ID: 1147358783

View in Genome Browser
Species Human (GRCh38)
Location 17:39918336-39918358
Sequence CCAAAGGTAGGATGGGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 445}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147358783_1147358795 12 Left 1147358783 17:39918336-39918358 CCACTTCCCCATCCTACCTTTGG 0: 1
1: 0
2: 2
3: 46
4: 445
Right 1147358795 17:39918371-39918393 ATATCCCTTCTGCCCAGCACAGG 0: 1
1: 1
2: 1
3: 27
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147358783 Original CRISPR CCAAAGGTAGGATGGGGAAG TGG (reversed) Intronic
900092610 1:926946-926968 CCTGAGGTAGGATGGGGGAGGGG + Intronic
900928581 1:5721320-5721342 CCAAAGGTGGGAGGAGGTAGAGG + Intergenic
901173800 1:7283991-7284013 CCACAGGTAGGGAGAGGAAGAGG - Intronic
902558473 1:17260976-17260998 CCAAAGGCAGGATAGGGAGCAGG - Intronic
903189865 1:21650542-21650564 CCAGAGGTAAGAAGGGGATGAGG + Intronic
903332970 1:22606363-22606385 CCATGGGGAGGATGGGGAAGTGG + Intergenic
903524196 1:23980394-23980416 GCGGAGGTAGGAGGGGGAAGTGG - Intronic
903886799 1:26545653-26545675 CCACAGGGAGGATGGGGGAACGG + Intronic
904880762 1:33695108-33695130 GCAAGGGTAGGATGGGAAGGAGG + Intronic
904935582 1:34127531-34127553 CCACAGGTAGGAGGAGGATGTGG + Intronic
905169605 1:36101547-36101569 CCACAGCTGGGAAGGGGAAGGGG - Intronic
906319432 1:44807231-44807253 CCAAAGGCAGAAGGTGGAAGGGG - Intergenic
906520454 1:46464112-46464134 CCCAAGGGAGGAGGGAGAAGAGG - Intergenic
906746899 1:48228493-48228515 CCAAAGGAAGGAAGCTGAAGGGG - Intronic
907046577 1:51303446-51303468 CTACAGGGAGGCTGGGGAAGGGG - Intronic
908042708 1:60132210-60132232 GCAAAGGTTGGAAGGAGAAGAGG + Intergenic
908120147 1:60978745-60978767 CTAGAGGTAAGATGGGGCAGAGG + Intronic
910299232 1:85686801-85686823 CCAGAGGTAGGATGGGGGAGAGG + Intronic
911086193 1:93979318-93979340 AGCAAGGTAGGATGGAGAAGGGG - Intergenic
911121290 1:94299750-94299772 CCAGAGGGAGGAAGGGGAGGGGG + Intergenic
913120803 1:115738885-115738907 CCAAAAGCAGGATGGGGTGGGGG - Intronic
913227416 1:116712513-116712535 CCAAAGTTAGCTTGGGGAAGGGG + Intergenic
914764311 1:150624511-150624533 CCAGAGGTAGGCTGGGAAAGTGG + Intronic
915238186 1:154501478-154501500 CCCCAGGGAGGAAGGGGAAGAGG + Exonic
915321668 1:155059969-155059991 TCAAAGGTAGCATGGGGGTGGGG + Exonic
915552847 1:156645210-156645232 CAAAAGGTAGGGTGGGGGAAGGG + Intronic
917314827 1:173713782-173713804 TCAAAGGTAGTCTGGGGAAAGGG - Intergenic
917470464 1:175322186-175322208 GCAAAGGTAGGAGGGGGAGATGG - Exonic
917472368 1:175336737-175336759 CCCCAGGAAGAATGGGGAAGGGG + Intronic
917611360 1:176692226-176692248 CCATAGGTGGAATGGGGATGGGG - Exonic
918102128 1:181385676-181385698 CAAAAGGAAGGAAGGGGTAGGGG - Intergenic
918625835 1:186654972-186654994 ACTAAGGTAGAATGAGGAAGAGG + Intergenic
919775925 1:201194028-201194050 CCAAAAGTAGGAGCGAGAAGGGG + Intronic
919845504 1:201639773-201639795 CCCAAGCTGGGATGGGGACGGGG - Intronic
920170340 1:204068196-204068218 ATAAAGGTGGGATGGGGTAGAGG + Intergenic
920865328 1:209747745-209747767 CCAAAGGGAGGCCGGCGAAGAGG - Intergenic
922130929 1:222777153-222777175 CCAAAAGAAGGAAGGGTAAGAGG - Intergenic
922173693 1:223178435-223178457 CCAAGGGGAGGCTGGGGAGGAGG + Intergenic
922272233 1:224044108-224044130 CCAGGGGTGGGATGAGGAAGAGG + Intergenic
922658488 1:227407423-227407445 GGAAGGGTGGGATGGGGAAGAGG + Intergenic
923186115 1:231575144-231575166 CAAAAGGGAGGGTGGGGAGGAGG - Intronic
924079881 1:240384143-240384165 CCAAAGGTGGGAAGAGGAAGAGG + Intronic
1062858908 10:794610-794632 CCAGAGGTGGGGTGGGGAGGAGG - Intergenic
1062870947 10:903800-903822 CAAAGAGTAAGATGGGGAAGTGG + Intronic
