ID: 1147345782

View in Genome Browser
Species Human (GRCh38)
Location 17:39793657-39793679
Sequence GACCATTAGGTCCCAAGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 53}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147345782 Original CRISPR GACCATTAGGTCCCAAGTTA GGG Intronic
905883824 1:41481203-41481225 TAGCATTAGGGCCCAAGTGATGG + Intronic
911071455 1:93835095-93835117 AAGCATGAGGGCCCAAGTTAAGG - Intronic
912938269 1:114022697-114022719 GACAGTTAGGCCCCAAGTTTGGG + Intergenic
920987919 1:210907883-210907905 GATCATTAGAACCCAACTTATGG - Intronic
924709974 1:246523572-246523594 GACCATCAGGACCCAGCTTAGGG + Intergenic
1065145584 10:22764527-22764549 GGCCATTAGGTCCTAAGGTGAGG + Intergenic
1092556557 12:9567627-9567649 GACCCTTAGGACCCAAGTGGAGG - Intergenic
1094515532 12:31123011-31123033 GACCCTTAGGACCCAAGTGGAGG + Intergenic
1108823410 13:54381314-54381336 GCCCAATAGATCCAAAGTTATGG - Intergenic
1109347457 13:61132033-61132055 CAGCATTAGGTCCAAAATTAAGG - Intergenic
1115653976 14:35425253-35425275 GACTATTGGGTACCAATTTAGGG + Intergenic
1115786636 14:36834021-36834043 GACCAAAAGGTCCAAAGGTAGGG - Intronic
1119732081 14:76957265-76957287 GCCCCTGAGGTCCCATGTTAGGG - Intergenic
1126368356 15:47919372-47919394 AACCATTAGGACCAAAATTATGG - Intergenic
1135136815 16:19891064-19891086 GACCATGAGGTCCCAAGCAGAGG - Intergenic
1137505389 16:49049849-49049871 GACCTTTAAGTACCAAGTCATGG - Intergenic
1140304319 16:73788545-73788567 GCCCATTAGGTCGTAAGTTCTGG + Intergenic
1143677716 17:8448172-8448194 AAACATTAAGTCCCAAGTCAGGG - Intronic
1146844846 17:36176000-36176022 GACCATCAGGACCCAGCTTAGGG + Intronic
1146857152 17:36263935-36263957 GACCATCAGGACCCAGCTTAGGG + Intronic
1146863463 17:36324440-36324462 GACCATCAGGACCCAGCTTAGGG - Intronic
1146873064 17:36387845-36387867 GACCATCAGGACCCAGCTTAGGG + Intronic
1146880422 17:36438931-36438953 GACCATCAGGACCCAGCTTAGGG + Intronic
1147066323 17:37925028-37925050 GACCATCAGGACCCAGCTTAGGG - Intronic
1147075947 17:37988470-37988492 GACCATCAGGACCCAGCTTAGGG + Intronic
1147077856 17:38004589-38004611 GACCATCAGGACCCAGCTTAGGG - Intronic
1147087472 17:38068016-38068038 GACCATCAGGACCCAGCTTAGGG + Intronic
1147093792 17:38128524-38128546 GACCATCAGGACCCAGCTTAGGG - Intergenic
1147103416 17:38191979-38192001 GACCATCAGGACCCAGCTTAGGG + Intergenic
1147345782 17:39793657-39793679 GACCATTAGGTCCCAAGTTAGGG + Intronic
1151694073 17:75705217-75705239 ACCTATTAGGTCCCACGTTAGGG + Intronic
1158431022 18:57387675-57387697 AACCATTAGGTGACAAGTCAAGG - Intergenic
935141731 2:100359183-100359205 CAGCATTAGGTCCCATGTCAAGG + Intergenic
937826591 2:126373621-126373643 GATCATTAGGGCCCAATTTAGGG - Intergenic
940139765 2:150481186-150481208 GACCATTAAGTCATGAGTTAGGG + Intronic
1181669277 22:24418629-24418651 GATCCTTCTGTCCCAAGTTACGG + Intronic
965783484 3:172312710-172312732 GACCGTGAGTTCCTAAGTTAAGG + Intronic
971539643 4:27800222-27800244 GACCAGTGGGTCCCAATGTATGG - Intergenic
971658781 4:29385117-29385139 TACCATTAGGGCCCATGCTAAGG + Intergenic
979174823 4:117650858-117650880 GTCCACTAGCTCCCAAGTGATGG - Intergenic
980214378 4:129832843-129832865 GATCATTAGTTCACTAGTTATGG - Intergenic
984064882 4:175035414-175035436 GACCATCAGGTCACCAGTTATGG - Intergenic
1008339751 6:50350104-50350126 GAGCCTTAGGTTACAAGTTAAGG - Intergenic
1016366474 6:143323937-143323959 GACCATTAGGTCTCAAGAGAGGG + Intronic
1020992076 7:15211025-15211047 TCCCTTTATGTCCCAAGTTATGG - Intronic
1026446854 7:70492193-70492215 GACCCTCAGGTCTCAACTTAGGG - Intronic
1026582540 7:71630278-71630300 GACCATTAAGGCTCAAGATAAGG + Intronic
1026582785 7:71632166-71632188 GACCATTAAGGCTCAAGATAAGG + Intronic
1035225395 7:157429713-157429735 GACCCTTAGGGTCCAAGTTTTGG + Intergenic
1037729801 8:21514871-21514893 AACCATTGGTTCCCTAGTTATGG + Intergenic
1039582740 8:38680335-38680357 GACTCTTAGGTCCCACTTTAAGG + Intergenic
1042826766 8:72987351-72987373 AACTATTTGGTCACAAGTTAAGG + Intergenic
1043386568 8:79754531-79754553 GACCATAAGGTTCTAAGTGATGG + Intergenic
1051343114 9:16129292-16129314 GACCATTTGGGCCCAAGTTACGG - Intergenic
1057829213 9:98394169-98394191 CACCATCAGGTTCCAAGGTAAGG - Exonic
1058898622 9:109421758-109421780 GAGCATTAGGCCCCCAGTGAAGG + Intronic
1059845678 9:118273756-118273778 GAGTTTTAGGTCCCAAGTGATGG + Intergenic
1061684943 9:132267895-132267917 CACCATGAGGTGCCAACTTAAGG + Intronic