ID: 1147357675

View in Genome Browser
Species Human (GRCh38)
Location 17:39910512-39910534
Sequence ACAGCTAGTAAGTGTAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 1, 2: 18, 3: 83, 4: 306}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147357670_1147357675 29 Left 1147357670 17:39910460-39910482 CCATGTAAAGATACTGAGGCTTA 0: 1
1: 0
2: 0
3: 28
4: 229
Right 1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG 0: 1
1: 1
2: 18
3: 83
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147357675 Original CRISPR ACAGCTAGTAAGTGTAGAGC TGG Intronic
901840911 1:11953432-11953454 ACAGCTAGTAAATGGTGAGCTGG - Intronic
903212689 1:21827684-21827706 CCAGCCAGTAAGTGTGGGGCAGG + Intronic
903440129 1:23381592-23381614 ACAGCTAATAATGGCAGAGCTGG - Intronic
903953063 1:27007349-27007371 ACAGCTGGTGAATGCAGAGCTGG + Intronic
903993737 1:27291787-27291809 ACTGCTAGTAAGTGCAGAGCTGG - Intronic
904017543 1:27434386-27434408 ACATCTAGAAATTTTAGAGCTGG - Intronic
904475107 1:30759840-30759862 ACAGCTACTAAGTGGGGAGCTGG - Intergenic
904481842 1:30798776-30798798 ACAGCAAGTCAGTGCAGAGATGG + Intergenic
904483017 1:30805832-30805854 ACAGCTGCTAAGGGTAGAGTTGG - Intergenic
905211627 1:36378309-36378331 ACAGCCAGTAAGGGCAGAGCTGG - Intronic
905394528 1:37658338-37658360 ACACCCAGTAAGTGAGGAGCTGG - Intergenic
905561085 1:38927905-38927927 ACAGCTAATAAGGGGAGGGCTGG + Intronic
905646947 1:39631758-39631780 ACAGCAAGAAAGCGCAGAGCTGG + Intronic
906289130 1:44608482-44608504 ACAGCTACAAAGTTCAGAGCAGG - Intronic
907199057 1:52710440-52710462 ATGGCTAGTAAATGTGGAGCTGG + Intergenic
907799964 1:57754774-57754796 ACAGCTAGTGAGAGCAGAGCTGG + Intronic
907811159 1:57871449-57871471 ACAGCTAGTAAGCTTAGAGCTGG + Intronic
907837434 1:58123652-58123674 ACAGCTAGTAAGGGCACACCAGG - Intronic
908400667 1:63770246-63770268 ACAACTATTAAGAGCAGAGCAGG + Intergenic
908699785 1:66886646-66886668 ACTGGTAGTAAGTGTGGAGAAGG + Intronic
911231002 1:95361709-95361731 ACAGCTACTAAGTGACTAGCAGG - Intergenic
911532015 1:99054255-99054277 TCAGTTAGTAATTGCAGAGCTGG - Intergenic
912454531 1:109788778-109788800 ACGGCTGGTAGGTGCAGAGCTGG + Intergenic
912702848 1:111891070-111891092 ATGGCTAGTAAGTGGAGAGCTGG - Intronic
913283130 1:117204363-117204385 CCAGCTAGGAAGTGGAGAGCTGG + Intronic
913572088 1:120130921-120130943 ACAGCTAGAATGTGCAGAGATGG + Intergenic
914293011 1:146292557-146292579 ACAGCTAGAATGTGCAGAGATGG + Intergenic
914554055 1:148743340-148743362 ACAGCTAGAATGTGCAGAGATGG + Intergenic
915232842 1:154458603-154458625 ACAGCTAGTAAGAATAGGCCAGG + Intronic
916100382 1:161389173-161389195 ACAGAAAGTAAATGTAAAGCAGG + Intergenic
916540352 1:165747754-165747776 CAAGCTAGTAAATGTTGAGCTGG - Intronic
916744709 1:167676186-167676208 AGAACTAGTAAATGTAGAGCTGG + Intronic
917338209 1:173947286-173947308 ACTGATAGTAAATGGAGAGCAGG + Intronic
917449086 1:175131819-175131841 ACAACTAGTAAGTATAGAACTGG + Intronic
917736406 1:177924855-177924877 ACAGCTAGTAAGGATGGAGCTGG - Intronic
918565481 1:185925623-185925645 GAATCTGGTAAGTGTAGAGCGGG + Intronic
919930831 1:202220617-202220639 ACAGCTAGTGAGTGTTGTCCTGG + Intronic
919974449 1:202601751-202601773 ACAGCCAGGCAGTGTGGAGCTGG + Intronic
920196356 1:204229861-204229883 ACAGCTATTAAGTACAGAGCTGG - Intronic
920546758 1:206824630-206824652 AGAGCTAGTAAGAGTAGGGGAGG + Intronic
921734706 1:218613764-218613786 ACAGCAAATAAGTATAGAGGAGG - Intergenic
923295166 1:232587605-232587627 ACAGCTAGTAAGTACAGTGTGGG - Intergenic
924143507 1:241050215-241050237 ACAGCCAGTATGTGTAGATCAGG + Intronic
1063391333 10:5651629-5651651 ACACCTAGTAAGCACAGAGCAGG + Intronic
