ID: 1147349379

View in Genome Browser
Species Human (GRCh38)
Location 17:39828223-39828245
Sequence TTACCCCATCTGGCAAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 5, 2: 16, 3: 27, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147349374_1147349379 7 Left 1147349374 17:39828193-39828215 CCTAAGGGCCTGATGAGGCAGGC 0: 1
1: 0
2: 1
3: 19
4: 194
Right 1147349379 17:39828223-39828245 TTACCCCATCTGGCAAAATTGGG 0: 1
1: 5
2: 16
3: 27
4: 171
1147349369_1147349379 23 Left 1147349369 17:39828177-39828199 CCTTTATGTCAGAACTCCTAAGG 0: 1
1: 1
2: 5
3: 10
4: 89
Right 1147349379 17:39828223-39828245 TTACCCCATCTGGCAAAATTGGG 0: 1
1: 5
2: 16
3: 27
4: 171
1147349375_1147349379 -1 Left 1147349375 17:39828201-39828223 CCTGATGAGGCAGGCTGTGCCTT 0: 1
1: 0
2: 2
3: 51
4: 224
Right 1147349379 17:39828223-39828245 TTACCCCATCTGGCAAAATTGGG 0: 1
1: 5
2: 16
3: 27
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147349379 Original CRISPR TTACCCCATCTGGCAAAATT GGG Intronic
902788354 1:18747463-18747485 TTAACGCATCTGGCCAACTTGGG + Intronic
903734401 1:25521106-25521128 TTTCCCCATCTGGAAAAAGTGGG + Intergenic
904091268 1:27946603-27946625 TGATCCCATCTGGCAGGATTAGG + Intronic
904130339 1:28271126-28271148 TTTCCTCATCTGGCAAAGTGGGG + Intronic
904172210 1:28599351-28599373 TTATCCCAGCTGCCAAAAATAGG + Intronic
905205376 1:36340287-36340309 TTTCCCCATCTGGAAAAAATGGG - Exonic
906445826 1:45897309-45897331 TCACCCCATTTAGCAAAAGTGGG - Intronic
907659879 1:56382155-56382177 TTTGCCCATCTGTCAAAAATCGG - Intergenic
908403755 1:63794218-63794240 TTTCCCCATCTGTAAAAATTGGG + Intronic
910739320 1:90497511-90497533 TTTCCCCATATGGTAAAAGTAGG + Intergenic
911746175 1:101444120-101444142 TCACCCCATGTAGCAAAACTGGG - Intergenic
912944648 1:114074902-114074924 TACCCCCAAGTGGCAAAATTTGG - Intergenic
916161828 1:161924174-161924196 TTACACCAACTGGAAACATTGGG + Intronic
917831920 1:178899757-178899779 TTACTCCACCTGCCAAATTTTGG - Intronic
919873530 1:201843218-201843240 TCACCCCATCCAGCAAAATTGGG - Intronic
921320858 1:213937055-213937077 TTACCTTTTATGGCAAAATTGGG + Intergenic
922486675 1:225978470-225978492 TGACCTCATCTGGCAAACTGCGG - Intergenic
922552999 1:226510949-226510971 TTACCCTATCTTCCTAAATTGGG + Intergenic
922995908 1:229961296-229961318 TTACAGCATCTGGCAAAATTGGG - Intergenic
1066133532 10:32418424-32418446 TGACCCCATTTGACAACATTTGG - Intergenic
1066216476 10:33293168-33293190 TTACCTCATCTGAAAAAATAAGG - Intronic
1068146908 10:53083307-53083329 TTTGCACATCTGGTAAAATTTGG + Intergenic
1068449590 10:57168622-57168644 TTTACACATCTGGTAAAATTTGG - Intergenic
1071135467 10:82448287-82448309 TTACAGCATCTAGAAAAATTGGG + Intronic
1072056456 10:91762420-91762442 TTTGTACATCTGGCAAAATTTGG - Intergenic