1063016165 10:2079863-2079885 GCAAAGGCAGGAGGGGGAGGAGG + Intergenic
1064122112 10:12628790-12628812 CCAAAGATTGGAAGGAGAAGGGG - Intronic
1064439333 10:15339685-15339707 ACAAAGGTGGGAAGGGAAAGGGG - Intronic
1064598857 10:16973204-16973226 GCAAGGGAAGGATGGGGAAATGG - Intronic
1065768483 10:29054440-29054462 GGAAAGGTTGGATTGGGAAGGGG + Intergenic
1065864296 10:29900426-29900448 CCTAAAGTAGTTTGGGGAAGGGG - Intergenic
1066998165 10:42582504-42582526 ACAACTGTAGGGTGGGGAAGAGG + Intronic
1067216151 10:44305600-44305622 CCAGAGGCAGGAAGGGGAAGAGG + Intergenic
1067703364 10:48589324-48589346 CCAGAAGCAGGCTGGGGAAGCGG - Intronic
1068835111 10:61544714-61544736 CCAAAGCTAGCTTGGGGAAGAGG + Intergenic
1069200470 10:65608726-65608748 CCAAAAGGAGGAAGGGGAAAGGG + Intergenic
1069264660 10:66443091-66443113 CCACAGGGAGGCTGGGGGAGGGG + Intronic
1069560265 10:69424269-69424291 CTAAAGGAAAGAAGGGGAAGTGG - Intergenic
1069820230 10:71222965-71222987 CCAAAGGTGGGATAGGGATGGGG - Intronic
1070732621 10:78841816-78841838 CCACAGAAAGGTTGGGGAAGAGG + Intergenic
1070787037 10:79167947-79167969 CCAAGGCTAGGAGGGAGAAGAGG + Intronic
1070954097 10:80453697-80453719 TCAAAAGAAGGATGGGGAAAAGG - Intergenic
1071087084 10:81876259-81876281 CCAAACCTGGGATGGGGGAGGGG - Intronic
1072914713 10:99530816-99530838 CCGGAGGTGGGGTGGGGAAGTGG + Intergenic
1073711876 10:106052663-106052685 CCAAAGATAGATAGGGGAAGAGG - Intergenic
1074170551 10:110930852-110930874 TAAAAGGCAGGATAGGGAAGAGG - Intronic
1074495633 10:113977928-113977950 CCAGAGAAAGGATGGGAAAGGGG - Intergenic
1074898851 10:117799759-117799781 CCTATGGTGGGATGGGGAACTGG - Intergenic
1075074745 10:119343198-119343220 CCAAGGGCGGGGTGGGGAAGGGG + Intronic
1075102096 10:119513690-119513712 GCCAAGGTAGGATGAGGAATGGG - Intronic
1075550711 10:123390637-123390659 TCAAAGATAGGCTGGGGATGGGG - Intergenic
1076499284 10:130923697-130923719 CCCAAGGGTGGATGGGGAAGGGG - Intergenic
1077107058 11:846726-846748 CCCAAGGCAGGGTGGGGTAGGGG + Intronic
1077888392 11:6402474-6402496 CCACAAGCAGGCTGGGGAAGGGG - Intronic
1078058912 11:8031261-8031283 CAAGAGGTAGGATTGGGAAGTGG + Intronic
1078133855 11:8636264-8636286 TCAAAGGCAGTTTGGGGAAGGGG - Intronic
1078359818 11:10659411-10659433 GAAAAGGGAGGATGAGGAAGTGG + Intronic
1078970898 11:16409997-16410019 CCAGAGGTTGGGTGGGGATGGGG + Intronic
1079102656 11:17551523-17551545 CCAAAGGAAGGTTGGGGTGGGGG + Intronic
1079782481 11:24625170-24625192 CCAGGGGTGGGTTGGGGAAGGGG + Intronic
1080178081 11:29391671-29391693 CCAAAGGTATGATGGGCTTGAGG + Intergenic
1080268668 11:30427079-30427101 TAAAGGGTAGGATGGGGAAGAGG - Intronic
1080596147 11:33775442-33775464 CCAAAGGTAGTATGGTGTAAGGG + Intergenic
1080798353 11:35586828-35586850 CCAAAGGGAGGATGGGTAGAGGG + Intergenic
1080948227 11:36998844-36998866 CCAAAGGTTGGCAGGGGCAGTGG - Intergenic
1081860605 11:46331517-46331539 CCATAGGCAGGACAGGGAAGGGG + Intergenic
1082632705 11:55560354-55560376 ACAAAGGGAGGATGTGAAAGAGG - Intergenic
1082777625 11:57259657-57259679 CCAAAGGGAGAAGTGGGAAGAGG - Intergenic
1083488191 11:62996517-62996539 CCCAAGGAAGGCTGGGGAGGTGG - Intronic
1083792381 11:64994368-64994390 TCAAAGGTGGGATGGAGAAGAGG + Intronic
1083859590 11:65412714-65412736 CCAAAGGGAGGAGGGTGAACAGG - Exonic
1084195816 11:67523268-67523290 CCTAAGGTAGGAGGGGTCAGGGG - Exonic
1084664574 11:70569524-70569546 GCAGAGGTAAGATGGGGAAGCGG - Intronic
1084679979 11:70661291-70661313 CAAAAGGTAGGAGGGGCAGGAGG + Intronic
1084736032 11:71106167-71106189 CAAAAGGGAGGCAGGGGAAGAGG + Intronic