1063970359 10:11377417-11377439 ACAGCTAGTGCATGCAGAGCTGG - Intergenic
1067744147 10:48922314-48922336 ACAGCTACTAAGTGACGAACAGG - Intronic
1068918946 10:62463190-62463212 ACAGCTAGAAACTGTGGGGCAGG + Intronic
1069944074 10:71973979-71974001 ACAGCCAGTAAGTGGGGAGTTGG - Intronic
1070089239 10:73268641-73268663 AGAGCTAGTTAGGGGAGAGCTGG + Intronic
1070575432 10:77673659-77673681 CCAGCTAATAAATGCAGAGCAGG - Intergenic
1070646087 10:78203405-78203427 AGAGCTGGTCAGGGTAGAGCAGG - Intergenic
1070916792 10:80160360-80160382 ACAGCTAGTAACAGCTGAGCTGG - Intronic
1071633466 10:87232937-87232959 ACAGCTTGTCAGTGTAGCTCAGG - Exonic
1071646913 10:87365155-87365177 ACAGCTTGTCAGTGTAGCTCAGG - Exonic
1072460065 10:95610589-95610611 AAAGCTAGCAGGTGTACAGCTGG - Intronic
1072829708 10:98644844-98644866 ACAGCTTGTAAGGGTAAAACTGG - Intronic
1073461136 10:103666606-103666628 AGAGCTAGTAAGGGCAAAGCAGG - Intronic
1073922411 10:108474101-108474123 ACACATAGTAAGTAGAGAGCTGG - Intergenic
1075363115 10:121857874-121857896 ACAGCTAGAAAGTGAAGTGATGG - Intronic
1075555834 10:123431210-123431232 ACAGCTAGCAAGTAGGGAGCTGG - Intergenic
1077461956 11:2715222-2715244 ACAGCTAGAAAGTGGCCAGCTGG + Intronic
1078901636 11:15648125-15648147 ACAGCTAGAAAGTCCAGACCAGG + Intergenic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1080083119 11:28245181-28245203 ACAGTGAGTAAGGGTAGAGCTGG - Intronic
1080347818 11:31344481-31344503 ACAGCTTGTAAGTGGGCAGCAGG - Intronic
1080615832 11:33943984-33944006 ACAGCGAGGAGGTGCAGAGCTGG - Intergenic
1081525649 11:43925753-43925775 TCAGCTAGAAAGGGCAGAGCTGG - Intronic
1082650558 11:55786726-55786748 ACAGCTTGTTAGTGATGAGCTGG - Intergenic
1083007975 11:59366887-59366909 ACAGCTAGTAAGTGAAGGGGTGG + Intergenic
1084907870 11:72362570-72362592 ACAGTCAGTAAGTTCAGAGCTGG - Intronic
1085044413 11:73344777-73344799 ACAGCCAGTAAGGGCAGTGCTGG + Intronic
1085200909 11:74701576-74701598 ACAGCCAGTAAGTGGAGGACGGG - Exonic
1085260177 11:75200102-75200124 ACAGCCAGTTGGGGTAGAGCTGG - Intronic
1085272683 11:75279548-75279570 ATAGTTAGTAAGAGGAGAGCTGG - Intronic
1085417251 11:76327706-76327728 ACAGCAAGTTAGTGAAGAGCTGG + Intergenic
1085833875 11:79931583-79931605 ACAGCTAATAAAGGGAGAGCTGG + Intergenic
1086162832 11:83742523-83742545 ACAGCCAGAAAGTGCAGAGGTGG - Intronic
1086798916 11:91146012-91146034 ACAACTATGAAGAGTAGAGCTGG - Intergenic
1087677335 11:101178279-101178301 ACAGCTGGTAAGATGAGAGCTGG - Intergenic
1088556365 11:111065368-111065390 ACAAGTAGAAAGTGCAGAGCTGG - Intergenic
1089306464 11:117529497-117529519 ACAACTAGTGAGTGTTGAGGCGG + Intronic
1090047898 11:123351806-123351828 ACAGCGAGTAAGAGCAGAGTGGG - Intergenic
1092155141 12:6277307-6277329 ACAGCTAGGAAATATAGTGCAGG - Intergenic
1093446381 12:19264258-19264280 ACAGCTAGTTAGTGTTAGGCAGG + Intronic
1093771743 12:23026026-23026048 ACAAGTAGTAAGTGGTGAGCTGG + Intergenic
1093844673 12:23955069-23955091 AAAACTAGTAAGTGCAGGGCTGG + Intergenic
1094184257 12:27624327-27624349 ATAGCTAGTAAGAGTAGATATGG + Intronic
1095289354 12:40459533-40459555 AGAGCTAGGAAGTGTAGTGAGGG - Intronic
1097393632 12:59046348-59046370 ACAGCTGGAAAGTGGAGAGCTGG - Intergenic
1098574329 12:72024005-72024027 ACAGTTAATAAGTGTTGATCTGG + Intronic
1098969753 12:76839287-76839309 ACTGCTAGTACAGGTAGAGCAGG + Intronic
1099351239 12:81571502-81571524 ACAACTTGTAAGTGAAGAGCTGG - Intronic
1100245868 12:92756449-92756471 ACTGCCAGTAATTGAAGAGCAGG + Intronic
1100545172 12:95595056-95595078 ACATCTAGTAAGTGCAGAGCAGG + Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1101806148 12:108065561-108065583 ACAGCTAGAAAGAGCAGAGCTGG - Intergenic