1080716311 11:34804692-34804714 TCACCCCCTATAGCAAAATTAGG - Intergenic
1085939360 11:81190107-81190129 TTCCCCCATGTTGCAACATTTGG + Intergenic
1088242549 11:107786901-107786923 TCACCCCATCTGGAAAAATTGGG + Intergenic
1088827424 11:113507557-113507579 TCACCTCATCTGGCAAAAATGGG - Intergenic
1089463293 11:118665728-118665750 TCACAGCATCTGGCTAAATTTGG + Intronic
1089652573 11:119923960-119923982 TTGCCACCTCTCGCAAAATTGGG - Intergenic
1090417775 11:126552373-126552395 TCACCCTGTCTAGCAAAATTAGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092403241 12:8195769-8195791 TTACCCCATGTGGCCAAATACGG - Intergenic
1092492976 12:8962896-8962918 TTATCTCATTTGGAAAAATTTGG - Intronic
1094249872 12:28347593-28347615 CACCCCCATCTAGCAAAATTGGG - Intronic
1095818028 12:46446206-46446228 TTTCCTCATCTGGTAAAATGGGG - Intergenic
1096241524 12:49962442-49962464 TTACCCCACCTGGAAAAAAGGGG + Intronic
1098550198 12:71754368-71754390 TTCCCCCACCTCACAAAATTAGG - Intergenic
1101470262 12:104989747-104989769 CAACCTCAACTGGCAAAATTAGG - Intronic
1106420998 13:29586050-29586072 CTACCCCATCTGGGAACATTAGG + Intronic
1108391742 13:49953879-49953901 TCACCCCATCTAGCAAAATTGGG - Intergenic
1109296124 13:60533026-60533048 TTACCTGAACTGGCATAATTTGG + Intronic
1110230657 13:73164101-73164123 TTACCTCATCTGTAAAAATAGGG - Intergenic
1110665085 13:78107293-78107315 TCACCCCATCTGGCAAAGTTGGG - Intergenic
1110716486 13:78710640-78710662 ATACACCATCTTGCAACATTTGG - Intergenic
1110850610 13:80240942-80240964 TTACCCTAGTTGGCAAAATTTGG + Intergenic
1113166707 13:107450943-107450965 ACACCCCATCTGGGAAAATCAGG - Intronic
1114589224 14:23844409-23844431 TCACCCCATCTGCTAAAATTGGG + Intergenic
1114593788 14:23893710-23893732 TCACCCCATCCTGCAGAATTGGG - Intergenic
1116080411 14:40163607-40163629 TTAAACCATCTGGCAACACTGGG - Intergenic
1117969016 14:61234155-61234177 TCATCCCATCTGGCAAAATTGGG - Intronic
1125403929 15:39333373-39333395 TGACTCTCTCTGGCAAAATTTGG + Intergenic
1128958502 15:71974687-71974709 TCACTCTATCTAGCAAAATTGGG + Intronic
1131782352 15:95873291-95873313 TTACTCTATGTGGCAAAATTGGG + Intergenic
1134361189 16:13532631-13532653 TTACCTCATGTGCCAAAAGTTGG + Intergenic
1138051976 16:53788313-53788335 CCACCCCATCTGGCCAAATAAGG - Intronic
1138136551 16:54528359-54528381 TTAGTCCATATGGCAATATTAGG - Intergenic
1138274044 16:55718277-55718299 TGATCCCATCTGTAAAAATTGGG + Intergenic
1140751906 16:78032424-78032446 TTACCACACCTGGCTAATTTTGG - Intronic
1146454456 17:32998068-32998090 CTACCACACCTGGCAAAATTTGG + Intergenic
1147158213 17:38556000-38556022 TCACCCAATCTGCCAAAGTTGGG + Intronic
1147349379 17:39828223-39828245 TTACCCCATCTGGCAAAATTGGG + Intronic
1149015003 17:51898637-51898659 TTAACACATCTGGTAGAATTTGG + Intronic
