965520193 3:169662940-169662962 CCTCCCCTTCCCCCCAGGCGGGG - Intronic
966064157 3:175796162-175796184 CCTTCCCCTCCCCACAGTTTTGG - Intronic
966919112 3:184601072-184601094 ATTCCCCCTCCCCAGAGGTGGGG - Intronic
967135565 3:186510045-186510067 CCTGCTCCTCCCAACAGGTGTGG - Intergenic
967885280 3:194329551-194329573 CCTCCTCCTGCCCTCAAGAGGGG - Intergenic
968035512 3:195544410-195544432 CCTCTCACCCCCCACAGCAGTGG - Intergenic
968085732 3:195873126-195873148 CCTCCCCGTCTCCTCAGGAGGGG + Intronic
968462440 4:732240-732262 GCTCCCCCTCCCCTCCCGAGTGG + Intronic
968925744 4:3547134-3547156 CCTTCCCCTTCCCACACGGGAGG - Intergenic
968983115 4:3861320-3861342 CCTCCACCCCCACACAGCAGAGG - Intergenic
969013739 4:4088891-4088913 CCCCCTCCTCCCCACAGGAGGGG + Intergenic
969101750 4:4774757-4774779 CCTCGCCCACCCCATAGGTGTGG + Intergenic
969799407 4:9551038-9551060 CCCCCTCCTCCCCACAGGAGGGG - Intergenic
970235142 4:13951121-13951143 CCACCCCCACCCCAAAGCAGAGG + Intergenic
971095784 4:23400203-23400225 CCTCCCCCGCCCTCCAGCAGTGG - Intergenic
972029953 4:34442419-34442441 CTTTTCCCTCCCCACTGGAGAGG + Intergenic
972450257 4:39190558-39190580 TCTCTTCCTCCCCACATGAGGGG - Intronic
972468914 4:39384940-39384962 CCTCCCCCACCCCCCAGCAGCGG - Intergenic
975274008 4:72473808-72473830 CTTTCCCCTCCCCACTGGGGTGG + Intronic
975340577 4:73235204-73235226 CTTCCCAGTCACCACAGGAGTGG + Intronic
975623320 4:76315901-76315923 CCTCCCCCTCCCCCAAGGGATGG - Intronic
975945605 4:79702396-79702418 CCTCCCTCTCCCCGCTAGAGTGG - Intergenic
976691918 4:87877309-87877331 CCTCCCCTGCCCTACAGGGGTGG + Intergenic
977399047 4:96509197-96509219 CCTCCCCCACCCCTTAGTAGTGG + Intergenic
977524382 4:98126200-98126222 CAGCCCCCTTCCTACAGGAGTGG + Intronic
979195500 4:117916133-117916155 ACTCCCCCTTCCCCTAGGAGTGG + Intergenic
979846794 4:125523311-125523333 CCACCCCCTCCCCTCACGAGGGG + Intergenic
980075623 4:128289990-128290012 CCTCCCACCCCCCAGAGGTGTGG + Intergenic
983532071 4:168821191-168821213 CATCCTCCTCCCCAAAGTAGTGG + Intronic
983657839 4:170100970-170100992 CCTCCCCTTTCCCTCAGCAGTGG + Intergenic
983891929 4:173038425-173038447 CTTCCTCCACCCCAGAGGAGAGG + Intronic
984847091 4:184117030-184117052 CTTTTCCCACCCCACAGGAGCGG - Exonic
985762789 5:1759699-1759721 ACTCCCCAGCCCCACAGTAGAGG - Intergenic
985847743 5:2364798-2364820 CCACCCCCTGCCCAATGGAGAGG - Intergenic
987301377 5:16600588-16600610 CTGCCCCGCCCCCACAGGAGAGG + Intronic
987323558 5:16792563-16792585 CCAGTCCCTCCCCACAGGAGCGG + Intronic
988275795 5:29079925-29079947 CCTCCACCTTCCACCAGGAGGGG - Intergenic
990513884 5:56514572-56514594 CCTTCCCCTTCCCCCATGAGTGG + Intronic
991410615 5:66341861-66341883 ACTGCCCTTCCCAACAGGAGTGG - Intergenic
992531923 5:77660176-77660198 CCTGCCCCATCCCACAGCAGTGG - Intergenic
993365579 5:87030471-87030493 CAGCCCCCTTTCCACAGGAGTGG + Intergenic
993745894 5:91596584-91596606 ACTCCCCATTCCCTCAGGAGTGG + Intergenic
996379130 5:122845810-122845832 CCTCCCCCGGCCCAGAGGAAGGG + Intronic
997459320 5:134041578-134041600 CTTTCCCATCCCCACTGGAGTGG - Intergenic
998251847 5:140558677-140558699 CCTCCCCCTGCTCAAAGGAGGGG - Exonic
998374181 5:141680498-141680520 CCTGCCCCTCCCCCCAGCAATGG - Exonic
998408086 5:141885861-141885883 CCTCCCCATACCCAGAGGAAAGG + Intergenic
999185027 5:149700859-149700881 CCTCCCTGTCCCCACTGGTGTGG + Intergenic
999849616 5:155523960-155523982 CCTCCCCTTTCCCCCAGCAGTGG - Intergenic
1000035537 5:157444847-157444869 CATCTCCCTCCCCAGAAGAGGGG + Intronic
1000933426 5:167280346-167280368 CCTCCCCTTCTCCACTGGAGTGG - Intergenic
1001152461 5:169244247-169244269 CCTTCCTCTCCCCGCAAGAGTGG + Intronic
1001845237 5:174916384-174916406 CCTCCCCCATCCCCCAGCAGGGG + Intergenic
1002066540 5:176654741-176654763 CCTCCCCACCCCCACAGGCCTGG - Intronic
1002202317 5:177536740-177536762 CCTCCCTCTGCCCACAGGTGAGG - Exonic
1002279630 5:178122802-178122824 CCTCCCTCCCTCCATAGGAGTGG + Exonic
1002596145 5:180324890-180324912 CCTCTTTCTCCCTACAGGAGAGG - Exonic
1002665068 5:180817074-180817096 CCTCCCCTTCCACACACAAGTGG - Intergenic
1003309937 6:4961729-4961751 CCTGCCAGTGCCCACAGGAGCGG + Intergenic
1004587400 6:17015880-17015902 CCTGCCCCTCGCCACAGTATAGG - Intergenic
1005455539 6:26016586-26016608 CCACGCCCTCTCCACAGGAGTGG - Intergenic
1005831240 6:29672751-29672773 CCTCTTTCTCCCCAAAGGAGAGG + Exonic
1006113294 6:31761733-31761755 TTTCTCCCTCCCCACAGGATTGG + Intronic
1006336901 6:33425711-33425733 CCTCCGCCTCCTCCCAGGAAGGG - Intronic
1006907059 6:37539619-37539641 CCTCCTCCTCCTCACAGGCCCGG - Intergenic
1007257707 6:40540456-40540478 CCTCCCCACCACCACAGGGGCGG + Intronic
1007361278 6:41358187-41358209 CCTCACCATCCCCACTGGGGTGG + Intergenic
1007396951 6:41583382-41583404 CCTCCCCTACCCCACAGGTGAGG + Intronic
1007558048 6:42782962-42782984 CCTCCCCCTCCCCAGACGCGGGG - Intronic
1007764549 6:44152853-44152875 CCCCCTCCTCCCCACAGGCCAGG - Intronic
1009884242 6:69605221-69605243 CCTGCCAGTCACCACAGGAGGGG + Intergenic
1010022206 6:71173713-71173735 CCTCCCTTTCCCTACTGGAGTGG - Intergenic
1010079990 6:71849816-71849838 CCTTCTCCTACCCCCAGGAGGGG + Intergenic
1011013413 6:82727294-82727316 TCTCCCCCTCCCCCCAGCAGTGG - Intergenic
1011685328 6:89819357-89819379 CCTGCGCCAGCCCACAGGAGGGG + Intronic
1012910270 6:105110059-105110081 CCTGCTCCTCGCCCCAGGAGGGG - Intronic
1013240599 6:108241705-108241727 CCTGCCCCTCCCCAAAGGGGAGG - Intronic
1014148056 6:118021144-118021166 CCTTCCCCTCCCCTGAGGCGAGG - Intronic
1014913603 6:127119947-127119969 CCTCCGGCTCCCCACAGCTGGGG - Intronic
1015531493 6:134225683-134225705 ACTCCCCTTCCCCACAGAAATGG - Intronic
1016038998 6:139412480-139412502 CCTGCCCCTCACCCCAGGACAGG - Intergenic
1017082883 6:150685433-150685455 CCTCTCCTTCCTCACTGGAGTGG - Intronic
1017205451 6:151800264-151800286 CCTCTCCCTCCTCTCAGGTGTGG - Intronic
1017720479 6:157240235-157240257 CCTCCTCCTCCTCTCTGGAGAGG - Intergenic
1017875032 6:158517151-158517173 CCTCCCTGCCCCCAGAGGAGAGG + Intergenic
1018919969 6:168165593-168165615 CCCAGCCCTCCTCACAGGAGCGG - Intergenic
1019351002 7:553944-553966 TCTCCCCCTGCCCACAGTGGCGG - Intronic
1019634897 7:2070284-2070306 ACTCCACCTCCTCACGGGAGGGG + Intronic
1022059182 7:26773921-26773943 CCTGCCTCTCCCCACAGCACTGG - Intronic
1022178488 7:27895288-27895310 ACTCCCCCACGCCACAGCAGTGG - Exonic
1023895926 7:44432844-44432866 CCTCACTGTCCCCTCAGGAGAGG + Intronic
1024054565 7:45651688-45651710 CCTTCCCATCTCCAAAGGAGCGG + Intronic
1025270985 7:57516230-57516252 CTTTTCCCTCCCCACTGGAGAGG - Intergenic
1025996691 7:66531699-66531721 CCTCTCCTTCCCCAGAGCAGGGG + Intergenic
1026475041 7:70727955-70727977 CCTCCCTATTCCCAGAGGAGGGG - Intronic
1026865613 7:73822394-73822416 CCTCCTGCTCCCCAGGGGAGGGG + Intronic
1026933753 7:74239867-74239889 CCTCCCCTTCCCCATGGAAGGGG + Intronic
1026988746 7:74571102-74571124 CCTCTCCTTCCCCAGAGCAGGGG + Intronic
1027184585 7:75963308-75963330 CCTCGCCGTTCCCACAGCAGCGG - Intronic
1027427951 7:78081071-78081093 TCTCCTCCTCCCCACAGGCCTGG + Intronic
1029072390 7:97910516-97910538 CCCCCTCCTCCCCACAGGAGGGG + Intergenic
1030039307 7:105435403-105435425 CCACCCCATGCCCAAAGGAGAGG + Intergenic
1031760836 7:125711249-125711271 CCTCCCCCCCACCACACGACAGG - Intergenic
1031775587 7:125905108-125905130 CCTCCCCTATCCCACAGCAGTGG - Intergenic
1032072651 7:128818330-128818352 CCTCTCTCTCCCAACAGAAGAGG - Intronic
1032193801 7:129778860-129778882 CCTCCCCACCCCCACAGGCAAGG - Intergenic
1032200827 7:129821596-129821618 ACTCCCCCTCCCCGCAGTGGTGG - Intergenic
1032390841 7:131554679-131554701 CCTCCCACTCCTCAAAGGAAGGG + Intronic
1032466460 7:132148686-132148708 CCTCAGCTTCCCCACAAGAGGGG - Intronic
1032723091 7:134566730-134566752 CCTCCAGCTCGGCACAGGAGAGG - Intronic
1034338476 7:150338211-150338233 GCTCACCCTGCCCACAGGAAGGG + Intergenic
1034701007 7:153095833-153095855 CCTCCCACTGCCCACATCAGAGG + Intergenic
1034970982 7:155418955-155418977 CCTCCACCTCCTCACAGAGGAGG - Intergenic
1035243035 7:157544533-157544555 CCGCCCCCTCCTCACTGGACGGG - Intronic
1036245269 8:7110781-7110803 CCCCCTTCTCCCCACAGCAGGGG - Intergenic
1036362008 8:8084486-8084508 CCCCCTCCTCCCAACAGGAGGGG - Intergenic
1036629281 8:10499264-10499286 CCTCTCCCCCTCCCCAGGAGTGG + Intergenic
1036633219 8:10529846-10529868 CCTCCACGTCCCCACAGGCTGGG - Intronic
1036888963 8:12582545-12582567 CCCCTTCCTCCCCACAGGAGGGG + Intergenic
1036896541 8:12640691-12640713 TCCCCTCCTCCCCACAGGAGGGG + Intergenic
1037838671 8:22229281-22229303 CCTCCACCCCCACACATGAGGGG - Intronic
1038205272 8:25459084-25459106 CCTCTCCCTCGGCACTGGAGTGG - Exonic
1038917280 8:32037964-32037986 CAGCCCCCTTCCCACAGGAGTGG + Intronic
1039294240 8:36132006-36132028 CCTTCTCCTCCCCACTGAAGTGG - Intergenic
1039824528 8:41161747-41161769 CCTCCCTCTCCCCACAGCAAGGG + Intergenic
1040908873 8:52497950-52497972 CCTCCCCCACCCCCCAGGTGGGG - Intergenic
1041781990 8:61586775-61586797 CCTACCTCTCCCTACAGGGGAGG + Intronic
1044490280 8:92805388-92805410 CCTCACCCTACCCACAGGTCTGG - Intergenic
1044664880 8:94624659-94624681 CCTCAGCCTCCCCACAGCTGGGG - Intergenic
1045459128 8:102411896-102411918 CTTCCCCCTCCCGCAAGGAGCGG - Intronic
1045459385 8:102412727-102412749 CCTCCCCCGCCGCTCCGGAGCGG - Exonic
1048025596 8:130583932-130583954 CCTTCGCCTTCCCACATGAGTGG - Intergenic
1048485937 8:134847696-134847718 CCTCCCCCTACCCAAAGTTGGGG - Intergenic
1048559813 8:135522097-135522119 CCTCCCCCTGCCCCCATGACAGG + Intronic
1049305489 8:141900601-141900623 CCTCCCCCTCCCCTCATATGAGG - Intergenic
1049396338 8:142402928-142402950 CCCTCCCCTCCCCACCGGCGCGG + Intronic
1049555668 8:143280348-143280370 CCTCCCCCACCCCACATCATTGG - Intergenic
1049561830 8:143315932-143315954 CCTCCCCCTCCCCAGAGCCTCGG - Intronic
1049816835 8:144607565-144607587 CCCACCCCGCCCCCCAGGAGAGG + Intergenic
1050325324 9:4491916-4491938 CCGCCCCCTCCCCTCAGGGTGGG + Intronic
1051199177 9:14597921-14597943 CCTCCCCCTCCACACAACTGAGG + Intergenic
1051478069 9:17530660-17530682 CCTCACCAGCCCCACAGGACTGG + Intergenic
1051594568 9:18811353-18811375 CCTTTCCCTCCCCACTGGGGTGG + Intronic
1052367424 9:27628488-27628510 CCATCCCCTCCACCCAGGAGTGG - Intergenic
1052476722 9:28970519-28970541 CCTCCCCCACCCCCCAGCAGTGG + Intergenic
1052864780 9:33458304-33458326 ACTCCCCTGCCCCACTGGAGAGG + Intergenic
1053014721 9:34655285-34655307 CCTCCCCCTGCCCCCAGGCCTGG + Exonic
1055318411 9:75057234-75057256 TCTCCCCCTTCCCACTGCAGAGG - Intergenic
1055524127 9:77113000-77113022 TCTCCCCTTCCCCACAGCAAGGG - Intergenic
1056106605 9:83353268-83353290 CCTCCCCCACCCCACTGCAGTGG - Intronic
1056774164 9:89498928-89498950 CTTCCCTCTGCCCCCAGGAGAGG + Intergenic
1057023860 9:91721373-91721395 CCTCCCTCTACCCAGAGGAAGGG + Intronic
1057227613 9:93300792-93300814 CCAGCCCCTCCCCACTGGAAGGG + Intronic
1057569543 9:96193995-96194017 CTCTCCCCTCCCCACTGGAGTGG + Intergenic
1057694453 9:97313421-97313443 CCTCCCCCTCTCCAGCAGAGAGG + Intronic
1057802093 9:98196931-98196953 CCCACCCCTCTCCACAGGAGGGG + Intergenic
1057915685 9:99053468-99053490 CCTCCCCCTCCTTCCAGGGGAGG - Intronic
1058461894 9:105190652-105190674 CCTCCCCCTGCCCAGGGAAGTGG - Intergenic
1059245803 9:112848733-112848755 CCTGCCCTGGCCCACAGGAGAGG - Intronic
1059402760 9:114080963-114080985 CCTCTCCCCACCCCCAGGAGAGG - Intergenic
1059485964 9:114626996-114627018 CCTCCCCCTTACCACAGCAAAGG - Exonic
1059667965 9:116467022-116467044 CCTGCCTCTCACCAGAGGAGTGG + Intronic
1060040487 9:120296108-120296130 CCTCCCCCAACCCAAAGGACTGG + Intergenic
1060838694 9:126777691-126777713 CCTCCCCCAGCTCCCAGGAGGGG - Intergenic
1060917066 9:127397778-127397800 CCTACCCCTCCCCTCGGGACGGG + Intronic
1060977957 9:127776518-127776540 CCTCCCCCTGCCCCCAGCTGTGG + Intronic
1061078331 9:128355214-128355236 CCTCCCCCAACCCTCAGGAAGGG - Intronic
1061095111 9:128452088-128452110 TCACCCCCTCCCTGCAGGAGAGG - Intergenic
1061283553 9:129610298-129610320 CCGCCCCCCCCCCACCGGCGTGG + Intronic
1061374543 9:130216113-130216135 CGTCCCCCTCCCCAATGAAGAGG - Intronic
1061548164 9:131316666-131316688 CCTTCCCCTTCCCCCAGGTGAGG + Intergenic
1062084688 9:134642492-134642514 CCGCCCCCTCCCCAGACGGGCGG + Intronic
1062101369 9:134730373-134730395 CCTCCCCCTCGCCATAGGTGAGG - Exonic
1062122188 9:134839720-134839742 CCTCACCCTCCCCACCGGCGAGG - Intronic
1062170943 9:135134306-135134328 CCACCCCCTCCCCCGGGGAGTGG + Intergenic
1062498556 9:136842823-136842845 CACCCCCATCCCCACGGGAGGGG + Intronic
1062609380 9:137367157-137367179 CCTCCTCTGCCCCACAGGTGAGG + Intronic
1062710762 9:137974024-137974046 CCTCGGGCTCCCCACACGAGGGG - Intronic
1203469963 Un_GL000220v1:111927-111949 CCCCCCCCGCCCAAGAGGAGAGG - Intergenic
1203470560 Un_GL000220v1:113915-113937 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1203477784 Un_GL000220v1:155899-155921 CCCCCCCCGCCCAAGAGGAGAGG - Intergenic
1203478381 Un_GL000220v1:157887-157909 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1185463164 X:341538-341560 CCTCCACCTCCTCCCCGGAGAGG - Intronic
1185596688 X:1311335-1311357 CCTTCCTCTCCCACCAGGAGTGG + Intergenic
1185728143 X:2439486-2439508 CATCCCCCACCCCACATCAGTGG - Intronic
1186219684 X:7336244-7336266 CCCCACCCGCCCCAAAGGAGGGG + Intronic
1188744895 X:33829807-33829829 CAGCCCCCTTCCCACTGGAGTGG + Intergenic
1188870506 X:35365340-35365362 CCTCCCACTTCCCTTAGGAGTGG - Intergenic
1188913935 X:35887250-35887272 CCTGCCCCTCCACACTTGAGAGG - Intergenic
1189208357 X:39261641-39261663 CCTCCTCCTCCCCAGAGCAGAGG - Intergenic
1189442257 X:41048138-41048160 CCTCCCCCTCCTCTCTGGGGTGG - Intergenic
1189653863 X:43220548-43220570 CCTCCACCTCCCCAAAGCACTGG + Intergenic
1190369330 X:49726586-49726608 CCACACCCTCCCCACAGTGGTGG - Intergenic
1192216934 X:69165465-69165487 CCTCCCCCGCCAGACAGCAGCGG + Exonic
1193152482 X:78139681-78139703 CCTCCCGCTCCCCGCAGGGGTGG - Exonic
1193467948 X:81869522-81869544 CCACACTCTCCCCACAGCAGTGG + Intergenic
1194236599 X:91391904-91391926 CCTTCCCCTCCCCACAGATTAGG - Intergenic
1194516037 X:94855096-94855118 TCTCACCCACCCCACAGCAGAGG - Intergenic
1194937756 X:99971184-99971206 CTCCCCCATCCCCACAGCAGTGG - Intergenic
1195113432 X:101670086-101670108 CCACCCCCACCCCACAGCAGAGG - Intergenic
1195310657 X:103629209-103629231 CCTCCCCCGTCCCCCGGGAGGGG + Intronic
1196347327 X:114679123-114679145 CAGGCCCCTGCCCACAGGAGGGG - Intronic
1196668200 X:118338407-118338429 CCTCCCCCTCACCCCACGACAGG + Intergenic
1196734792 X:118974251-118974273 CCCCCCACTCCTCCCAGGAGAGG - Intergenic
1197953020 X:131918341-131918363 CCTCCCCCACTCCCCAGAAGTGG + Intergenic
1199139013 X:144288013-144288035 CCTCCCCCATCCCCCAGAAGAGG - Intergenic
1199413112 X:147548385-147548407 CCTCCCCCTCCCCCCACCGGGGG - Intergenic
1199550161 X:149052174-149052196 CCTCCCCCCACCCTCAGGACAGG - Intergenic
1199850302 X:151721344-151721366 CCTGCCCAACCCCACATGAGTGG - Intronic
1200375418 X:155774799-155774821 CCTCCCCCTCTCCAAAGATGAGG - Exonic
1200408321 Y:2837455-2837477 CCTCACCCTCTCCAAAGGAGAGG - Intergenic
1201416558 Y:13753237-13753259 CCTCCCCTCCCCGGCAGGAGAGG - Intergenic