1101846154 12:108364731-108364753 ACAGCTAGTATGTGAGGAACCGG + Intergenic
1102468575 12:113145501-113145523 AAAGCTATTAAGAGTAAAGCTGG - Intergenic
1102619723 12:114184339-114184361 ACAGCTAGTCAGGGCAGAGCTGG - Intergenic
1102919483 12:116781124-116781146 ACAGCTAGTCAGTGCAGAGCTGG - Intronic
1103559061 12:121782785-121782807 ACAGCCAGTGAGGGCAGAGCTGG - Intronic
1107070206 13:36260169-36260191 GCAGCTAATAATGGTAGAGCTGG + Intronic
1107294626 13:38896040-38896062 ACAGCTAGAATGTGCAGAGAAGG - Intergenic
1108252710 13:48582932-48582954 ACAGCTGGGAAGTATAGAGATGG - Intergenic
1108790196 13:53960906-53960928 ACATCTTGGAAGTGAAGAGCAGG + Intergenic
1108841758 13:54626502-54626524 ACCGCTTTTAAGTGAAGAGCAGG + Intergenic
1110032848 13:70638933-70638955 ACAGCTAGTATGTGTAGTGGAGG + Intergenic
1110445528 13:75575642-75575664 ATATCTGCTAAGTGTAGAGCTGG + Intronic
1110541823 13:76714424-76714446 ACACCTAGTTAGTGCAGAGATGG + Intergenic
1111524466 13:89450891-89450913 ACAGGGAGTAAGTATAGATCTGG - Intergenic
1114168677 14:20248736-20248758 ATAGCTAGTTGGTGTTGAGCTGG - Intergenic
1114480935 14:23034199-23034221 AGAGCTAGTTATTGCAGAGCTGG + Intronic
1115274097 14:31587272-31587294 ACAGTTAATAAGTGAAGAGTTGG - Intronic
1115298295 14:31855836-31855858 ATAGCTAGTAAGAGATGAGCTGG - Intronic
1115885774 14:37970161-37970183 AGAGCTAGTAAGATTAGAGAAGG - Intronic
1117281324 14:54243993-54244015 GCAGCTAGTAATGGTAGAGGTGG - Intergenic
1117507115 14:56415033-56415055 CCAGATAGTAAGTGAGGAGCTGG + Intergenic
1117702086 14:58424406-58424428 ACAGATAGTAACTGGACAGCTGG + Intronic
1119255837 14:73195471-73195493 ATAGCTAGTAAGTGATGAGTAGG - Intronic
1119408971 14:74416939-74416961 ACAGCTGGTGAGTGGGGAGCTGG + Intronic
1120120068 14:80668210-80668232 ACAGCTGCTATGTGAAGAGCTGG + Intronic
1121201145 14:92119427-92119449 ATAGCTATTAAGTACAGAGCTGG + Intronic
1121340171 14:93100280-93100302 ACAGCTGGTAGGGGCAGAGCTGG - Intronic
1121719047 14:96096607-96096629 ACAGAAAGTAAGTGTGGGGCTGG + Intergenic
1122937526 14:104966971-104966993 CCAGCCAGTAGGTGTGGAGCTGG + Intronic
1123783928 15:23649968-23649990 ACAGCTACTAAGTGAATAACAGG - Intergenic
1128428825 15:67571762-67571784 ACAGCTAGTCAATAGAGAGCTGG + Intronic
1128536844 15:68498071-68498093 ACAGCTAGAAAGGGCAGAGCTGG + Intergenic
1128620758 15:69147629-69147651 ACATTTAGTAAGAGCAGAGCTGG + Intergenic
1128666823 15:69544457-69544479 CCCGCTAGCAAGTGCAGAGCTGG + Intergenic
1129788847 15:78327281-78327303 ACAACTAGTTAATGTGGAGCTGG + Intergenic
1130006876 15:80107993-80108015 ACAGCTAGTAAGTGAGGAGCTGG - Intronic
1130169171 15:81494165-81494187 ACAGCTGATAAGAGTGGAGCTGG + Intergenic
1131304421 15:91228988-91229010 ATAGCTCGTAAGTGTTGAGCAGG + Intronic
1131433257 15:92403220-92403242 ACAGCTAGTAAACATGGAGCTGG + Intronic
1131530245 15:93184803-93184825 ACAGCTAGTGAGTGGAAAGGTGG + Intergenic
1132771033 16:1563549-1563571 CCAGACAGTAAGTGTGGAGCTGG + Intronic
1133197099 16:4178806-4178828 ACAGCTGTTAAGAGGAGAGCTGG - Intergenic
1133614856 16:7466607-7466629 ACAGCTAGTGAGTGCAGAGCTGG - Intronic
1133710975 16:8400862-8400884 AAATGTAGTAAGTGTAGGGCTGG - Intergenic
1133753259 16:8741401-8741423 ACAGCTAGCAAGTGGTTAGCAGG - Intronic
1133909657 16:10053424-10053446 CCAGCTAGCAAGAGAAGAGCTGG + Intronic
1134506224 16:14809479-14809501 ACAGCTAGTGAGTGGAGAGTTGG - Intronic
1134574328 16:15319285-15319307 ACAGCTAGTGAGTGGAGAGTTGG + Intergenic
1134625254 16:15718590-15718612 ACAGCCAGGAAGTGGACAGCCGG + Intronic
1134728089 16:16437013-16437035 ACAGCTAGTGAGTGGAGAGTTGG - Intergenic
1134782970 16:16915641-16915663 ACAGCTGGTAAGAGCAGAGCCGG + Intergenic
1134939347 16:18274813-18274835 ACAGCTAGTGAGTGGAGAGTTGG + Intergenic