1149569403 17:57661814-57661836 TTGCCCTCTCTGTCAAAATTTGG + Intronic
1154066484 18:11111429-11111451 TTATACCATCTGGCAAAACTAGG + Intronic
1156333659 18:36149375-36149397 TCACCCCATCTAGCAAAATTAGG - Intronic
1156358922 18:36366844-36366866 TTTCACCATCTGGCAAAAGTAGG - Intronic
1156636109 18:39031646-39031668 TCCCTCCATCTGTCAAAATTTGG + Intergenic
1157501690 18:48194950-48194972 TTCCCAGAGCTGGCAAAATTGGG - Intronic
1166586611 19:43954591-43954613 TCACCCCATCTGGCAAAATTGGG - Intronic
1167737381 19:51303909-51303931 CCACCCTATCTGGCAAAACTGGG - Intergenic
927258354 2:21060587-21060609 TAACAGCATCTGGCAAAAGTAGG + Intergenic
929007829 2:37412612-37412634 TTCTACCATCTGGCATAATTAGG + Intergenic
930243628 2:48961250-48961272 TGACCCCATCTGGATAATTTCGG - Intergenic
931330455 2:61275813-61275835 TTTCATCATCTGTCAAAATTGGG + Intronic
935622496 2:105142257-105142279 TTACTTCATCAGGAAAAATTGGG - Intergenic
936388445 2:112052118-112052140 TTACCAGATCTGGGACAATTTGG - Intergenic
936936478 2:117843691-117843713 TTAACCGAACTGGCAAAAGTGGG + Intergenic
938123543 2:128653285-128653307 TTACTCAAGCTAGCAAAATTTGG - Intergenic
939986764 2:148836594-148836616 TTACCCTACCTGGCAAAACCAGG + Intergenic
940951512 2:159680772-159680794 TTACCCCCTATTGCAAAATAAGG + Intergenic
941137774 2:161738947-161738969 TCACCCCATCTGGCAAAATTGGG - Intronic
942939530 2:181599807-181599829 TTAACCTCTCTGGCAAGATTAGG - Intronic
943637647 2:190323955-190323977 TCACCGCACCTGGCCAAATTGGG + Intronic
943989745 2:194672723-194672745 TTTAACCATGTGGCAAAATTGGG - Intergenic
944146223 2:196510205-196510227 TCATCCCATCTAGCCAAATTGGG - Intronic
944450483 2:199836930-199836952 TAACCCCATCGGGCAACACTTGG - Intronic
944567514 2:201005565-201005587 TCATTCCATCTGGCAAAATTAGG + Intronic
946102396 2:217337247-217337269 TTACCCCATCAGGGGACATTTGG + Intronic
947376659 2:229503196-229503218 TGACCCCCACTGGCAAAACTGGG + Intronic
1169658040 20:7947541-7947563 TTTGCACATCTGGCAGAATTTGG + Intergenic
1171288650 20:23966592-23966614 TCTCCCCATCTGGCTAAAATTGG + Intergenic
1172163051 20:32881816-32881838 TCATCCCATCTGGCAAAATGGGG - Intronic
1172856141 20:38004072-38004094 TTACCTCATCTGGAAAAAAAGGG + Intronic
1173060869 20:39659805-39659827 TGACCCCCTCTGTCTAAATTAGG - Intergenic
1175287150 20:57844616-57844638 TTTCCTCCTCTGGCCAAATTTGG - Intergenic
1175590719 20:60189809-60189831 TTCCCCAATCTTGCAAAACTAGG + Intergenic
1179058319 21:37956180-37956202 TTATCTCGTCTGGCAAAAGTGGG + Intronic
1181840716 22:25657717-25657739 TTACCAAATCTGGGAAAATTAGG + Intronic
1183067763 22:35375274-35375296 TTTCCTCATCTGACAAAATGAGG - Intergenic
1183183582 22:36278229-36278251 TTTCCTCATATGGAAAAATTGGG + Intergenic
950546545 3:13641384-13641406 TCACCCCATCCGGAAAAATCAGG - Intergenic
