ID: 1147352659

View in Genome Browser
Species Human (GRCh38)
Location 17:39863808-39863830
Sequence CCAGATTTGCAGCCATTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147352653_1147352659 0 Left 1147352653 17:39863785-39863807 CCAAAAGGGTTGATTATTCCACC 0: 1
1: 0
2: 1
3: 8
4: 90
Right 1147352659 17:39863808-39863830 CCAGATTTGCAGCCATTTCAGGG 0: 1
1: 0
2: 1
3: 18
4: 201
1147352650_1147352659 18 Left 1147352650 17:39863767-39863789 CCATGAAGGAAAAAATATCCAAA 0: 1
1: 0
2: 3
3: 71
4: 773
Right 1147352659 17:39863808-39863830 CCAGATTTGCAGCCATTTCAGGG 0: 1
1: 0
2: 1
3: 18
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147352659 Original CRISPR CCAGATTTGCAGCCATTTCA GGG Intronic
900926591 1:5709961-5709983 CCACTTGTGCAGCCATTTCCTGG + Intergenic
901672287 1:10862887-10862909 CCAGAATTCCTGCCATTGCAGGG + Intergenic
902343455 1:15799390-15799412 CTTGATTTGAAGCCATCTCAGGG - Intergenic
904450713 1:30609610-30609632 CCTGATTTGGAGCCAGTCCAGGG + Intergenic
904780377 1:32942302-32942324 CCAGCTTTGCAGCCCTCTCAGGG - Exonic
905678949 1:39852759-39852781 GCAGCTTGGCAGCCATTTCTGGG + Exonic
908587150 1:65582323-65582345 CCAGGACTGCAGTCATTTCAAGG + Intronic
913498849 1:119452270-119452292 CCTGATTTGCAGCAATGGCAGGG + Intergenic
914493158 1:148166922-148166944 CCAGATTTTCAGCCTTTTGAGGG - Intergenic
916021348 1:160795444-160795466 CCAGGGCTGCAGTCATTTCAAGG + Intergenic
917046615 1:170867537-170867559 CAAGATCTGTAGGCATTTCAAGG + Intergenic
918238141 1:182599693-182599715 CCAGCCTTGCAGTCATGTCAAGG - Exonic
918829511 1:189375090-189375112 CCAAATCTGCAGACATTTCCAGG - Intergenic
919340731 1:196303141-196303163 AGAGATTTGCATCCATCTCAGGG - Intronic
919807954 1:201391890-201391912 CCTGATTTGCAGACAATGCAGGG - Intronic
920057078 1:203200606-203200628 CCAGTTCTGCAGCTATTTTAGGG + Intergenic
922368060 1:224884582-224884604 CCAGACATGGAGCCATTCCAAGG - Intergenic
924113264 1:240721329-240721351 CAAGATATGCACCCATTGCAGGG - Intergenic
924612251 1:245583388-245583410 CCAGATTTGAAACCATCTCCGGG + Intronic
1064845221 10:19644556-19644578 CCTGATTTAAATCCATTTCATGG - Intronic
1065854365 10:29817446-29817468 GCAGATCTGCAGCCACTGCAGGG + Intergenic
1066299169 10:34081700-34081722 CCTGTTTTGCAGGCATGTCATGG + Intergenic
1067421972 10:46159697-46159719 CCAGATCTGCAGCCACTACTTGG + Intergenic
1067507279 10:46865786-46865808 CCAGATCTGCAGCCACTACTTGG + Intergenic
1068675473 10:59765262-59765284 CCAGATTTGGGGCCAGTTTATGG + Intergenic
1068738927 10:60447131-60447153 GCATATTTGCTTCCATTTCAGGG + Intronic
1071886170 10:89952383-89952405 CCAGGTTTGCAGCCATAGCTTGG + Intergenic
1073896203 10:108162114-108162136 CCATATTTACAGACATTACAAGG + Intergenic