1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG + Intronic
1136074895 16:27810306-27810328 CCAGCTAGTATTTGTAGAGACGG - Intronic
1137310339 16:47250771-47250793 AGAGCTAATTAGTGTTGAGCAGG + Intronic
1137897669 16:52231812-52231834 ACAGGTAATAAGTGGTGAGCTGG - Intergenic
1137980238 16:53063264-53063286 ATAGCTAGGAAGTGATGAGCTGG + Intronic
1138581676 16:57945684-57945706 CCTGCCAGTAAGCGTAGAGCTGG - Intronic
1138773535 16:59693104-59693126 ACAGCTAGTACTTACAGAGCTGG - Intergenic
1140441785 16:74993461-74993483 GCAGCTAGTAAGAGCAGAGCTGG - Intronic
1140746974 16:77989083-77989105 CCAGCTAGTAACTATACAGCTGG - Intergenic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141049210 16:80745440-80745462 ACAGCTAGTAAGTGTCAGGCTGG - Intronic
1144446547 17:15335199-15335221 AAAGCTAGAAATTGTAGAGCAGG + Intronic
1144623647 17:16833553-16833575 ACAGCTGGTAAGGGCAGAGCAGG - Intergenic
1144882782 17:18439163-18439185 ACAGCTGGTAAGGGCAGAGCAGG + Intergenic
1145016948 17:19405276-19405298 ACAGCTATTAATGGCAGAGCTGG - Intergenic
1145149449 17:20505223-20505245 ACAGCTGGTAAGGGCAGAGCAGG - Intergenic
1145746900 17:27326807-27326829 ACAGCAAGTTAGTGCAGAGCTGG + Intergenic
1145853862 17:28133322-28133344 AGAGCTAGTAAGTGTGGGGATGG + Intronic
1146176893 17:30670880-30670902 ACAGCTAATAACTGTGAAGCCGG - Intergenic
1146269625 17:31476547-31476569 ACAGGTAGTAATAGCAGAGCTGG + Intronic
1146350356 17:32086980-32087002 ACAGCTAATAACTGTGAAGCTGG - Intergenic
1146576163 17:33993581-33993603 ACAGCTATGAATTCTAGAGCTGG - Intronic
1147357675 17:39910512-39910534 ACAGCTAGTAAGTGTAGAGCTGG + Intronic
1147577978 17:41613485-41613507 ACAGTTGGTAAGGGCAGAGCAGG - Intronic
1148336286 17:46843634-46843656 CCAGCTAGTAAGCTTAGAACCGG - Intronic
1148878510 17:50707505-50707527 ACGGCTGGTAAGTGGGGAGCGGG - Exonic
1149124704 17:53214281-53214303 ACAACTAGTCAATGTAGAGAGGG + Intergenic
1149658749 17:58323858-58323880 ACAGTTATTGAGTGCAGAGCAGG - Intronic
1150158324 17:62872532-62872554 ACAGCCAGTAAATGGGGAGCTGG - Intergenic
1152369404 17:79877193-79877215 ACAGCCAGTAACAGTAGGGCAGG - Intergenic
1152879096 17:82805266-82805288 ACAGCAAGTAGGCGTAGAGCAGG + Intronic
1153456858 18:5292547-5292569 ATAGCTATTTAGTGAAGAGCTGG + Intronic
1153572020 18:6483082-6483104 ACAGCCAGTAAGTCTAGGACGGG - Intergenic
1153656847 18:7290480-7290502 TCAACTAGTAGGTGCAGAGCTGG - Intergenic
1155132235 18:22949143-22949165 ACAGCTGGTAAATGAAGAGCTGG + Intronic
1155874271 18:31065508-31065530 ACAGCTAGTAAGGATAGAGCCGG + Exonic
1156859401 18:41818526-41818548 ACAGCTAGAGAGTTTAAAGCAGG - Intergenic
1157271917 18:46282819-46282841 ACAGCTGGTAAGGGCGGAGCAGG - Intergenic
1160318680 18:77870326-77870348 TCGGCTAGAAAGTGTGGAGCAGG - Intergenic
1160918985 19:1510975-1510997 ACAGCCAGTCAGGGCAGAGCCGG - Exonic
1162981925 19:14246030-14246052 ACAGCTAATAACTGTGAAGCCGG + Intergenic
1164527424 19:29022383-29022405 ACAGCTGGTAAGGGTGGGGCTGG + Intergenic
1166664141 19:44667078-44667100 ACAGCCATTCAGTGTATAGCTGG + Intronic
1166710174 19:44931752-44931774 ACAGCCAGGAAGTGGAGAACTGG + Intergenic
1167698296 19:51027441-51027463 GCAGCCAGTAAGTGAACAGCTGG - Exonic
925664050 2:6234181-6234203 GCAGGCAGTAAGTGCAGAGCCGG + Intergenic
925981322 2:9179837-9179859 ACAGCTAGCAAGTGCCTAGCTGG + Intergenic
926051873 2:9750299-9750321 ACAGCAAGTACCTGCAGAGCTGG - Intergenic
926454260 2:13044739-13044761 ACAGCTAATAAGTGAAGCGAAGG + Intergenic
926694135 2:15758841-15758863 ACAGCCAGCAAGAGCAGAGCTGG - Intergenic
928406596 2:31019721-31019743 ACAGTGAGTGAGTGCAGAGCTGG - Intronic
928612872 2:33007921-33007943 ACAGCTAGTCAGTGTTGAGCTGG + Intronic