1085126395 11:74005419-74005441 CCACAGGCAGGATGTGGTAGGGG - Intronic
1085238359 11:75032230-75032252 CCTGAGGTGGGATGGGGAAAGGG + Intergenic
1086276191 11:85132751-85132773 ACAAAGGTAGGATAGGAAACAGG - Intronic
1087048180 11:93861871-93861893 CCAAAGTGAGGATGGGGCAGGGG + Intergenic
1088973659 11:114795549-114795571 CCAAAGCAAGGATGGGCAACAGG - Intergenic
1089537230 11:119168442-119168464 CTGAAGGTAGGCTGGGGAGGCGG + Intronic
1089633380 11:119797101-119797123 CTAAAGAGAGGATGGGGAATGGG - Intergenic
1089647467 11:119889679-119889701 CCAGAGGGAGGATGGGTATGGGG - Intergenic
1089660840 11:119984018-119984040 CCCAGGGTAGGCGGGGGAAGGGG - Intergenic
1090248504 11:125234972-125234994 TGAAAGCCAGGATGGGGAAGGGG - Intronic
1090356535 11:126144245-126144267 CCAAAGCTGGGCTGGGAAAGAGG + Intergenic
1090943753 11:131411425-131411447 TCAAAGGTAAGATGAGAAAGAGG + Intronic
1091346520 11:134857820-134857842 GCTAAGGGAGGATGGGGAGGGGG + Intergenic
1091583796 12:1804734-1804756 CAAGAGCGAGGATGGGGAAGAGG - Intronic
1093960421 12:25266492-25266514 CCAAAGGTAGGGTGGAGGTGGGG + Intergenic
1095235882 12:39795104-39795126 AGAAAGATAGAATGGGGAAGAGG - Intronic
1096120910 12:49089028-49089050 ACCAAGGTAGGATGGGGACCAGG + Intergenic
1096148329 12:49294236-49294258 CCTGAGGTAGGAAGGGGAGGGGG - Exonic
1096210753 12:49763739-49763761 CCCAAGCAAGGATAGGGAAGGGG + Exonic
1096976781 12:55703858-55703880 GAGAAGGAAGGATGGGGAAGGGG - Intronic
1097709962 12:62907456-62907478 CCAAAGGCAGCATGGGACAGTGG - Intronic
1098024135 12:66184980-66185002 CCAAAGACAGAAGGGGGAAGTGG + Intergenic
1098162115 12:67655871-67655893 CCAAAGGTAGGATTTAAAAGGGG + Intronic
1098227652 12:68341116-68341138 CCAAAGGAAGGATGGGAATTGGG + Intergenic
1100057258 12:90527157-90527179 GAAGAGGTAGGAGGGGGAAGAGG - Intergenic
1100057264 12:90527173-90527195 GAAGAGGTAGGAGGGGGAAGAGG - Intergenic
1100950416 12:99842676-99842698 CCAAATATAGCATGGGCAAGTGG - Intronic
1101334754 12:103786468-103786490 TCAGAGGTGGGCTGGGGAAGGGG + Intronic
1101399268 12:104373719-104373741 CAAGAGGTAGGCTGGGGATGAGG - Intergenic
1102086940 12:110149698-110149720 GCAGAGTTAGGATGGGGCAGTGG - Intronic
1102219753 12:111186488-111186510 CCTGAGGTCGGGTGGGGAAGAGG + Intronic
1102468612 12:113145760-113145782 CAAAAGGAAGGAGGGGGAGGGGG - Intergenic
1102625998 12:114235927-114235949 GAAAAGATAGGATGAGGAAGAGG + Intergenic
1103020275 12:117528443-117528465 CCCAAATGAGGATGGGGAAGGGG - Intronic
1103177183 12:118874747-118874769 CCAACAATAGGAAGGGGAAGTGG + Intergenic
1104320118 12:127742940-127742962 TCAAAGGTAATTTGGGGAAGGGG + Intergenic
1105469218 13:20676966-20676988 AGAAAGGTAGGAAGGGAAAGAGG - Intronic
1105497709 13:20945269-20945291 TCAAAGGTATGATGGAGAAGTGG - Intergenic
1106419845 13:29577152-29577174 TCAATGGTCGGATGGGGCAGGGG + Intronic
1106831356 13:33586798-33586820 CCCAAGTTAGGATGGGGCAGGGG - Intergenic
1108476290 13:50821313-50821335 CCAAAGTTAGCATGGGGTGGGGG + Intronic
1109381913 13:61573575-61573597 CCAAAGGTCAGATGTTGAAGTGG + Intergenic
1110029358 13:70586712-70586734 ACAACTGTAGGATGGGAAAGAGG + Intergenic
1110890937 13:80697223-80697245 CCTAGGGTAGGATGGGGGAAAGG + Intergenic
1110979276 13:81874958-81874980 CAAAAGGTAGGAGGGTGGAGAGG + Intergenic
1111124925 13:83902693-83902715 CAAAAGCTAGGGTGGGGTAGGGG + Intergenic
1111512858 13:89288144-89288166 CCAAAGGCTGGAAAGGGAAGTGG - Intergenic
1112264769 13:97913227-97913249 CCAGTGGGAGGATGGGAAAGAGG + Intergenic
1113171536 13:107510250-107510272 CCAAAGTTATGGAGGGGAAGAGG - Intronic
1113822101 13:113221988-113222010 CTAAAGGATGGATGAGGAAGTGG + Intronic
1114483770 14:23050908-23050930 CCAGAGACAGGATGGGGAGGAGG + Intronic
