ID: 1147342934

View in Genome Browser
Species Human (GRCh38)
Location 17:39765863-39765885
Sequence CCTTTCGAGTGTAACATGTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147342934_1147342938 -7 Left 1147342934 17:39765863-39765885 CCACACATGTTACACTCGAAAGG 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1147342938 17:39765879-39765901 CGAAAGGGTCACGGAAGCCGTGG 0: 1
1: 0
2: 1
3: 2
4: 44
1147342934_1147342942 29 Left 1147342934 17:39765863-39765885 CCACACATGTTACACTCGAAAGG 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1147342942 17:39765915-39765937 TCGTGAACATCACATAGTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147342934 Original CRISPR CCTTTCGAGTGTAACATGTG TGG (reversed) Exonic
900286455 1:1903119-1903141 ATTTTCGAGTGTACAATGTGTGG + Intergenic
913272084 1:117104250-117104272 CCTTTCATCTGTAAAATGTGTGG + Exonic
917759438 1:178140768-178140790 CTTTTCAAGTAAAACATGTGAGG - Intronic
1062936020 10:1390403-1390425 TCATTGGACTGTAACATGTGCGG + Intronic
1064825694 10:19396776-19396798 CCTCTCCTCTGTAACATGTGTGG - Intronic
1065459278 10:25939421-25939443 CCTTTCTAATGTAAAATTTGAGG + Intronic
1066545061 10:36490646-36490668 CGTTTTGAGTGTGACCTGTGAGG + Intergenic
1066768599 10:38825223-38825245 CCTTTCGAGTCCATCATGTTTGG - Intergenic
1067136857 10:43616848-43616870 CCTTTTAAATGTAACAAGTGTGG + Exonic
1075446958 10:122519727-122519749 CCTTCCGAGGTCAACATGTGAGG - Intergenic
1075502865 10:122993847-122993869 CCTTTTCAGTGTAATATATGTGG - Exonic
1086982270 11:93211333-93211355 CCTGTCCATTGTAAAATGTGGGG - Intergenic
1089835941 11:121370725-121370747 CCTTTTGGGTGTAACTTGTTAGG + Intergenic
1097023236 12:56035242-56035264 CCTTTTGAGTGCAACATCTGTGG + Exonic
1099209828 12:79770827-79770849 CTTTTCCAGTGAAAAATGTGTGG - Intergenic
1099349848 12:81552491-81552513 CATTTCAATTGTAACATGTTTGG - Intronic
1102657077 12:114491072-114491094 CTGTTCGTGTGGAACATGTGTGG + Intergenic
1103295735 12:119885251-119885273 CTTTTCGAGAGTAAAATTTGTGG + Intergenic
1108319297 13:49272350-49272372 CCTTTAGAGTTTAACATGAGTGG - Intronic
1111904508 13:94239870-94239892 CCTTTCAAGTGTCATTTGTGGGG + Intronic
1117364801 14:55015569-55015591 CCTTTCGGGGACAACATGTGAGG + Intronic
1119138561 14:72243912-72243934 CCTTTGGAGAGTAACATTTCTGG - Intronic
1121991464 14:98561847-98561869 CCTTTGGAATCTGACATGTGGGG - Intergenic
1137786379 16:51140774-51140796 CCATTCAAGTGCAACATCTGCGG - Exonic
1139681104 16:68563964-68563986 CCTTTTGAATGTAGCATATGTGG + Exonic
1140794553 16:78424947-78424969 CCTTTCAAGTGAATCATCTGGGG + Exonic
1141383077 16:83593279-83593301 CCTTTCTAGTCTAACATTTAAGG - Intronic
1144594196 17:16553021-16553043 CCTTACAAGTGTAATGTGTGTGG - Exonic
1147342934 17:39765863-39765885 CCTTTCGAGTGTAACATGTGTGG - Exonic
1149439802 17:56664638-56664660 CCTTTAGAGTGGAAAAGGTGAGG + Intergenic
1151904897 17:77041285-77041307 CCTTCCTTGTGTATCATGTGGGG - Intergenic
1157080698 18:44521872-44521894 CCTTTGGGTTGTAACATGTTTGG + Intergenic
1160454920 18:78993330-78993352 CCCTTCAAGTGCAACATCTGCGG + Exonic
1162243769 19:9381514-9381536 CCTTATGAGTGTAACCAGTGTGG + Exonic
1164045557 19:21536567-21536589 CCTTTCCAGTGTAAAAAATGTGG + Exonic
1165506720 19:36236567-36236589 CCTTTTGAATGTAACGAGTGTGG + Exonic
1167835581 19:52065990-52066012 CCTTTCCAGTGTAACGAATGCGG - Exonic
1167900027 19:52613849-52613871 CCTTACGAATGTAACAAATGTGG - Exonic
1167968187 19:53165855-53165877 CCTTACCAGTGTAATAAGTGTGG - Exonic