929661283 2:43787353-43787375 ACAGCTACGAAGTGTACAACTGG - Intronic
930538346 2:52672037-52672059 AAAGCTGGGAAGTGGAGAGCTGG - Intergenic
930693625 2:54389410-54389432 ACTGCAAGTCAGTGTAGACCTGG + Intergenic
931014548 2:57961484-57961506 ACAGCTAGGAAATGTAGATTTGG + Intronic
931922319 2:67034223-67034245 TCAGCTAGCAAGAGCAGAGCTGG + Intergenic
932306748 2:70709225-70709247 ACCGCTGGTAAGTGTGGTGCTGG - Intronic
932515092 2:72338110-72338132 AGAGCTACTAAGTGGAAAGCTGG - Intronic
932850689 2:75181984-75182006 AGAGCTAGTCAGTTTAGAGCTGG + Intronic
932867070 2:75354948-75354970 ATAGTTAGTAAGTGTGGGGCAGG - Intergenic
933247363 2:79990497-79990519 ACAGCTAGTAAGTGGAGGAGTGG - Intronic
935211214 2:100940719-100940741 ACAGCCAGACAGTGAAGAGCTGG + Intronic
935629859 2:105204480-105204502 ACAACTAGTAAGGGCTGAGCTGG - Intergenic
936254363 2:110898704-110898726 ACTGCTATTCAGTGTAGTGCTGG + Intronic
936594665 2:113836407-113836429 GTAGCTAGTAAGTGAAGAGCTGG - Intergenic
937064268 2:119005481-119005503 ACAGCTAGGAAGGGCAGAGCTGG + Intergenic
937135365 2:119547006-119547028 ACACCTGGTAAGTGGAGAGCTGG + Intronic
937355527 2:121195989-121196011 ACAGCTTGTAAGTGGAGCCCAGG + Intergenic
937433316 2:121859351-121859373 ACAGCTAGTAAGTGTTGGGTTGG - Intergenic
938015817 2:127866381-127866403 ACAGCTAGTACATGTTGAGCTGG + Intronic
938561780 2:132478893-132478915 ACATCTAGTAACTGAACAGCCGG - Intronic
941406924 2:165101468-165101490 ACAGCTAATAAGAGTAGAATTGG + Intronic
941667039 2:168252598-168252620 CCAGCTAGAAAGTGTAGTACAGG - Intergenic
941983282 2:171483834-171483856 ACAACTAGTCAGTGCAGAGGTGG + Exonic
944499612 2:200345588-200345610 AAACCTAGAAAGTGTAGACCTGG - Intronic
945197534 2:207251316-207251338 ACAGCTAGTAAGTGATGAGCCGG + Intergenic
945296573 2:208176755-208176777 TCTGCTTGTAAGTGTGGAGCTGG + Intronic
945941613 2:215956991-215957013 ACAGCAGGTAAGTGAAAAGCTGG + Intronic
946109699 2:217403758-217403780 AAAGCTAGTAAGTGCAGAGCTGG + Intronic
946900075 2:224363851-224363873 ACAACTAGTAAGTGGAGCCCTGG - Intergenic
947019236 2:225656326-225656348 ACAGCTATTAAGTATACAGAAGG - Intergenic
947433847 2:230055101-230055123 ACAGCCAGTAAGTGTAGAACTGG - Intronic
948332814 2:237183435-237183457 AGCACTAGTAAGTGGAGAGCCGG - Intergenic
948473347 2:238200967-238200989 ACAGTTAGTAAGCGAAGAGCTGG + Intronic
1169594915 20:7187664-7187686 ACATCTAATGAGAGTAGAGCAGG - Intergenic
1172195881 20:33091120-33091142 ACAGCTAATAAATGTGGACCTGG + Intronic
1172772667 20:37390800-37390822 ACAGCCAGCAAGTGGTGAGCTGG + Intronic
1172900522 20:38331263-38331285 ACAGTTAGTAAGTATGGAGCAGG - Intronic
1173019423 20:39254655-39254677 ACAGCAAGTAAGTGCAGAGCTGG + Intergenic
1173132854 20:40410932-40410954 ACAGCTAGTAAGGATAGAGCTGG - Intergenic
1173578589 20:44130175-44130197 ATAGCTAGTAAGTCCAGAGTTGG + Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1173955935 20:47032696-47032718 ACAGCCAGTGAGTGCAGAGGCGG - Intronic
1174563799 20:51450194-51450216 ACAGCTACTAAATGCAGATCAGG + Intronic
1174676721 20:52364622-52364644 ACAGATAGAAAATGCAGAGCAGG + Intergenic
1175744031 20:61441360-61441382 ACAGCTAGTTGGGGCAGAGCTGG + Intronic
1178500387 21:33121343-33121365 CCAGCCAGTAAGTGTAGAGCTGG - Intergenic
1182767842 22:32771497-32771519 ACAGCTAGTAGATGCAGACCTGG - Intronic
1183009370 22:34932246-34932268 GCAGCCTGTAAGTGCAGAGCTGG - Intergenic
1183042132 22:35189909-35189931 ATAGCTAGTAATGGTAGAACTGG + Intergenic
1183355509 22:37356781-37356803 ACAGCTGGTAAGTCCAGAGCAGG + Intergenic
1184769442 22:46589000-46589022 ACAGCTCGTAACTGTGGCGCTGG + Intronic
949279613 3:2330660-2330682 TCAGCTAGAAAGTGAAGAGCTGG + Intronic
949433839 3:4006837-4006859 ATAGCCAGAATGTGTAGAGCCGG - Intronic