1114556591 14:23565799-23565821 CGAAAGGTGGGCTGGTGAAGGGG - Exonic
1117604445 14:57413116-57413138 CCAAGGGTGGGATGGGGTGGGGG - Exonic
1117785617 14:59281398-59281420 CCAAAGCTAGCTTGGGGAAGGGG - Intronic
1118474179 14:66101646-66101668 TCAAAGGTAGTTTGGGGATGGGG - Intergenic
1118481652 14:66173515-66173537 CCTAAGTTAAGCTGGGGAAGGGG + Intergenic
1119120411 14:72070565-72070587 CCAAAGATAGGATGGCTAAAAGG - Intronic
1119348396 14:73944632-73944654 CCAGAGGCAGGGTGAGGAAGAGG - Exonic
1120299752 14:82691571-82691593 CCAGAGGTAGGCTGGGAAAGTGG + Intergenic
1121326285 14:93021680-93021702 CCAAAGGAAGACTGGAGAAGAGG + Intronic
1121603397 14:95222797-95222819 GCAAAGGTGGGATGGTTAAGAGG + Intronic
1122293239 14:100690820-100690842 CCAAAGCTAGGGAGGGGAGGGGG - Intergenic
1124337482 15:28868197-28868219 CCCAAGGAAGGATGGGAACGCGG - Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1126655904 15:50977250-50977272 TCAAGGGTTGGATAGGGAAGGGG + Intronic
1126704839 15:51397412-51397434 CAAGAGGTAGAAGGGGGAAGGGG - Intronic
1127215391 15:56818206-56818228 CCAAAGACAGGATGGGGACCAGG + Intronic
1127270058 15:57392331-57392353 CTAGAGGGAGGTTGGGGAAGGGG + Intronic
1127475448 15:59328211-59328233 CCAAAGGTAGAATGTGAGAGTGG + Intronic
1127809376 15:62550078-62550100 TCAAATGTAGGCTGGGGTAGGGG + Intronic
1128008018 15:64263581-64263603 ACAAAGGTGGGATGCAGAAGGGG - Intronic
1128213425 15:65917660-65917682 CCCGAGTTTGGATGGGGAAGAGG - Intronic
1128648343 15:69393162-69393184 CCAAAGGTAGAGTGGGCATGTGG + Intronic
1128866760 15:71120233-71120255 CTAAAGGGAAGCTGGGGAAGGGG - Intronic
1129117742 15:73374724-73374746 CCCGAGGTGGGAGGGGGAAGAGG - Intergenic
1129460076 15:75696182-75696204 CCACAGTCAGGAGGGGGAAGGGG - Intronic
1129551951 15:76461394-76461416 ACAAATGTAGGATGAGAAAGAGG - Intronic
1129781030 15:78271362-78271384 ACAAAGGGAGGGTGGGCAAGAGG - Intronic
1130541525 15:84823703-84823725 AAAAACCTAGGATGGGGAAGAGG - Intronic
1131346734 15:91656420-91656442 CAAAGGGAAGGATGGGGAGGGGG - Intergenic
1132516754 16:369663-369685 GTAAAGTTAGGATGGGGAGGAGG - Intronic
1133972117 16:10575691-10575713 CCAAAGGAAGGCTGAGGGAGAGG - Intronic
1134787917 16:16961788-16961810 CCCCTGGGAGGATGGGGAAGAGG - Intergenic
1136995281 16:35184725-35184747 CAAAATGAAGGATGGGGAGGTGG + Intergenic
1137071849 16:35910527-35910549 CCCAAGTGAGGATGGGGAAGAGG + Intergenic
1137325339 16:47429520-47429542 ACAAATGTAAGATGGTGAAGTGG - Intronic
1137733796 16:50709566-50709588 GCATGGGGAGGATGGGGAAGTGG + Intronic
1137957973 16:52852482-52852504 CCATAGGTAGCATGGGCAGGTGG + Intergenic
1138787317 16:59863109-59863131 ACAAAAGCAAGATGGGGAAGAGG - Intergenic
1138882173 16:61030296-61030318 CTACAGGTGGGATGGGGAAAGGG - Intergenic
1139757763 16:69158778-69158800 CCAAAGGATGGGTGGGGATGAGG - Intronic
1139966197 16:70746701-70746723 CGGAGGGCAGGATGGGGAAGTGG + Intronic
1140278577 16:73533193-73533215 AAAAAGTGAGGATGGGGAAGAGG - Intergenic
1140361999 16:74352415-74352437 CCAAATGTAGGACGGGAGAGTGG + Intergenic
1140410220 16:74736695-74736717 CCTGAGGAAGGATGGGGAAGAGG + Intronic
1141140261 16:81492770-81492792 CAAGAGGCAGGATGTGGAAGAGG + Intronic
1141163737 16:81646409-81646431 CCAAAGGTAGTATGGCTCAGTGG - Intronic
1141594548 16:85089364-85089386 ACAAAGGTCTGGTGGGGAAGGGG - Exonic
1141949870 16:87333469-87333491 CCACAGGGTGGGTGGGGAAGGGG + Intronic
1142371061 16:89682612-89682634 CCAAAGGTAGTTTGGGGGAAGGG + Exonic
1142523238 17:519584-519606 GCACAGGGAGGATGGGGCAGGGG - Intronic
1142535590 17:615752-615774 AGGAAGGTAGCATGGGGAAGGGG + Intronic