1075171784 10:120122170-120122192 CCAGAACTGAAGCCATCTCAAGG - Intergenic
1076228623 10:128801555-128801577 GATGATTTTCAGCCATTTCATGG - Intergenic
1076472962 10:130732176-130732198 GCAGATTTGCTTCCATGTCAAGG + Intergenic
1079790703 11:24735391-24735413 TCAAATTTTCAGACATTTCAGGG - Intronic
1080540601 11:33260440-33260462 CCTGATTCACATCCATTTCATGG + Intronic
1081564454 11:44248937-44248959 TCACATTTGCAACCATTTCAGGG + Intergenic
1087229148 11:95640243-95640265 CCAGTTTTGGAGCCAGTTTATGG + Intergenic
1088397655 11:109386350-109386372 CCACATTCCCAGCCATTTTAAGG + Intergenic
1090592284 11:128285118-128285140 CCAGGGTTGCAGTCATTTCAAGG - Intergenic
1090767264 11:129887071-129887093 CCAGATGTGCTGCCCATTCAGGG + Intronic
1091264055 11:134256609-134256631 CCATATTTGGAGCCATCTCTCGG - Exonic
1092218484 12:6698087-6698109 CCAGATTTTCAGCCTTTACTGGG + Exonic
1092473984 12:8803444-8803466 CCAGTTTTGGGGCCATTTTATGG + Intergenic
1093076436 12:14763582-14763604 CAATATTTGAAACCATTTCATGG - Intergenic
1093504588 12:19850357-19850379 ACAGAGGTGAAGCCATTTCAGGG + Intergenic
1095148424 12:38760142-38760164 CCACATATTCAGCCCTTTCAGGG + Intronic
1096330083 12:50703652-50703674 CCTGTTTTGCAGCCACTTAATGG - Intronic
1097151679 12:56983954-56983976 CAAGGTTTGCACCCATTTCAAGG + Intergenic
1098991702 12:77070941-77070963 CCAGATGTCCAGCTATTTAAAGG + Intergenic
1099718736 12:86333453-86333475 CCAGAGTTGTAGCCATGGCAGGG + Intronic
1099939223 12:89165013-89165035 CCAGGTTTTCAGTCGTTTCAAGG - Intergenic
1100515616 12:95324720-95324742 GCAGAGCTGCAGCCATATCAGGG - Intergenic
1101999471 12:109547893-109547915 AAATATTTGCAGCCACTTCAGGG + Intergenic
1104272915 12:127298469-127298491 CCAAATGTGCACCCCTTTCAGGG + Intergenic
1104279942 12:127367371-127367393 CCAAATAGGCATCCATTTCAAGG + Intergenic
1104500076 12:129276592-129276614 CCAGGCATGCAGCCACTTCATGG + Intronic
1105314080 13:19241809-19241831 ACAGGTTTTCAGCCATCTCATGG - Intergenic
1105322384 13:19340085-19340107 CAAGAATTTCAGACATTTCAGGG - Intergenic
1106683312 13:32030931-32030953 CCAGAAATGCAGTCTTTTCAAGG - Intergenic
1108525416 13:51281847-51281869 CCAGATTTGCAGGTGTTGCATGG - Intronic
1111599188 13:90449683-90449705 CAAGATTAGTAGCCATTTTAGGG + Intergenic
1112253064 13:97801582-97801604 CCAGAGTTGTAGTCATTGCAGGG - Intergenic
1113878278 13:113608089-113608111 CCTGACTTGCTGGCATTTCATGG + Intronic
1115074527 14:29371031-29371053 CCAGTTTTGCACACATTGCATGG - Intergenic
1116238114 14:42307583-42307605 CCAGATTTGGGGCCAGTTTATGG + Intergenic
1121040890 14:90746049-90746071 CCAGATATGGAGGCATTTGAAGG - Intronic
1122002701 14:98674872-98674894 GCAGTTTTGCAGCAATTTCCAGG + Intergenic
1125294964 15:38192570-38192592 CCAGGGCTGCAGCCATTTGAAGG + Intergenic