951108420 3:18772342-18772364 TTAAACCATTTGACAAAATTGGG + Intergenic
952193677 3:31050014-31050036 TTACCCCATATGGCAAAGAAGGG - Intergenic
952915844 3:38240747-38240769 TTACTCCTACTGGCAAAATCTGG + Intronic
955087938 3:55721091-55721113 TTTCCCCATCAGGAAATATTGGG - Intronic
955653915 3:61223660-61223682 ATACACCATCTGGCAAAATGTGG - Intronic
957187376 3:76959363-76959385 TTATATCCTCTGGCAAAATTCGG + Intronic
959020952 3:101186959-101186981 TCACCCCACCTGGCAAAATTGGG + Intergenic
959974721 3:112445774-112445796 TTATCCCATGTAGCCAAATTTGG - Intergenic
964031430 3:152143841-152143863 TTACCCTATTGAGCAAAATTAGG - Intergenic
964640344 3:158903286-158903308 CTTCCCCAGCTGGCAGAATTAGG + Intergenic
964758031 3:160106332-160106354 TCACCCTAACTGGCATAATTGGG + Intergenic
966761481 3:183423119-183423141 TTCCCCCATCTGACTATATTTGG - Intronic
966991844 3:185240356-185240378 TTTGCACATCTGGTAAAATTTGG + Intronic
969762827 4:9202091-9202113 TTACCCCCTGTGGCCAAATATGG + Intergenic
970467529 4:16341748-16341770 TTTTCCCATCTGGCAATCTTTGG + Intergenic
973664728 4:53147362-53147384 TTTCCACACCTGGAAAAATTTGG + Intronic
975536252 4:75454320-75454342 TTACCCCACTTGGCTAAGTTGGG - Intergenic
975675248 4:76821401-76821423 TTCTCCCATCTGCCTAAATTTGG - Intergenic
976362177 4:84193204-84193226 TAGCCTCAGCTGGCAAAATTGGG - Intergenic
976977743 4:91185245-91185267 TTTCCACATATGGCACAATTAGG + Intronic
977716116 4:100185698-100185720 TCATCTCATTTGGCAAAATTGGG - Intergenic
977721320 4:100243351-100243373 TCCTTCCATCTGGCAAAATTGGG + Intergenic
978241172 4:106518209-106518231 TTTGCACATCTGGCAGAATTCGG + Intergenic
978942206 4:114449591-114449613 TTGACCCATCTAGCAAAGTTGGG - Intergenic
979990303 4:127367372-127367394 TTACCCCATCTAGCAGAACTGGG - Intergenic
981388641 4:144161386-144161408 TTTGCACATCTGGTAAAATTAGG + Intergenic
981624246 4:146737986-146738008 TCACCCCACCTGGCAAAATTGGG + Intronic
983248213 4:165313057-165313079 TTACCCCATCTGTCACCATTAGG + Intronic
983529318 4:168793610-168793632 TTTCCCCATCTGTAAAAAGTGGG + Intronic
984666748 4:182437131-182437153 CTACCCCATATGGTAACATTTGG - Intronic
985931427 5:3060499-3060521 TTAGCCCATTTGGCAAACTAGGG + Intergenic
987358113 5:17082850-17082872 TTGGCCCATCTAACAAAATTGGG + Intronic
988122169 5:26979578-26979600 TTACGCAATCTGACAATATTTGG - Intronic
989365415 5:40650546-40650568 TCACCTCATCTGGCAAAACTGGG + Intergenic
991526339 5:67562690-67562712 TAACCCCATCTGATATAATTTGG + Intergenic
992429812 5:76698593-76698615 TTGACACAACTGGCAAAATTTGG + Intronic
993190518 5:84673851-84673873 TTACCCCATCTAGCAAAATTGGG + Intergenic
995079416 5:108031006-108031028 TTAGGCCATTTGGCAACATTTGG + Intronic
998839120 5:146234542-146234564 TTATCACATCCAGCAAAATTAGG + Intronic
999674346 5:153983836-153983858 CTTCCCCATAGGGCAAAATTGGG + Intergenic
999762506 5:154713278-154713300 ATTCCCCATCTGGGAAAATGAGG + Intronic
999845388 5:155473934-155473956 TTTCCCCATCTGTAAAAAATAGG - Intergenic
1000674754 5:164106670-164106692 TTATCTATTCTGGCAAAATTTGG + Intergenic
1000813419 5:165890601-165890623 TCACCCCATCTGCCAAAATTGGG + Intergenic
1001164108 5:169347966-169347988 TTACCCCAAATGGCAAAGTTAGG + Intergenic
1002999812 6:2320287-2320309 TCACTCCATCTAGCATAATTGGG - Intergenic
1005229984 6:23688808-23688830 TCACCACATCTGTCATAATTTGG - Intergenic
1005858176 6:29880179-29880201 TTCCCACATATGGCAAAATCAGG + Intergenic
1005921332 6:30404595-30404617 TCACTGCATCTGGCAAAGTTGGG + Intergenic
1006040879 6:31253745-31253767 TCACTGCATCTGGCAAAGTTGGG + Intergenic
1006051225 6:31346153-31346175 TCACTGCATCTGGCAAAGTTGGG + Intronic
1007710432 6:43819688-43819710 TTACCCCACCTAGCAAAAGTGGG + Intergenic
1008211283 6:48728495-48728517 TTACCCCACCTAGCAAAATTGGG - Intergenic
1008259941 6:49353130-49353152 TTTGCACATCTGGTAAAATTTGG - Intergenic
1008692268 6:53992705-53992727 GGACCCCAACTGGCCAAATTTGG - Intronic
1009720292 6:67459872-67459894 TTTCCCCATCTTGTAAGATTTGG + Intergenic
1009946152 6:70343782-70343804 TTTACACATCTGGTAAAATTTGG + Intergenic
1012102295 6:95105122-95105144 ATAGCCCCTCTGGCAAAATGTGG - Intergenic
1012358959 6:98352302-98352324 TTTCCACATCTGTCAAAATGGGG + Intergenic
1014828221 6:126070818-126070840 TTTCCCCATCTGTAAAAATATGG - Intergenic
1017628462 6:156371917-156371939 TTAACCCATCGGGCAATGTTTGG + Intergenic
1018082233 6:160268804-160268826 TCACCCCATCTGGCAAACTGGGG + Intronic
1018292653 6:162308614-162308636 TTACCACAAATGGCAAAAGTTGG - Intronic
1019756857 7:2777011-2777033 TTACCCCATCTGGGAGAACTGGG + Intronic
1021222684 7:17991733-17991755 TCGCCCCATCTGGCAAATTGGGG - Intergenic
1021242380 7:18219511-18219533 GTAAGCCATCTGCCAAAATTTGG + Intronic
1022567068 7:31414067-31414089 TTTCCTCATCTTCCAAAATTGGG + Intergenic
1030124316 7:106140072-106140094 TTAGCACTTCTGGCAAACTTTGG - Intergenic
1030461187 7:109839115-109839137 TTCCTCCATCTGGAAAAATGTGG - Intergenic
1031463527 7:122080662-122080684 TAACCCCATCTGGGTAAATGGGG - Intronic
1031482603 7:122297453-122297475 TTACCAGTTCTAGCAAAATTAGG + Intergenic
1034246631 7:149649699-149649721 TTTCCACATATGGCACAATTAGG + Intergenic
1036272919 8:7323827-7323849 TTACCCCCTGTGGCCAAATATGG + Intergenic
1036348431 8:7986521-7986543 TTACCCCCTGTGGCCAAATATGG - Intergenic
1036843703 8:12146987-12147009 TTACCCCCTGTGGCCAAATATGG - Intergenic
1036865073 8:12389305-12389327 TTACCCCATGTGGCCAAATATGG - Intergenic
1037850613 8:22324543-22324565 TCATTCCATCTGGCAAAACTGGG - Intronic
1041853075 8:62416137-62416159 TTAGCCTTTCTGGGAAAATTTGG + Intronic
1042126954 8:65547808-65547830 GTTCCCCAAATGGCAAAATTAGG - Intergenic
1042148621 8:65758221-65758243 TCACCCCATCTGGCAAAATTGGG - Intronic
1042363274 8:67906992-67907014 TTTCCCCATCTGCTAAAATGTGG + Intergenic
1042389221 8:68214005-68214027 TTACCCCACCTGGAAAATATAGG - Intronic
1042515473 8:69654475-69654497 TCACCCCATCTGGCAAAACTGGG - Intronic
1043999922 8:86866639-86866661 TTACCCCAGCTATGAAAATTGGG + Intronic
1044407843 8:91850368-91850390 TAACCCCGTCTGGGTAAATTGGG - Intergenic
1044558067 8:93586076-93586098 TTACACCATCTGGGAAAATTGGG - Intergenic
1045517810 8:102876178-102876200 CCACCACACCTGGCAAAATTAGG + Intronic
1047962498 8:130021122-130021144 TTTCCTCATCAGGCAAAATGGGG + Intergenic
1047969342 8:130071374-130071396 TCACCCCTTCTAACAAAATTGGG + Intronic
1048515835 8:135110537-135110559 TTGACCTCTCTGGCAAAATTAGG + Intergenic
1051775804 9:20632464-20632486 TTATCCCAACTGGAAAAATGAGG - Intergenic
1052191443 9:25668679-25668701 TTACCACTTGTCGCAAAATTGGG - Intergenic
1055150925 9:72998643-72998665 TTTCAACATCTAGCAAAATTTGG + Intronic
1055898558 9:81208483-81208505 TCATCCCATCTGAAAAAATTGGG + Intergenic
1056841703 9:90003197-90003219 TTACCCCAGCTGGCAGAGTTTGG + Intergenic
1059841815 9:118225801-118225823 TTCCCTCATATGGCATAATTTGG - Intergenic
1062155436 9:135045716-135045738 TTGCTCCATCTGGCAGCATTTGG - Intergenic
1186066945 X:5776516-5776538 TTTCCCCATTTGTAAAAATTAGG - Intergenic
1188890408 X:35605244-35605266 TTACCCCATCCGTCAAAATTAGG + Intergenic
1189063864 X:37785130-37785152 TTAAACCAACTGCCAAAATTGGG + Intronic
1189184536 X:39041926-39041948 TTACCCCATCTGGGAAGCATGGG - Intergenic
1189516344 X:41716743-41716765 TTATCCCATCTGGCAAAATTGGG + Intronic
1190090231 X:47430849-47430871 TCACCTCATCTGGCAAATTAGGG + Intergenic
1190863912 X:54368779-54368801 TCACCCTATCTAGCAACATTAGG - Intergenic
1191013672 X:55787859-55787881 TTTCCCCAGATGGCAATATTTGG + Intergenic
1192138731 X:68630322-68630344 TTTCCTCATCTGGAAAAAATGGG + Intergenic
1192147052 X:68688971-68688993 TTTCCTCATCTGGAAAAAATGGG - Intronic
1192381307 X:70619290-70619312 TTACCCTATCTAGCAAAATTGGG + Intronic
1193769993 X:85576997-85577019 TCACCCCATCTAGAAAAATTGGG + Intergenic
1195401810 X:104468839-104468861 TTTATCCATCTGGCAAAATCTGG - Intergenic
1195752633 X:108173722-108173744 TTTCCTCATCTGTAAAAATTGGG - Intronic
1195886251 X:109640892-109640914 TTTCTTCATCTGGAAAAATTGGG - Intronic
1196540202 X:116899145-116899167 TTACCCCATGAGCCAAAATGGGG - Intergenic
1197442680 X:126510802-126510824 TGACCCCTTCTGGCAAAATTGGG - Intergenic
1198747197 X:139902651-139902673 TCAATCCATCTAGCAAAATTGGG + Intronic
1199186736 X:144924070-144924092 TTACCCTATCTGGCAAAACTGGG + Intergenic
1201361163 Y:13150735-13150757 GTACCCCAAATGGCAAAATAAGG + Intergenic