1142650267 17:1345387-1345409 CAAAGGGTGGGATGGGGAGGAGG + Exonic
1143451742 17:7040851-7040873 CCACAGGGATAATGGGGAAGAGG - Intergenic
1143588239 17:7862885-7862907 CCAAAGTTAGGATGGGAAGGTGG + Intronic
1144364210 17:14526367-14526389 CCAAAGGCAGTTTGGGAAAGGGG - Intergenic
1144408350 17:14974590-14974612 CCAAAGGGAAGAGGGGGCAGGGG - Intergenic
1146403563 17:32519075-32519097 CAAACGGAAGGAAGGGGAAGAGG + Intronic
1146472149 17:33133215-33133237 CCAAAGGTGGGGAAGGGAAGAGG + Intronic
1147358783 17:39918336-39918358 CCAAAGGTAGGATGGGGAAGTGG - Intronic
1148347546 17:46913411-46913433 GCTAAGGAAGCATGGGGAAGGGG + Intergenic
1148555762 17:48577825-48577847 CCAGGGGTGGGAGGGGGAAGGGG + Intronic
1148653656 17:49267586-49267608 CAAGAGGAAGGATGAGGAAGGGG + Intergenic
1148740147 17:49888083-49888105 TCAGAGGTAGGATAGGGAACAGG - Intergenic
1149316477 17:55443670-55443692 GCAAAGCTTGGATGGGGATGTGG - Intergenic
1149865628 17:60149709-60149731 CCAGGAGTAGGATGGGGGAGGGG + Intergenic
1150848229 17:68680576-68680598 GAAAAGGTGGGAGGGGGAAGGGG + Intergenic
1151684035 17:75636433-75636455 CCAAACCTAGGAAGGGAAAGGGG + Intronic
1151781115 17:76246137-76246159 GAAAAGGTAGAATGTGGAAGCGG + Intergenic
1151972549 17:77466337-77466359 CCAAGGCTGGGAGGGGGAAGGGG - Intronic
1152239415 17:79153749-79153771 CCAAAGGTGGGAGGAGGAGGTGG - Intronic
1152239727 17:79155020-79155042 CCAAAGGGTGGGTGGGGGAGGGG + Intronic
1152244893 17:79180217-79180239 CCCTAGGTAGGCTGGGGATGGGG - Intronic
1152415728 17:80160509-80160531 CCAAAGGTAGCTTGGGGAAGTGG + Intergenic
1155500473 18:26482396-26482418 CCTAAGGAGGGATGGGAAAGAGG + Intronic
1156340270 18:36204237-36204259 CCAAGGGTTGGAAGGGGAGGAGG - Intronic
1157604772 18:48919195-48919217 CCAGAGCTAGGCTGGGGAAGGGG + Intergenic
1157764985 18:50289342-50289364 CCAAAGATAGGAAGGGGAGAAGG - Intergenic
1159062939 18:63535338-63535360 TCAAAGGTAGAATGGGAAAAAGG + Intergenic
1159691731 18:71496344-71496366 CCGAAGTTAGGATGGTGAGGAGG + Intergenic
1160717923 19:584806-584828 CCAACAGGACGATGGGGAAGGGG + Intergenic
1160899206 19:1418717-1418739 CCGAAGGAAGGATGGGTAAGGGG + Exonic
1161585604 19:5103850-5103872 ACCAAGGCAGGGTGGGGAAGGGG - Intronic
1161609248 19:5231782-5231804 CCAAAGGTGGGATGGGCGGGTGG + Intronic
1162799914 19:13104639-13104661 CTGAAGGTGGGAGGGGGAAGAGG + Intergenic
1162859948 19:13499046-13499068 CCAAAGTTTGGAAGGGGAGGGGG + Intronic
1163059211 19:14746215-14746237 CACAAGGTAAGATGGAGAAGGGG - Exonic
1163112025 19:15167196-15167218 TCACAGGTAGGATGGGTGAGGGG + Intronic
1163288769 19:16365125-16365147 ACACAGGCATGATGGGGAAGGGG - Intronic
1163335820 19:16671018-16671040 CCATATGTAGGAGGGGGAGGCGG - Intronic
1165476282 19:36032707-36032729 CCCGAGGTAAGATGGGGAGGGGG - Exonic
1165810304 19:38607959-38607981 CCCCAGGGAGGATGGGGAGGGGG - Intronic
1166167658 19:41003745-41003767 AGAAAGGAAGGATGAGGAAGGGG + Intronic
1167411208 19:49344946-49344968 CTAAAGTTAGGAAGAGGAAGAGG - Intronic
925180700 2:1815326-1815348 CGACAGAGAGGATGGGGAAGGGG - Intronic
925260816 2:2526860-2526882 ACACAGGTAGGATGAGGAACAGG - Intergenic
926459006 2:13104345-13104367 CCCAGGGTAGCATGGAGAAGAGG - Intergenic
928822296 2:35375919-35375941 CCAAAGGAAGGAAAAGGAAGGGG + Intergenic
929213786 2:39388607-39388629 GCACAGGTAGGTTGGGGAAAAGG + Intronic
929535823 2:42783622-42783644 GAAGAGGAAGGATGGGGAAGGGG + Intronic
929978625 2:46658169-46658191 ACATAGGTAGGATAGAGAAGAGG + Intergenic
931323156 2:61192313-61192335 ACAAAGGCAGAATTGGGAAGAGG - Intronic
931682591 2:64764061-64764083 CCAAATCTAGGATGTGGAAGGGG + Intergenic
932263082 2:70343233-70343255 TCAAAGGGAGGAGGGGGAGGTGG + Intergenic