1127952931 15:63827476-63827498 CCTGATTTGGAGTCATTTCCAGG + Intronic
1128282012 15:66403506-66403528 CCAGAAAGGCATCCATTTCAAGG - Intronic
1128619929 15:69140193-69140215 CCTGATTGGCAGCCATTTCGAGG + Intergenic
1130062150 15:80577813-80577835 ACAGATTAGCAGACATTGCAGGG + Intronic
1131363881 15:91820819-91820841 CAAGATTTTCAACCATTTCTAGG + Intergenic
1131863690 15:96682729-96682751 CCAGAATTGCAGTTATCTCAAGG - Intergenic
1133678503 16:8098404-8098426 CCAGAATTGCAGCAAATGCACGG + Intergenic
1134294089 16:12929832-12929854 CCAGAATTGCTTCCACTTCAGGG + Intronic
1134315546 16:13115631-13115653 CCAGTTTTGGAGCCAGTTTATGG + Intronic
1135952901 16:26931798-26931820 CCAGATCTCCTGGCATTTCAAGG - Intergenic
1138256801 16:55571603-55571625 CCAGACTTGAAGATATTTCAGGG - Intronic
1142371401 16:89684936-89684958 CCAGTTTTGCGGCCAGTTGATGG - Intronic
1143214623 17:5215198-5215220 CCTCATTTTCAGCCATTTCCAGG - Intronic
1143956716 17:10675874-10675896 CCATGTTTGCACCCAGTTCAAGG - Exonic
1144428269 17:15166186-15166208 CCAGATTTGCTGCCATTGCAGGG - Intergenic
1146591533 17:34131819-34131841 CCAGATTCTCAGACCTTTCAGGG - Intronic
1147041856 17:37725634-37725656 CTAGAATAGCAGACATTTCAAGG + Intronic
1147352659 17:39863808-39863830 CCAGATTTGCAGCCATTTCAGGG + Intronic
1148612330 17:48972543-48972565 CCAGCTCTGCAGCCAGGTCAGGG + Intergenic
1149070764 17:52539567-52539589 CCAGTTTTGCACCCAATACAGGG - Intergenic
1151204214 17:72493547-72493569 CCAGATTTTCTGGCTTTTCAAGG + Intergenic
1153409181 18:4774572-4774594 ACAGATTTGCATATATTTCATGG - Intergenic
1160962429 19:1729384-1729406 GCAGATGTGCGGCCATTTGAGGG + Intergenic
1162282690 19:9711971-9711993 CCAGTTTTGGAGCCAGTTTATGG + Intergenic
1162642404 19:12022032-12022054 CCAGTTTTGGAGCCAGTTTATGG - Intronic
1163360711 19:16844396-16844418 CCAGTTTTGTGGCCATTTTACGG - Intronic
1164283564 19:23790443-23790465 CCTAAGTTGCAGCCTTTTCAGGG - Intronic
1167956549 19:53069944-53069966 CCTGAACTGCAGCTATTTCAAGG - Exonic
1168265377 19:55220697-55220719 GCCCATTTGCAGCCATTTCTGGG + Intergenic
925649419 2:6073563-6073585 CCAGATTTAAACCCATTTCCAGG + Intergenic
925952041 2:8923843-8923865 CCAGTTGTACAGCCGTTTCAGGG + Intronic
932638927 2:73421809-73421831 CTAGATTTGCAGTAATTTCAGGG + Intronic
936913164 2:117613471-117613493 CACGATTTGCAGCCATATGAAGG + Intergenic
937170963 2:119868481-119868503 CCAGTTTTGGAGCCAGTTTATGG - Intronic
937269771 2:120641652-120641674 ACAGAGTTGCAGTCATCTCAGGG - Intergenic
939098592 2:137867127-137867149 ACACATTTGCAGGCATTTCATGG - Intergenic
939724393 2:145698222-145698244 CCAGATTTCCAGACATGTTAAGG + Intergenic
941828628 2:169928664-169928686 CCAGATTTATAGCCTTTCCAAGG - Intronic
941829624 2:169940385-169940407 CCAGACATGCAGACATTTTAAGG - Intronic
943732767 2:191320600-191320622 CCAAATCTGTAGCCATTTCATGG - Intronic
943759826 2:191595644-191595666 CCAGTTATACAGCCTTTTCATGG - Intergenic
947987185 2:234458678-234458700 CCAGGGTTGCAGCCATCTCAAGG - Intergenic
1171060812 20:21957332-21957354 ACAGATTTGCAGCCAATCAATGG + Intergenic
1173757141 20:45526449-45526471 CCAAATGAGCAGCCTTTTCAGGG + Intergenic
1175550314 20:59813319-59813341 CAAACTTTGCAGCCTTTTCAGGG - Intronic
1178092998 21:29183904-29183926 TCAGATTTTCAGACATTTAATGG - Intergenic
1180037685 21:45258108-45258130 CCAGATGTGCAGCAATGACAAGG + Intergenic
1182842210 22:33400441-33400463 TCAGAGTTGCAGCCATTTTTCGG - Intronic
949651684 3:6167199-6167221 CCAGTTTTGGAGCCAGTTTATGG + Intergenic
950481689 3:13248094-13248116 CCAGCTTTGCAGCCCTCTGAGGG - Intergenic
951465388 3:22995775-22995797 CCAGGGTTGCATCCATTTAAAGG + Intergenic
951760741 3:26144738-26144760 CAAGATTGGGAGCTATTTCAAGG - Intergenic
952040326 3:29253699-29253721 GCAGATTTGCATGCAGTTCAGGG + Intergenic
953329750 3:42043160-42043182 GCAGCTTAGCAACCATTTCAAGG + Intronic
953572613 3:44083150-44083172 CCAGGTTTGCAGTAATTACAAGG + Intergenic
954200650 3:49021514-49021536 GCAGACTTGGAGCCATTTTAAGG + Exonic
954465433 3:50651682-50651704 AGAGATTTGCTCCCATTTCACGG - Intergenic
955503119 3:59604776-59604798 CCAAATTTGCAGCCACTAAATGG - Intergenic
956158860 3:66326497-66326519 CCAGAATTGCAGCCAGGGCAGGG + Intronic
956464712 3:69507733-69507755 CCAGGTTTGCAGCCTTCTGATGG + Intronic
956664177 3:71626766-71626788 CCAGCTTTGCATTCATTACATGG + Intergenic
959241056 3:103794749-103794771 CCAGTTTTGTAGTCATTTCCAGG + Intergenic
959320560 3:104869219-104869241 CCAGATTTGCAGTCATCTTAAGG - Intergenic
959367093 3:105475087-105475109 CCAGGTTTTCAGCCACTGCAGGG - Intronic
959667733 3:108940545-108940567 CATGATTGGCAGCCATTGCAAGG + Intronic
959833360 3:110890619-110890641 CCACATTTGAAGAAATTTCATGG - Intronic
960455028 3:117860475-117860497 CCAGAGTTGCGGGCATTTGAAGG - Intergenic
962659048 3:137582078-137582100 CCACTTTTGCAGACGTTTCATGG - Intergenic
962675079 3:137750259-137750281 CCAGGGCTGCAGCCATTTGAAGG - Intergenic
963843458 3:150131146-150131168 CCAGATTTGTACCCATCTGAGGG + Intergenic
964132910 3:153311213-153311235 CCAGGTCTGCAGCCATCTCAGGG - Intergenic
966077886 3:175960687-175960709 GCAGATTTGCAGCCACGGCATGG + Intergenic
967450843 3:189620588-189620610 TCAGATTGAAAGCCATTTCAAGG + Intergenic
967616127 3:191568862-191568884 CAATATTAGCAGCTATTTCATGG - Intergenic
968930224 4:3575038-3575060 GCAGATTTGCACACATTTCTGGG - Intergenic
969902647 4:10364093-10364115 CCAGAGTCACTGCCATTTCAAGG - Intergenic
973866931 4:55124257-55124279 CCAGATTTCCACCCTTTGCAGGG - Intronic
974163718 4:58173138-58173160 TCTGTTTTGCAGCCATTACAAGG + Intergenic