950116407 3:10452922-10452944 ACTGCCAGTAAGTTTAGTGCAGG - Intronic
950165370 3:10793222-10793244 ACAGCTGGGAAGTGCAGGGCTGG + Intergenic
950440119 3:13005586-13005608 ACAGCTAGCAGGTGGAGAGCTGG - Intronic
950744082 3:15073221-15073243 ACAGACAGGAAGTGCAGAGCAGG + Exonic
951100200 3:18678601-18678623 AGAGCTAGTAAGTGTGGAACTGG + Intergenic
951709731 3:25575860-25575882 ACACCTAGTGAGTGCAGAACTGG + Intronic
952005980 3:28842673-28842695 ACAACTAGTAACTGCAAAGCAGG - Intergenic
952377021 3:32776313-32776335 ATACCTAGTAAGGGTAGGGCAGG + Intergenic
953419771 3:42745409-42745431 ACAGCTGGTGAGTGGAGAGCTGG + Intronic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
953781622 3:45876498-45876520 CCTGCAAGCAAGTGTAGAGCTGG + Intronic
955639974 3:61072079-61072101 AGAGCTAGAAAGTAAAGAGCTGG - Intronic
956785646 3:72640092-72640114 ACAGCTAGTAGTGGCAGAGCTGG + Intergenic
957509158 3:81165609-81165631 ATAGATGGTAAGTGTAGAGTGGG - Intergenic
961042868 3:123689545-123689567 ACAGACAGTAGGTGTAGATCTGG - Intronic
961511192 3:127404808-127404830 ACAGCTAGTGAGTATGGAGCAGG - Intergenic
962637670 3:137347359-137347381 ACACCTGGTAAGAGTACAGCTGG - Intergenic
962843159 3:139253278-139253300 ACAGCAAGTGAGAGCAGAGCTGG + Intronic
963262786 3:143209637-143209659 ACAGCTAGCTAGTGCAGTGCTGG + Intergenic
964019179 3:151986451-151986473 ATAACTAGTAAGTGCAGAGCTGG + Intergenic
964624802 3:158748780-158748802 ACAGCCAGGAAGGGTAGAGCTGG + Intronic
964894830 3:161583124-161583146 GCAGATAGTGAGTGGAGAGCTGG + Intergenic
965441959 3:168725274-168725296 ACAGCTAGCAGGTGCAAAGCTGG - Intergenic
966008052 3:175040917-175040939 ACAGCAAGTAACTGTAGACACGG + Intronic
966588987 3:181658832-181658854 GTAGCTGGTAAGTGCAGAGCAGG - Intergenic
966647131 3:182259328-182259350 ACAGCTGGTAAGTGAAGTCCAGG - Intergenic
969158657 4:5235900-5235922 AGAGCTAGTAAGTGATGGGCAGG - Intronic
969288474 4:6222932-6222954 ACAGCTAGTGAGAGAAGAGCTGG + Intergenic
969836539 4:9846971-9846993 ACAGCTTGGAAGTGGAGAGGTGG - Intronic
973324063 4:48839491-48839513 ACAGCTACTGTGTGTGGAGCTGG - Intronic
974400846 4:61403825-61403847 ACAGCTGGTACCTGGAGAGCTGG + Intronic
975433389 4:74321466-74321488 ACAGCTAGTAGGAGTGAAGCTGG - Intergenic
975777412 4:77802793-77802815 ACAGCTAGTAAGTGGCTAGACGG + Intronic
976113098 4:81698209-81698231 ACAGCTAGCAAGTGGCAAGCAGG + Intronic
976220117 4:82749979-82750001 ACAGCTAATAAACGTAGAGCTGG - Intronic
976400604 4:84602512-84602534 ACTGCTAGTTAGAGTAGAGGTGG + Intronic
976628824 4:87216993-87217015 ACAGCCAATAAGTGGAGATCTGG + Intronic
976711421 4:88075505-88075527 ACGGCTAGTACGTGAAGAGTTGG + Exonic
977577922 4:98694338-98694360 ACAGCTGGCAAGTGCAGGGCAGG - Intergenic
979297494 4:119050434-119050456 AAAGCTAGTAAGTGTTGGGGTGG - Intronic
981405202 4:144359660-144359682 ACAGCTGGTAGGTGTTGAACTGG - Intergenic
982127805 4:152199527-152199549 ACTGCTAGTAAGGGTGGAGCTGG - Intergenic
982578249 4:157145306-157145328 ACAGCTAGTAAATCCAGAACTGG - Intronic
982621707 4:157715539-157715561 ATAGCTAGTGAGAGTAGAGTAGG + Intergenic
982941940 4:161570196-161570218 ACAGTGAGTGAGTGAAGAGCAGG + Intronic
984186408 4:176548827-176548849 ATAGCTGGTAATTGCAGAGCTGG - Intergenic
984403138 4:179292695-179292717 ACAGATGGCAAGTGTACAGCAGG - Intergenic
986332095 5:6724911-6724933 ACAGCTGGTAGGTGTAAAGCAGG + Intronic
987653906 5:20781127-20781149 AGAGCTACTAAGTGTAAAACTGG - Intergenic
989749910 5:44881025-44881047 AGAACTTGTAAGTATAGAGCTGG + Intergenic
990661335 5:58018979-58019001 ACATCTAGTGAGTGTAGACTTGG - Intergenic
991924961 5:71696434-71696456 ACAACTAGTAATAGTAGGGCTGG - Intergenic
994147824 5:96414158-96414180 ACAGCTGGTAAGAGCAGAACTGG - Intronic
995070193 5:107912306-107912328 ATAGCTAGTAAGTCCAGAGCTGG + Intronic
995869276 5:116727059-116727081 ACAGCTTGTCAGTGTAGTACTGG + Intergenic
997302683 5:132817929-132817951 ACAGCTAGTAAATGCAGAGCTGG + Intergenic
997897241 5:137730164-137730186 ATAACTAGTAAGTGCAGAACTGG + Intronic
998380155 5:141718720-141718742 ACAGCTAGGAGGTGGAGTGCGGG + Intergenic
999115150 5:149156267-149156289 ACAGCTAATAAGGGTCAAGCTGG - Intronic
999131478 5:149286845-149286867 ACAACCAGTAAGTGTGGAGCTGG + Intronic
999273214 5:150310334-150310356 ACAGCTAGGAAGGGTGGAGCTGG - Intronic
999811117 5:155128174-155128196 CCAGCTAGCAAGTGCAGAGCTGG + Intergenic
999923642 5:156350907-156350929 ACAGCTAGTAAGTAAAACGCTGG + Intronic
1000129491 5:158282280-158282302 ACAGCTAGTAAGTGTAGAAGTGG + Intergenic
1001526077 5:172429787-172429809 ACAGCTATGACGTGCAGAGCAGG + Intronic
1002576677 5:180177837-180177859 ACAGGAAGTAAGTATGGAGCTGG + Intronic
1003638378 6:7855486-7855508 ACAGCCAGCAAGGGCAGAGCTGG - Intronic
1003963421 6:11230350-11230372 ACAGCTAGAAAGTGGTGAGCTGG - Intronic
1004473629 6:15950961-15950983 ACAGCTATTAAGTGGTGTGCTGG + Intergenic
1005027007 6:21472849-21472871 ACAACTAGTAACTGAAGAGGAGG - Intergenic
1006717230 6:36128342-36128364 ACAGCTGGTAAGGGCAGAGCTGG - Intronic
1006852583 6:37109722-37109744 ACAGCTAGTTAGGGCAGAGGTGG + Intergenic
1007812819 6:44498283-44498305 ACAGCTAGGAAGTAGGGAGCTGG + Intergenic
1007828511 6:44620035-44620057 AGAGCCAGTAAGTGCAGGGCTGG - Intergenic
1008407890 6:51139519-51139541 ACATCTGGTCAGTGCAGAGCTGG - Intergenic
1011639452 6:89405455-89405477 ATAGCTAGTAAATGGAGAGTTGG - Intronic
1012507306 6:99962202-99962224 ACAGCTACTAAGTGACTAGCAGG + Intronic
1013602067 6:111714331-111714353 ACAGCTCGTAAGTTTGGAGAGGG - Exonic
1013663612 6:112323789-112323811 ACAGATAGTAAGAGATGAGCTGG - Intergenic
1013912367 6:115292230-115292252 AGAGCTAATTAGTGTAGAGTTGG + Intergenic
1013978403 6:116101932-116101954 AGAGCTAGTAACAGTGGAGCTGG - Intronic
1015917408 6:138231421-138231443 ACCACTAGGCAGTGTAGAGCCGG - Intronic
1017529838 6:155278672-155278694 ACAGCTAGTAAGTGGGGAGATGG + Intronic
1017753756 6:157512204-157512226 ATGGCAAGTAAGTGTGGAGCCGG + Intronic
1017831543 6:158134933-158134955 TCAGCCAATAAGTGTTGAGCTGG + Intronic
1017948120 6:159113144-159113166 ACAGCTAACAAGCGGAGAGCTGG + Intergenic
1019818148 7:3216599-3216621 ACAGCTATTAAGTGTAAACTGGG - Intergenic
1019856048 7:3609369-3609391 AGAGCTAGTCAGGGGAGAGCTGG + Intronic
1021278428 7:18685380-18685402 ACACCTAGAAATTGTATAGCTGG - Intronic
1021458697 7:20860199-20860221 ACAGCTAGTCAGAGGTGAGCTGG + Intergenic
1021935563 7:25627719-25627741 ACAGCTAGTAATTGAAAACCAGG + Intergenic
1022878384 7:34560390-34560412 ACAGCTAGTCAGAGTGGGGCAGG + Intergenic
1027045052 7:74985653-74985675 ACAGTTAGTGAGGGCAGAGCTGG - Intronic
1029387803 7:100255257-100255279 ACAGTTAGCAAGGGCAGAGCTGG + Intronic
1030008274 7:105139856-105139878 ACAGTTATTAAGTTTTGAGCTGG + Intronic
1030332950 7:108292637-108292659 TCAGTTAGTAAGTGAGGAGCTGG - Intronic
1032088171 7:128894364-128894386 ACATCTAATAAGTGGATAGCTGG - Intronic
1033972906 7:147065122-147065144 ATAGCTAATAAGGGAAGAGCTGG - Intronic
1034472537 7:151263127-151263149 AGAGCTAGTAGGGGTAGAGCTGG + Intronic
1034613723 7:152396072-152396094 ACAGCTACTAAGTGTGAGGCTGG + Intronic
1035533547 8:374366-374388 ACAGCCAGTAAGTGTCTAGCAGG + Intergenic
1036436540 8:8739461-8739483 ACAGCATGTAAGTGTGAAGCTGG - Intergenic
1036780865 8:11646214-11646236 AAAGGTACTAAGTGAAGAGCTGG + Intergenic
1036797346 8:11765880-11765902 AGAGCTAGTAAGTGGAAATCAGG + Intergenic
1037348587 8:17924716-17924738 ACAGCTTTGAAGTGTGGAGCGGG + Exonic
1039799617 8:40942760-40942782 ACAGTTGTTAAGTGTAGAGCTGG - Intergenic
1041330134 8:56715364-56715386 ACAGCTATTAAGTGGTGAGCGGG - Intergenic
1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG + Intronic
1042581591 8:70285036-70285058 TCAGATGGAAAGTGTAGAGCAGG - Intronic
1042738305 8:72013329-72013351 ACAGTTCCTAAGTGTGGAGCTGG + Intronic
1042864939 8:73348929-73348951 ACGGCTAGTAAGTTTGGAGCTGG + Intergenic
1042937158 8:74071089-74071111 ACAGCTAGCAAGCATAGGGCAGG + Intergenic
1043196852 8:77305051-77305073 ACAGCTAGTAAGGATAGAGCTGG + Intergenic
1044343613 8:91076631-91076653 ACAGCTGGTAAGAGCAGAGCAGG - Intronic
1044384621 8:91572885-91572907 ACACCTAGTAAGGGAATAGCTGG - Intergenic
1044804981 8:95996919-95996941 TAAGCTACTAAGTGTTGAGCCGG + Intergenic
1045818523 8:106306830-106306852 ACAGTTACCAAGTGTAGAGTTGG - Intronic
1047162451 8:122395819-122395841 AGAGCTAGTAAATGTCGAGGCGG - Intergenic
1047286327 8:123490311-123490333 ACAGCTAGGAAGTGGTGGGCTGG + Intergenic
1047298780 8:123594803-123594825 ACAGCTAATAATGGTAGAACTGG - Intergenic
1047654611 8:126963505-126963527 GCTGCTAGTAAGTGTGGAGCGGG + Intergenic
1048743956 8:137592408-137592430 ACAGCTTGAAAGGGCAGAGCTGG - Intergenic
1051681933 9:19616415-19616437 ACAGCTAGTAAATGCAGAACTGG + Intronic
1053277685 9:36795609-36795631 ACAGCAAGCAAGTGGAGAACAGG - Intergenic
1053304169 9:36972332-36972354 ACAGCAAGTAACAGCAGAGCTGG - Intronic
1053857597 9:42354718-42354740 ATAGCTTCTAAGTGTACAGCTGG - Intergenic
1056225197 9:84488407-84488429 ATAGCTAGTGAATGTAGAGCTGG - Intergenic
1056739286 9:89239479-89239501 TCAGCTAGTAAGTACAGAGCTGG - Intergenic
1058477115 9:105347941-105347963 AGAGCTAGTAGGAGTAGAACTGG - Intronic
1058655109 9:107213157-107213179 CCAGGTGGAAAGTGTAGAGCTGG + Intergenic
1058740814 9:107940398-107940420 ACAGCTAGCAATAGCAGAGCTGG + Intergenic
1058923116 9:109637063-109637085 AAAGCTAGTAAATGTAAAGCTGG + Intergenic
1059393018 9:114011114-114011136 GCAGCTATTAAGTGTCGAGCTGG - Intronic
1060013905 9:120069669-120069691 ACAACTGGTAAGTGCAGAGCTGG + Intergenic
1060297706 9:122354620-122354642 ACAGCTAGTAAGGGCCGAGGCGG + Intergenic
1060334384 9:122707521-122707543 ACAGCTAGTGATTGTAAGGCTGG + Intergenic
1060800320 9:126540479-126540501 ACAGCTACTAAGTGACTAGCGGG + Intergenic
1060837892 9:126770963-126770985 ACAGCTAATAAATGTGGAGCTGG - Intergenic
1062085882 9:134648066-134648088 GCCGCTAGCAGGTGTAGAGCAGG + Intronic
1187993496 X:24901049-24901071 ACAGCCAGTAGGTATACAGCAGG + Intronic
1188046883 X:25435673-25435695 ACAGCTAGAAAGTGGAAAGTGGG - Intergenic
1188415158 X:29924004-29924026 ACAGCTAGTAAGAACAGAGTTGG - Intronic
1188464009 X:30457675-30457697 TCACTTAGTAAGTGTGGAGCCGG - Intergenic
1190095778 X:47479249-47479271 ATAGCTAGTAAGTGCCAAGCAGG + Intronic
1190522197 X:51291882-51291904 ACAGCTGGGAAGTGCAGAGCTGG - Intergenic
1190525424 X:51324991-51325013 ACAGCTCGGAGGTGCAGAGCTGG - Intergenic
1190544053 X:51506635-51506657 ATGGCTAGGAAGTGCAGAGCTGG + Intergenic
1191869565 X:65734456-65734478 ACAGCTAAAAATGGTAGAGCTGG + Intronic
1192019394 X:67369205-67369227 ATAGCTAGTAATGGTAGTGCTGG - Intergenic
1192232605 X:69276373-69276395 ACAGCTAGTAATGGCAGAGCTGG + Intergenic
1195990089 X:110673664-110673686 ACGGCTGGTAAGTACAGAGCTGG + Intergenic
1196123635 X:112077159-112077181 ACAGCTAGTAATTCGTGAGCAGG + Intronic
1196712955 X:118782374-118782396 TCAGCTAATAAGTGTAGAAATGG - Intronic
1196991962 X:121339713-121339735 ACAGCTATTAAGTGCAGAGTTGG + Intergenic
1198581097 X:138065437-138065459 ACAGCTAGTAAGAACAGAGCTGG + Intergenic
1198744662 X:139877522-139877544 ACACCTAGTATCAGTAGAGCTGG + Intronic