932845393 2:75129876-75129898 CCAAAGGAAGGACTAGGAAGGGG + Intronic
936029372 2:109059090-109059112 CCAAAGCGGGGGTGGGGAAGGGG + Intergenic
936077226 2:109409231-109409253 ACAAAGGCAGAAAGGGGAAGAGG + Intronic
936428291 2:112437088-112437110 CCACAGGGAGGGTGGGGAGGGGG + Intergenic
936617352 2:114061579-114061601 GGTAAGGCAGGATGGGGAAGAGG + Intergenic
936819102 2:116497240-116497262 ATAAAGATGGGATGGGGAAGGGG + Intergenic
938593632 2:132764605-132764627 CCTATGGTTGGATGGGGAATAGG - Intronic
938986577 2:136582311-136582333 GCTAAGGTAGGGTGGGGAAAAGG - Intergenic
940917913 2:159277909-159277931 CTAAAGGCAGGGTGGGGATGTGG + Intronic
941296650 2:163747238-163747260 AAAAAGAGAGGATGGGGAAGAGG + Intergenic
942118472 2:172752151-172752173 CCATGGGTAGGATGGGAATGAGG - Intronic
944139335 2:196437946-196437968 CAAAAGGCTGGATGGCGAAGAGG + Intronic
945622696 2:212160854-212160876 CTGAGGGTAGGTTGGGGAAGGGG + Intronic
945974142 2:216257810-216257832 ACAGAGGGAGGATAGGGAAGAGG + Intergenic
946097846 2:217291157-217291179 CCAAAGCAAGCATGGGGATGGGG - Intronic
946209708 2:218137697-218137719 CCAAATGCAGAATGGGGAAGTGG + Intergenic
946393796 2:219433017-219433039 CCAGAATGAGGATGGGGAAGAGG + Intergenic
946819332 2:223613969-223613991 CCACAGCTAGGAAGAGGAAGAGG - Intergenic
947616737 2:231562513-231562535 CCCATGGTGGGATGGGGAGGTGG + Intergenic
1168751905 20:288558-288580 ACATAGGTAGGCTGGGGGAGGGG - Intronic
1168994694 20:2124434-2124456 CCAAAGGGAGGATGGGAAAAGGG + Intronic
1169131516 20:3168334-3168356 CCACAGGTGGGAGGGGGGAGGGG + Intronic
1169339495 20:4785602-4785624 ACAAAGGGAGGAAGGGGGAGAGG + Intronic
1170368952 20:15627490-15627512 TCAAAGGCAGTTTGGGGAAGGGG + Intronic
1170941827 20:20854368-20854390 CCACAGGAAGTATGGGCAAGGGG + Intergenic
1171020115 20:21577178-21577200 GCATAGGTAGGAAGGGGAAAAGG + Intergenic
1171491186 20:25518745-25518767 CCAAAAGCAGGGTGGGGGAGGGG - Intronic
1171950160 20:31414249-31414271 AGAAAGGAAGGAAGGGGAAGGGG + Intergenic
1172617320 20:36297945-36297967 CCAAAGTGGGGATGGGGGAGAGG - Intergenic
1172646678 20:36474625-36474647 ACCAAGGTGGGGTGGGGAAGAGG + Intronic
1172776652 20:37411437-37411459 ACAAAGGGAGGGTGAGGAAGGGG - Intergenic
1172784286 20:37456261-37456283 CTGAGGTTAGGATGGGGAAGGGG + Intergenic
1173152088 20:40576118-40576140 TCAAAGCTTGGATGGAGAAGGGG - Intergenic
1173465721 20:43279680-43279702 ACACAGGTCGGTTGGGGAAGTGG + Intergenic
1173564158 20:44027441-44027463 CCTAAGCTGGGATGGGGCAGTGG - Intronic
1173676318 20:44838828-44838850 CAAAAGGTAAGATGGGAAATGGG + Intergenic
1174059627 20:47823534-47823556 CACAAGGGAGGAGGGGGAAGCGG - Intergenic
1174152346 20:48494237-48494259 TCCCAGGTAGGCTGGGGAAGAGG - Intergenic
1174195686 20:48771240-48771262 CTAAAGGTCGGATAGGGAAATGG - Intronic
1175114687 20:56673811-56673833 GCAAAGGTATGATGGGGACAAGG + Intergenic
1175279696 20:57794823-57794845 ACAGAGGCAGGATGGGGAAAGGG - Intergenic
1176373961 21:6078123-6078145 CCACAGGGAGGGTGGGGAGGGGG - Intergenic
1176965110 21:15204277-15204299 CCTCAGGCAGGATGGAGAAGAGG - Intergenic
1176976147 21:15324803-15324825 CAAAAGGGAGGATGGGACAGTGG + Intergenic
1177121111 21:17138115-17138137 CTAAAGGGAGGAGGAGGAAGGGG + Intergenic
1178534587 21:33401715-33401737 CCAAAGCTAGCAAGGGGAAGTGG - Intergenic
1179051446 21:37891900-37891922 TCAAGTGTGGGATGGGGAAGGGG + Intronic
1179277929 21:39908669-39908691 CCAAAGGAAAGGTGGGGAGGAGG + Intronic
1179666567 21:42916869-42916891 CCCAAGTGAGGATGGGGCAGGGG + Intergenic
1179749516 21:43460120-43460142 CCACAGGGAGGGTGGGGAGGGGG + Intergenic