1168006320 19:53491292-53491314 CCTTTCAAGTGTAATGAGTGTGG + Exonic
1168344793 19:55644911-55644933 CCCTTCGAGTGTGACATCTGTGG + Exonic
1168541276 19:57212457-57212479 CCTTTCGAGTGCAAAGAGTGTGG + Exonic
1168546423 19:57254179-57254201 CCTTTCGAGTGCAAAGAGTGTGG + Exonic
925786531 2:7436557-7436579 CCTTTCCACTGTAAAATGAGAGG - Intergenic
928625081 2:33131341-33131363 CCTTCAGCGTGTCACATGTGAGG + Intronic
931747307 2:65301395-65301417 CCTTTCGAGTCTACCCTCTGGGG - Intergenic
933944913 2:87277916-87277938 CATTTAGAGTGAAACATATGGGG - Intergenic
934541839 2:95181762-95181784 CCTTATGAGTGTAACGAGTGCGG + Exonic
935706361 2:105860843-105860865 CCTTGCGACTGCAACTTGTGGGG + Intronic
936335295 2:111583674-111583696 CATTTAGAGTGAAACATATGGGG + Intergenic
939821122 2:146958201-146958223 CCTTTAGTGGGTAAAATGTGTGG + Intergenic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
1169903219 20:10573873-10573895 CCTTTCAAGCTTTACATGTGTGG - Intronic
1171510098 20:25675303-25675325 CCCTTCGTGTGTAATGTGTGTGG - Exonic
1172178032 20:32984454-32984476 CCTATCTAGTGTAAAAAGTGGGG + Intronic
1174609689 20:51788892-51788914 CCTTTTGTGTGCAACATTTGTGG - Exonic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1174803204 20:53582342-53582364 ACTTACGGGTGTAACATGTGCGG - Exonic
1177713692 21:24812272-24812294 CCTTTGGATGGTAACATATGTGG + Intergenic
1179977808 21:44879943-44879965 CCTTTTGTGTGTAACTGGTGAGG - Intergenic
953172141 3:40516765-40516787 CCTTATGAGTGTAAAGTGTGTGG + Exonic
959738931 3:109693743-109693765 GCTTTCCAGTGTCAGATGTGTGG + Intergenic
961972789 3:130988332-130988354 CCTTTTCAGTGTCACATTTGTGG - Intronic
962187851 3:133279083-133279105 ACTATCGAGTGTATCTTGTGAGG + Intronic
963046901 3:141109366-141109388 CCTTTCCACTGTAAGATGAGGGG - Intronic
969041988 4:4306146-4306168 CCTTTTGAATGTAACATTTGTGG + Exonic
978599948 4:110417353-110417375 CCTTACAAGTGTAATAAGTGTGG + Intronic
990472578 5:56129922-56129944 CCATTCTAGTCTAACATGTCTGG - Intronic
991136605 5:63189586-63189608 CCTCTAGGGAGTAACATGTGAGG + Intergenic
991864154 5:71042180-71042202 CCTGTTGAGTGTAAAATCTGTGG - Exonic
993848751 5:92979074-92979096 CCTTTCTATTGTAAAAGGTGTGG - Intergenic
1002393206 5:178932286-178932308 CCTTTTGAATGTAACGAGTGTGG + Exonic
1008485425 6:52030081-52030103 CCTTTAGCCTGTAACATTTGAGG + Intronic
1019478597 7:1255778-1255800 CCCTTCGAGTCAAACATGAGCGG - Intergenic
1024531917 7:50400532-50400554 CCTTTTGAGTGCAACATGTGCGG + Exonic
1029288928 7:99486892-99486914 CCTTTTGAGTGTAAGGTCTGTGG + Exonic
1030392913 7:108949255-108949277 CCTTTCAAGTGTAATATTAGTGG - Intergenic
1034362809 7:150515441-150515463 CCCTAACAGTGTAACATGTGGGG + Intronic
1040452671 8:47563582-47563604 CCTATCGACTGTCACATGCGAGG + Intronic
1040722465 8:50342827-50342849 CCTTTCCACTTTAACATGTTAGG - Intronic
1045518623 8:102883555-102883577 CTTTTCTACTGTACCATGTGGGG - Intronic
1055497946 9:76874270-76874292 GTTTTCCAGTGTAACAGGTGAGG - Intronic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1203485950 Un_GL000224v1:54917-54939 CCTTTCGAATGTAATCAGTGTGG + Intergenic
1190362970 X:49666571-49666593 CCTTTTAAGTGTAAGATCTGTGG - Intergenic
1192430400 X:71107747-71107769 GCTTTAGGGTGTAACATGGGGGG + Exonic
1193458761 X:81764318-81764340 CCTTTAGAGTTTTACAAGTGAGG - Intergenic
1194946843 X:100079025-100079047 CCTTTCAAATGTAAAATCTGTGG + Intergenic
1201988812 Y:20001659-20001681 CCTTTCAAATGTAATAAGTGTGG - Intergenic