974982517 4:68977005-68977027 CCAGACTTGCAGTGATTTCTAGG - Intergenic
975340540 4:73234933-73234955 CCAAGTTTGGAGCCATTCCAAGG + Intronic
977845513 4:101762108-101762130 ACAGTTTTTCAGCCATTTCCTGG + Intronic
978448409 4:108802909-108802931 CCAGAGTTGGAGCAGTTTCAGGG + Intergenic
982083213 4:151810028-151810050 CCAGATTAGCAGACAATGCAAGG - Intergenic
983423712 4:167555180-167555202 CATGATTTTCAGCCATTTAAAGG - Intergenic
985169574 4:187134378-187134400 CCAGATTTGCTGCCTTATCTTGG - Intergenic
985735503 5:1578284-1578306 CCAGTTTTGGAGCCAGTTTATGG + Intergenic
989354621 5:40529538-40529560 CCACCTTTGCAGACTTTTCATGG - Intergenic
989794731 5:45453518-45453540 CCAGCAGTGCAGCCAATTCATGG + Intronic
990329933 5:54715421-54715443 CCAGGCTTGCAGTCATCTCAGGG + Intergenic
991211446 5:64109562-64109584 CTAGATTTGAAGCTATTTCATGG + Intergenic
991950815 5:71945492-71945514 CCAGATTTTAAGCCAATTAAGGG + Intergenic
992382109 5:76248072-76248094 CCAGTTTTGCAGCATTTTAATGG - Intronic
992447245 5:76845196-76845218 CCAGTTTTGGAGCCAGTTTATGG - Intergenic
992491592 5:77249653-77249675 CCACATTTGCAGCAATTGCTAGG + Intronic
995592238 5:113711948-113711970 CCAGTTTTGGAGCCAGTTTATGG - Intergenic
995765160 5:115606631-115606653 CCAGATAACCATCCATTTCAAGG + Intronic
996774102 5:127116102-127116124 CGATATTTGCAGCTCTTTCAGGG - Intergenic
997836493 5:137197710-137197732 CTAGATTTGAACCCATTTAATGG - Intronic
998696524 5:144646832-144646854 CAGGATATGCAGCCATTTGATGG + Intergenic
1000116251 5:158156323-158156345 CCAGAGTATCAGCCATTCCATGG - Intergenic
1000588102 5:163124989-163125011 CCAGTTTTGGGGCCAGTTCATGG - Intergenic
1003815166 6:9831735-9831757 CCAAATTTGCTGACATTACAGGG - Intronic
1004482853 6:16037647-16037669 CCAGTTTTGGAGCCAGTTTATGG - Intergenic
1004534427 6:16486308-16486330 CCAAAGTTGAAGCCATTTCTGGG + Intronic
1005981051 6:30836835-30836857 CCAAACTTGGAGACATTTCAGGG - Intergenic
1011022435 6:82829292-82829314 TTAGCTTTACAGCCATTTCAAGG + Intergenic
1011164732 6:84433202-84433224 CCAGATTTAAAGCCATATCTGGG - Intergenic
1011998213 6:93620074-93620096 CAAGATTTGCAGCCATTATGAGG - Intergenic
1013475606 6:110504597-110504619 CCCCAGTTGCAGCCATGTCAAGG + Intergenic
1015467011 6:133558870-133558892 CCAGTTTTGGGGCCAGTTCATGG + Intergenic
1018353511 6:162988022-162988044 CCAGTTTTGCACCCGTCTCATGG + Intronic
1019233952 6:170593541-170593563 CCAGTTTTGCGGCCAATTTATGG + Intergenic
1021201418 7:17732174-17732196 CCAGAATTGCAGCCTTGCCAGGG - Intergenic
1022580996 7:31553994-31554016 CCAAATTTGCATTCATTCCAGGG - Intronic
1023436600 7:40146774-40146796 CCAGTTTTGGAGCCAGTTTATGG + Intronic
1024154151 7:46603223-46603245 CCACATTTGCAGCCTCTGCAAGG + Intergenic
1024596327 7:50940715-50940737 CCAGATTAGTAACCAGTTCAGGG + Intergenic