1180626818 22:17199168-17199190 CCAAAGGTTGGCTGGGGGACGGG + Intronic
1182395517 22:30033265-30033287 CCCAAGGTTGGAAGAGGAAGTGG + Intergenic
1183588328 22:38766003-38766025 CCACAGGTAGAATGAGGAGGTGG + Intronic
1183741522 22:39671022-39671044 CCAGGGATAGGGTGGGGAAGGGG + Intronic
1183947081 22:41332587-41332609 AGAAAGGCAGGGTGGGGAAGAGG - Intronic
950077020 3:10194534-10194556 CCAAAGGCAGGATGAGGCAAAGG - Intronic
951682044 3:25305100-25305122 CCAGAGGCAGGAGGGGGCAGTGG - Intronic
953008937 3:39005446-39005468 CCAGAGGTAGGAAAGGAAAGAGG - Intergenic
953010349 3:39019377-39019399 TCAAAGGTAGTTTGGGGAAAGGG - Intergenic
953668693 3:44944663-44944685 CCACAGATAAGATGGGGAAATGG + Intronic
953671822 3:44969393-44969415 CTAAAAGCAGGATGGGGAAGTGG - Intronic
954225156 3:49176519-49176541 CCAAAGGAAGGCAGGGGCAGTGG - Intergenic
954558061 3:51533809-51533831 CCCAAGTGAGGATGGGGCAGGGG + Intergenic
954646400 3:52134186-52134208 CCAGGGCTGGGATGGGGAAGGGG + Intronic
954751642 3:52817390-52817412 CCAAGGGTAAGATGGAGAATTGG + Intronic
955092652 3:55767851-55767873 CCAAATGTAGGATGGTGATATGG + Intronic
955169772 3:56551895-56551917 AAAGAGGTAGGTTGGGGAAGGGG - Intergenic
955337589 3:58099647-58099669 CCAGAGGTAGGATTCGGAAGAGG - Intronic
956243038 3:67151200-67151222 CCAGAGGTAGAAGGGGGAACTGG + Intergenic
957688890 3:83541489-83541511 CCAGAGGTTGGATAGGGTAGAGG - Intergenic
960815026 3:121663378-121663400 CAACTGGTAGGATGGGGGAGGGG + Exonic
960902185 3:122564274-122564296 GCACAGGGAGGAGGGGGAAGCGG + Exonic
961039628 3:123668498-123668520 CCAGAGGTAGGGTGGGGGAGGGG + Intronic
961202254 3:125054889-125054911 ACAAAGGTAGCAGGGAGAAGAGG + Intronic
961345330 3:126260264-126260286 CTAGAGGGAGGATGGGGAAGAGG - Intergenic
961450984 3:127002208-127002230 CCAAAGCTGGGCAGGGGAAGAGG - Intronic
961825995 3:129599373-129599395 CCACAGCTAGGAAGGGGCAGAGG + Intronic
962174633 3:133139964-133139986 CCTAAGGTGTGAGGGGGAAGAGG + Intronic
963729614 3:148958600-148958622 CCAAATGCAGCATGGGGATGTGG + Intergenic
963831397 3:150013238-150013260 CCAAAGGCAGGATGAGAAATAGG + Intronic
964444599 3:156745456-156745478 CCAAAGCTTGGAAGGGAAAGAGG - Intergenic
965128545 3:164663280-164663302 GCTAAGTTAGGATGGGGAATAGG - Intergenic
965673029 3:171166281-171166303 ACTAAGGTTGGATGGGTAAGGGG - Intronic
966325732 3:178751667-178751689 ACAAAGGTACAATAGGGAAGAGG + Intronic
966598042 3:181745077-181745099 AAAAAGGAAGGATAGGGAAGAGG - Intergenic
967881264 3:194303376-194303398 CCAAAGGTGGGTTGGACAAGGGG + Intergenic
969877247 4:10144908-10144930 CCAAGGGTAGGCTATGGAAGAGG + Intergenic
970479673 4:16460344-16460366 CCACAGGCAGGCTGGGGTAGGGG - Intergenic
970686256 4:18570977-18570999 CAAAAGGTGAGATGGGCAAGTGG + Intergenic
970793431 4:19887405-19887427 CCCAAGGGAGGATGGGGCAAAGG - Intergenic
971074217 4:23129332-23129354 CCAAAGGCAGTTTGGGGAAGGGG + Intergenic
971398858 4:26256231-26256253 CCAAAGGCAGGGTGGGGCTGTGG - Intronic
971477894 4:27089551-27089573 TCAAGGGTAGGATGGGGCACTGG - Intergenic
971575428 4:28266939-28266961 CCTAAAGTAGAATGGGAAAGAGG - Intergenic
972314126 4:37909644-37909666 CCAAATGTAGAAGGGGGAAGAGG - Intronic
972770623 4:42193885-42193907 GCAGAGGGAAGATGGGGAAGAGG + Intergenic
972931109 4:44072259-44072281 CCAAAGTCAGGAGGGGGCAGAGG + Intergenic
974192961 4:58532319-58532341 GCAGAGGTAGGGTGTGGAAGAGG - Intergenic
978040467 4:104054508-104054530 CCAAAGGTAGGAAAGGAAAAAGG - Intergenic
978843479 4:113244509-113244531 CTAAATGTAGAATTGGGAAGAGG + Intronic
980291693 4:130853160-130853182 CCAAAGGAAGGATGGGAATTGGG + Intergenic
981173000 4:141646448-141646470 CCAAAGCAGGTATGGGGAAGGGG - Intronic
981550710 4:145938061-145938083 CCAGAGTGAGGAGGGGGAAGGGG + Intronic
981814001 4:148807645-148807667 GGAAAGGAAGGAAGGGGAAGGGG + Intergenic
981855122 4:149280092-149280114 CTAAAGTTAGGAGGGGGAAGGGG + Intergenic
982293431 4:153802988-153803010 CCAAAGGAAGGAGGGGACAGAGG + Intergenic
982474986 4:155839405-155839427 CCAGAAGTAGGATGGGGAGGGGG + Intronic
983242356 4:165247738-165247760 CCAAAAGGAAGATGAGGAAGAGG + Intronic
984279751 4:177655755-177655777 AGAAAGGTAGGAGGGGGAAAGGG - Intergenic
988232058 5:28492031-28492053 CAAAAGGTAGGAGGAGGGAGAGG + Intergenic
988973663 5:36494121-36494143 ACAAAGGTAGAATGGTGAAATGG + Intergenic
990138101 5:52671312-52671334 GCACAGGAAGGATGGGGAATTGG - Intergenic
990299843 5:54438918-54438940 GGGAAGGTAGGAAGGGGAAGAGG + Intergenic
991190751 5:63870270-63870292 GCAAAGGAAGGATGGGGTAGGGG + Intergenic
991719885 5:69485517-69485539 GCAAAGGAAGGAAGAGGAAGGGG - Intergenic
992758184 5:79928967-79928989 CCAGAGATAGCATGGGGCAGGGG - Intergenic
994048082 5:95331557-95331579 CCAAAGGAATGATTTGGAAGTGG + Intergenic
995808170 5:116077653-116077675 ACAAATGGAGGGTGGGGAAGAGG - Intergenic
995917343 5:117264198-117264220 GCAAAGATAGGATTGGGAAAGGG - Intergenic
996023256 5:118614907-118614929 ACAAAGATAGGATGTGGAGGAGG - Intergenic
996869140 5:128166642-128166664 CCAAGGGTTGGAGGGAGAAGGGG + Intronic
997060600 5:130497333-130497355 GAATAGGTAGGATGGGAAAGTGG + Intergenic
997177675 5:131796596-131796618 CCGACGGGAGGAGGGGGAAGGGG + Intronic
997906493 5:137822517-137822539 ACAACTATAGGATGGGGAAGGGG + Intergenic
998402131 5:141853522-141853544 CCAAAGGTGGGGTAGGGACGGGG - Exonic
1000043886 5:157505633-157505655 CAAGAGGGAGGATGGGGAGGAGG - Intronic
1001128259 5:169040510-169040532 TCAAGGGCAGGATGGGGATGAGG - Intronic
1002297647 5:178240323-178240345 CCAAAGGGAAGGTGGGGAGGGGG + Intronic
1003133250 6:3413449-3413471 CCCAGGGCAGGCTGGGGAAGGGG + Intronic
1003880734 6:10477381-10477403 ACAATGGGAGGATGGAGAAGAGG + Intergenic
1005251023 6:23946292-23946314 CCAAGGGTAGAATGGGTAAAAGG - Intergenic
1005808991 6:29502143-29502165 CCAAAGGGAGGAGGGGGAAATGG + Intergenic
1005938928 6:30546367-30546389 GCCAAGGAAAGATGGGGAAGAGG + Intronic
1006300658 6:33192192-33192214 CCAGAGGTAGGAGGAGGAGGAGG + Exonic
1006603453 6:35240804-35240826 CCAAAGGAATGATCGAGAAGGGG - Intronic
1007631268 6:43274868-43274890 CCAAATGAGGGGTGGGGAAGGGG + Intronic
1008003087 6:46381288-46381310 CCCAAGGTTGCATGGGGCAGAGG - Intronic
1008235890 6:49049359-49049381 CCAAAGGTAGGTGGTGGAAAGGG - Intergenic
1009932655 6:70194410-70194432 CCACAGTTAGGTTTGGGAAGGGG - Intronic
1010492842 6:76495107-76495129 GCAGAGGAAGGTTGGGGAAGAGG + Intergenic
1011260498 6:85465199-85465221 CTCAAGTTAGGATGGGGAGGTGG + Intronic
1011659449 6:89581714-89581736 CGGAATGGAGGATGGGGAAGGGG - Intronic
1012438046 6:99235645-99235667 GGAAAGGTAGGATGGGGGACAGG + Intergenic
1013450455 6:110275426-110275448 CCAAAGGTAGAAGAAGGAAGGGG - Intronic
1014167271 6:118239357-118239379 ATAGAGGTAGGATGGGGAAAGGG + Intronic
1014288473 6:119530599-119530621 CCAAAGGAAGGAAGGAAAAGAGG - Intergenic
1016938846 6:149468302-149468324 CCAAAGGTACAAAGAGGAAGTGG + Intronic
1017074750 6:150607246-150607268 GCAGAGGGAGAATGGGGAAGAGG + Intronic
1017229070 6:152052749-152052771 CCAAAGGCAGGATGGGGGTGAGG + Intronic
1017951763 6:159141233-159141255 ACAAAGGCAGGATGGGAAGGAGG - Intergenic
1018004461 6:159608594-159608616 CCAAAGGTAGTATAGGGAACAGG + Intergenic
1018167092 6:161108342-161108364 CTGGAGGTAGGATGGGGAAAGGG + Intronic
1018780539 6:167059892-167059914 CCAGAGGTTGGAGGGGGAGGTGG + