ID: 1147350063

View in Genome Browser
Species Human (GRCh38)
Location 17:39835346-39835368
Sequence CAGCTTGGACCCCCTGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147350052_1147350063 11 Left 1147350052 17:39835312-39835334 CCACGTCCTGCTTGGCCCACTGT 0: 1
1: 0
2: 4
3: 28
4: 200
Right 1147350063 17:39835346-39835368 CAGCTTGGACCCCCTGGCATTGG 0: 1
1: 0
2: 0
3: 7
4: 147
1147350058_1147350063 -5 Left 1147350058 17:39835328-39835350 CCACTGTAGGGCGGCCTCCAGCT 0: 1
1: 13
2: 14
3: 13
4: 123
Right 1147350063 17:39835346-39835368 CAGCTTGGACCCCCTGGCATTGG 0: 1
1: 0
2: 0
3: 7
4: 147
1147350055_1147350063 5 Left 1147350055 17:39835318-39835340 CCTGCTTGGCCCACTGTAGGGCG 0: 1
1: 2
2: 10
3: 21
4: 86
Right 1147350063 17:39835346-39835368 CAGCTTGGACCCCCTGGCATTGG 0: 1
1: 0
2: 0
3: 7
4: 147
1147350057_1147350063 -4 Left 1147350057 17:39835327-39835349 CCCACTGTAGGGCGGCCTCCAGC 0: 1
1: 1
2: 16
3: 29
4: 112
Right 1147350063 17:39835346-39835368 CAGCTTGGACCCCCTGGCATTGG 0: 1
1: 0
2: 0
3: 7
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147350063 Original CRISPR CAGCTTGGACCCCCTGGCAT TGG Intronic
901332573 1:8422958-8422980 CAGCTGGGACCCACTGGCCAGGG + Intronic
903907059 1:26695353-26695375 CAGCCCTGACCCCCTGGCAGCGG - Intergenic
904604514 1:31691433-31691455 CTCCCTGGACCCCCTGGGATAGG - Exonic
904773889 1:32895239-32895261 CAGCTTGGGCACCCTGGCAGGGG + Intronic
905041656 1:34964962-34964984 CAGCTTTGACCTCCTGGCTCAGG - Intergenic
905144449 1:35876861-35876883 CAGCTTCGACCACCTGGGCTGGG + Intronic
905395206 1:37662348-37662370 CACCTGGGACCCCCTTGCCTGGG + Intergenic
907249814 1:53130563-53130585 CAGCTTGGAGCCCCTGGGGATGG + Intronic
911192253 1:94959903-94959925 CAGCCTGGACCTCCTGGGCTAGG + Intergenic
916007468 1:160675374-160675396 CAGCATGGGACCCCTAGCATAGG + Intergenic
922211843 1:223492255-223492277 CAGCCTGGAGCTCCTGGCCTGGG + Intergenic
923659203 1:235944050-235944072 CAGCTTGGATCTCCTGACCTTGG + Intergenic
1067141107 10:43658169-43658191 CAGTTTTGGGCCCCTGGCATTGG + Intergenic
1069602205 10:69715184-69715206 CAGCTTGAACCCCCTTCCTTTGG - Intergenic
1071480412 10:86061042-86061064 CACCTTGGCCCCCATGGCACTGG + Intronic
1071565136 10:86667780-86667802 CTGCCTGCACCCCTTGGCATAGG - Intergenic
1076083122 10:127601241-127601263 CAGGTTGCACACCCTGGCACGGG - Intergenic
1076096885 10:127739396-127739418 CAGCTTGGCCCACCTGGCTCAGG + Exonic
1077955914 11:7020029-7020051 CAGCTTGGGCCCCGGGGTATGGG - Intronic
1082866807 11:57907618-57907640 CAGCTTGGCCCCCAGGGCAATGG - Intergenic
1082868537 11:57921223-57921245 CCTCTTGGACCCACTGACATTGG + Intergenic
1083894384 11:65612894-65612916 CAGCTGGGACCCCCTAGGGTGGG + Intronic
1084004954 11:66317721-66317743 CAGCTTGGTCACCCAGGCACAGG + Intergenic
1084230618 11:67750081-67750103 CAGCCTGGTCCCCCTGCAATGGG - Intergenic
1084944427 11:72631116-72631138 CAGCCTGGACCCCCTTGCAAAGG - Intronic
1085297090 11:75437424-75437446 CAGCTGGGACTCCCTGAGATTGG - Intronic
1088785467 11:113177755-113177777 CAGTTTGTAGCCCCTGTCATGGG + Intronic
1089555196 11:119312228-119312250 CAGCCTGGTCCCCCTGTCCTGGG + Intronic
1090421615 11:126579303-126579325 CAGCTTGCACCCCTTGGCCCTGG - Intronic
1091547785 12:1514897-1514919 CATCCTGGACCTCCTGGCACAGG + Intergenic
1099844075 12:88006560-88006582 CAACTTGTGCCTCCTGGCATGGG + Intronic
1103863719 12:124034680-124034702 TAGCATGGAGCCCCTGGCAAGGG - Intronic
1104436050 12:128757359-128757381 CAGCTTGACTCCCCTGACATGGG + Intergenic
1104937659 12:132375161-132375183 CAGGTTGGACCTCCTGGCCCAGG + Intergenic
1105378308 13:19864040-19864062 CAGCTTGGGCCCCCGGGCTCGGG - Intergenic
1106379531 13:29223148-29223170 CAGCCTGGGCCCCCAGGCCTTGG - Intronic
1106391549 13:29339472-29339494 CAGCATGGTCTCCCTGGCACAGG + Intronic
1108962229 13:56248068-56248090 CAACTTGCAACCACTGGCATGGG + Intergenic
1116055093 14:39853964-39853986 CAGCTTGAACTCACTGGCCTGGG + Intergenic
1122062854 14:99148328-99148350 CACTTTGGACCCCCTGCCAAAGG + Intergenic
1129461950 15:75704064-75704086 CTGCCAGGACTCCCTGGCATTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129708002 15:77805625-77805647 CAGTTTGGAAGCCCTGCCATGGG - Intronic
1129722904 15:77887781-77887803 CTGCCAGGACTCCCTGGCATTGG + Intergenic
1130229752 15:82087581-82087603 CAGCTTGGTCCCCCTGCTCTGGG + Intergenic
1130520368 15:84657135-84657157 CAGCTGGGCCCTCCTGACATTGG + Intronic
1131149336 15:90037091-90037113 CAGCTTGGAGGACCTGGCAGGGG + Intronic
1131690845 15:94825791-94825813 CAGCTGGGAGCCCCTTGCAAGGG + Intergenic
1132152909 15:99475111-99475133 CAGCTGGGGCCCCCTGGGATGGG + Intergenic
1132338289 15:101062787-101062809 CACCTAGGACCACCTGGCCTAGG + Intronic
1132462035 16:60307-60329 CGGCTTCGAGCCCCTAGCATTGG + Intronic
1132501210 16:285484-285506 CAGCATGGACTCCCTGCCACAGG + Exonic
1132761467 16:1510506-1510528 CAGCTGGGACACCCGGGCCTTGG - Exonic
1138534166 16:57651159-57651181 CAGATGGGACCCCGTGGCAGGGG - Intronic
1139776378 16:69319416-69319438 CTGTTCGGACCCCCTGGCACAGG + Exonic
1139949806 16:70663340-70663362 CAGCCTGGCCCCTCTGTCATGGG + Exonic
1139972681 16:70786030-70786052 CAGCCTGGTCCCCTAGGCATGGG - Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1147350063 17:39835346-39835368 CAGCTTGGACCCCCTGGCATTGG + Intronic
1147787603 17:42990975-42990997 CAGCCTGGACCCTCTGCCACAGG - Exonic
1152233753 17:79127816-79127838 CATCTTGAACCTCCTGGGATCGG - Intronic
1153411671 18:4800215-4800237 CAGCTTTGACCTCCTGGCTTAGG + Intergenic
1157607171 18:48933223-48933245 CAGGGTGGGCCCCCTGGGATGGG - Intronic
1158381308 18:56933031-56933053 CTGCTGGGACCCCTTGCCATTGG - Intronic
1159986721 18:74850522-74850544 TAGATTAGACCCACTGGCATGGG - Intronic
1160910922 19:1473484-1473506 CAGGTTGGACCCCCTGTCTGGGG - Exonic
1161164453 19:2778602-2778624 CAGCTTAGACACCCTGGGCTAGG + Intronic
1161286754 19:3472292-3472314 CAGCTGAGACCCCCTGACCTTGG - Intergenic
1163704708 19:18805439-18805461 CAGCCTCGACCCCCTGGGCTTGG + Intergenic
1164593620 19:29519679-29519701 CTGCCTGTACCCCCTTGCATAGG + Intergenic
1164669315 19:30063711-30063733 TCGCTTGGACCCCCAGGCCTGGG - Intergenic
1164950596 19:32333586-32333608 CAGCTTGGACTCTCTGCCAAGGG + Intergenic
1165049458 19:33132337-33132359 CACCCTCGACCCCCTGGCCTTGG + Exonic
927087957 2:19689735-19689757 CAGCATGGATCCCCTGCCCTTGG - Intergenic
934571273 2:95374709-95374731 CTGCTGGGGCCCCCTGGCCTGGG - Intronic
934714601 2:96536542-96536564 CAGACTGGAGCCCCTGGAATAGG - Intergenic
936400258 2:112159575-112159597 CGGTTTGGACCCCGTGGCTTCGG + Intronic
943774337 2:191749096-191749118 CAGTTTGGCCCCCCTGGAAGTGG - Intergenic
947573150 2:231251043-231251065 CTGAATGGAGCCCCTGGCATGGG + Intronic
948721540 2:239904017-239904039 CAGCCTGGGCTCCCTGGGATGGG - Intronic
1170355515 20:15488120-15488142 CAGCTAGGTCCCCTTGGCTTGGG - Intronic
1174670581 20:52304130-52304152 CATTTTGCACCCCCAGGCATTGG - Intergenic
1181517791 22:23425643-23425665 CAGCTCGGATCCCCTGGAGTTGG - Intergenic
1183513662 22:38250748-38250770 CAGCTTGGACTCCCAGGCAGAGG + Intronic
1184441256 22:44517728-44517750 CAGCTGGGTCACCCTTGCATAGG - Intergenic
1184874301 22:47263360-47263382 CAGCTTGGATCATCTGGCCTAGG - Intergenic
1184893600 22:47394147-47394169 CATGGTGGAGCCCCTGGCATTGG + Intergenic
1185252821 22:49814325-49814347 CACCTCGCACCACCTGGCATGGG - Intronic
950076888 3:10193737-10193759 CTGCTGGGACCCCCAGGGATAGG - Intronic
952327837 3:32336933-32336955 CAGCTATGACCCCTTGGCCTTGG - Intronic
961239820 3:125400944-125400966 CAGCGTGGGGACCCTGGCATGGG - Intergenic
963437794 3:145293709-145293731 CAGCTTGGACTCATTGGCTTTGG - Intergenic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
965544574 3:169902655-169902677 CAGCCTTGACCCCCAGGCCTAGG + Intergenic
968459033 4:714625-714647 CAGGTGAGACCCCCTGGCGTTGG + Intronic
968619824 4:1599064-1599086 CACCCTGGATCCCCTGGCCTCGG - Intergenic
968619845 4:1599130-1599152 CACCCTGGATCCCCTGGCCTCGG - Intergenic
968619867 4:1599196-1599218 CACCCTGGATCCCCTGGCCTCGG - Intergenic
968619886 4:1599262-1599284 CACCCTGGATCCCCTGGCCTCGG - Intergenic
969414924 4:7051981-7052003 CAGTGGGGCCCCCCTGGCATTGG - Intronic
969656074 4:8499276-8499298 CAGCCTGGGCCCCCTGCCCTGGG + Intergenic
969660611 4:8525370-8525392 CACCCTGGTCTCCCTGGCATGGG + Intergenic
969690733 4:8702738-8702760 CACCATGGAAGCCCTGGCATGGG + Intergenic
975147968 4:70991333-70991355 CAGCCTTGACTCCCTGGCTTCGG + Intronic
975992040 4:80267279-80267301 CAGCTTGGTCCCAGTGGCCTGGG - Intronic
977923073 4:102667255-102667277 CTGATTGGACTCCCTAGCATTGG - Intronic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
979797324 4:124862433-124862455 AGGCTTGGATCCCCTGGGATGGG - Intergenic
985789511 5:1917807-1917829 CAGCTCGGAACACCTGGCAGTGG - Intergenic
991509848 5:67364564-67364586 AAGCTTGGAACCCCTGGGACAGG + Intergenic
996747470 5:126857659-126857681 CTGCCTGGCCTCCCTGGCATTGG + Intergenic
997588698 5:135059986-135060008 CAGTTTGGACATCATGGCATTGG + Intronic
1001470598 5:172009472-172009494 GAGTTTGCATCCCCTGGCATTGG + Intergenic
1002134112 5:177097613-177097635 CAGCCACGACCCCCTGCCATTGG + Exonic
1004152917 6:13137832-13137854 CGGCTTGGGCCTCCTGGAATAGG + Intronic
1004274400 6:14222669-14222691 CTGCTTCGACCTCCTGGCCTTGG - Intergenic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1005960557 6:30690181-30690203 CATCCTTGCCCCCCTGGCATGGG - Exonic
1006798643 6:36745886-36745908 CACCTTGCACCCTCAGGCATGGG + Intronic
1014200812 6:118607034-118607056 CAGCTTGGCCCCCATGGCTATGG - Intronic
1019221087 6:170473358-170473380 CAGCTTGTACCTCCTGGCAGTGG - Intergenic
1019614796 7:1954352-1954374 CAGCTTGGACCCCACAGCCTGGG - Intronic
1019687382 7:2389157-2389179 CCTCCTGGAACCCCTGGCATGGG - Intergenic
1019888401 7:3925183-3925205 CAGATGGCACCCCCTGCCATTGG + Intronic
1020090119 7:5334019-5334041 CACCTTGGAGCCCCTGTCCTGGG - Intronic
1020314312 7:6894110-6894132 CAGCCTGGTCCCCCTGCAATGGG - Intergenic
1027995788 7:85423931-85423953 CAGCCTGGTCCCCATGCCATAGG - Intergenic
1029125719 7:98293973-98293995 CAGGCTGGACCCCCTGGGCTGGG + Intronic
1035391365 7:158506971-158506993 CAGGTTGGAATCCCTGGTATTGG - Intronic
1035649470 8:1254093-1254115 CAACTTGGCCCCCCTGGCCATGG - Intergenic
1035670211 8:1411417-1411439 CAGCTAGGACCGCCTGGCTCAGG - Intergenic
1036632409 8:10524857-10524879 CAGCCTGGACCCTCGGGAATGGG - Intergenic
1037333074 8:17763684-17763706 CAGCCTGGAGCCCCAGGCAAAGG + Intronic
1037456873 8:19072609-19072631 CAGCTGGGAGCCCGTGGCCTGGG - Intronic
1040135394 8:43847401-43847423 CAGCTTGGAATCACTGCCATTGG + Intergenic
1043921535 8:85989245-85989267 CAGCCTGGACCTCCTGGCTCAGG + Intronic
1047208117 8:122819684-122819706 CAGCCTGGCCCCACAGGCATCGG + Intronic
1047548165 8:125839686-125839708 CAGGTAGGGCCCCCTGGCTTGGG + Intergenic
1052872609 9:33523532-33523554 CAGCTTGGGCGCCCAGGCAGCGG - Intergenic
1053324184 9:37127800-37127822 GTGCTTGGAGCCCCTGGGATTGG + Intronic
1055500352 9:76896752-76896774 CTGCCTAGACCCCCTGACATCGG + Intronic
1057694946 9:97316572-97316594 CACCTGGGCACCCCTGGCATGGG - Intronic
1058568611 9:106314764-106314786 CAGCCTGGACTCCCGGGCAGTGG - Intergenic
1060110854 9:120905285-120905307 CAGCTTGGAGGCCCAGGCTTGGG + Intronic
1060681475 9:125568758-125568780 CAGCTTGGCCCCCAGGGCAATGG + Intronic
1061362838 9:130154716-130154738 CAGCTTTGACCTCCTGGGTTTGG + Intergenic
1062733129 9:138120415-138120437 CCGCTTGGACCCCCTGACTCGGG - Intronic
1185539894 X:894790-894812 AAGCCTGGAGCCTCTGGCATGGG + Intergenic
1187772788 X:22720404-22720426 CAGCATGGCTCCCCTGGCAGCGG + Intergenic
1189356989 X:40317537-40317559 CAGCCTTGACCTCCTGGCTTAGG + Intergenic
1190815430 X:53924977-53924999 CAGCTTGGCCCCCAGGGCAATGG + Intergenic
1190970374 X:55342492-55342514 CAGCATGGACGCCCAGGAATGGG + Intergenic
1192221077 X:69197735-69197757 CAGCTTGGGCTGCCTGGCCTGGG - Intergenic
1201153287 Y:11107089-11107111 CAGCTTGGGCGCCCAGGCAGGGG - Intergenic
1201178135 Y:11322217-11322239 CAGCTTGGCCGCACCGGCATAGG + Intergenic