1024666101 7:51548719-51548741 CCTGACTTTCAGCTATTTCAGGG + Intergenic
1026948059 7:74328594-74328616 CCTCATCTGCAGCCATCTCAAGG - Intronic
1028810600 7:95081956-95081978 CCACCTTGGCAGCCACTTCAGGG + Intronic
1030365945 7:108646094-108646116 CCAGTTTTGGGGCCAGTTCATGG + Intergenic
1032919333 7:136527808-136527830 CCAGAATTGGAGCCATTGCCAGG + Intergenic
1034819467 7:154203385-154203407 CCAGAGTTGAAGCCATCTGAAGG + Intronic
1039843167 8:41308037-41308059 CCAGTTTTGCAGCAATCCCAAGG + Intronic
1040381384 8:46876564-46876586 CCAGTTTTGGAGCCAGTTTATGG - Intergenic
1040491705 8:47929315-47929337 TCAGCTCTGCAGACATTTCAAGG + Intronic
1041114063 8:54517320-54517342 CTAGATTGTCAGCCATTTGAAGG - Intergenic
1041689661 8:60676883-60676905 TCAGATGTGCATCTATTTCAAGG - Intergenic
1042510525 8:69606776-69606798 CCAGATATGAAAGCATTTCATGG - Intronic
1044488677 8:92785753-92785775 CCACAATTGGAGCCATGTCAGGG - Intergenic
1046148637 8:110194192-110194214 CCAAGTTTCCAGCCATTTCATGG - Intergenic
1047137074 8:122091489-122091511 CCAGATTTGCTGACGTATCAGGG + Intergenic
1048012103 8:130466143-130466165 CCAGAGCTGCAGTCATTTCAAGG - Intergenic
1048686283 8:136908367-136908389 CCAGTTTTGGGGCCATTTTATGG + Intergenic
1049105325 8:140609017-140609039 CCAGATCTGCAGACATTTTTCGG - Intronic
1050517712 9:6462466-6462488 CATGATTTGCATCCATATCAGGG - Intronic
1052606465 9:30708506-30708528 CCAGTTTTGGAGCCAGTTTATGG + Intergenic
1053392844 9:37748204-37748226 ACAGATTGGAAGCAATTTCATGG + Intronic
1054459874 9:65456876-65456898 GCAGATTTGCACACATTTCTGGG + Intergenic
1054756575 9:68964805-68964827 CCAGAATTGCAGCGTTTACAAGG - Intronic
1056216576 9:84410518-84410540 CCAGATTTTCAGCAAAATCAAGG - Intergenic
1058440999 9:105007111-105007133 CCAGATTTGAAGTCATGTCATGG + Intergenic
1058967195 9:110048932-110048954 CCAGATTTCCAGCCCTTCCTCGG - Intronic
1060027694 9:120186817-120186839 ACAGATGTGCATCCATTTTATGG - Intergenic
1060524976 9:124315378-124315400 CCCGACTTGCAGCCACTTCAGGG - Intronic
1062075440 9:134586153-134586175 CCAGACTTCCATCCATTTCCAGG + Intergenic
1062476420 9:136729728-136729750 CCAGAGTTTCAGCCAGTTCCAGG - Intergenic
1187277561 X:17829147-17829169 CTTGATTTGCAGTCATTTCAAGG + Intronic
1187885136 X:23882590-23882612 CCAGAATGGAAGCCCTTTCAGGG - Intronic
1188623002 X:32249688-32249710 CCAGATTTGTAGCTTTTCCAGGG - Intronic
1189095643 X:38136158-38136180 CCCAATTTGCAGCAAGTTCAGGG - Intronic
1191870427 X:65740708-65740730 CCAGATCTGCAGTCACTTCGTGG + Exonic
1195546109 X:106114336-106114358 CCAGTTTTGGAGCCAGTTTATGG + Intergenic
1196390890 X:115206318-115206340 CCAGTTTTGGGGCCAGTTCATGG - Intronic
1201987056 Y:19980056-19980078 CAATATTTTCAGCCATTTCCCGG - Intergenic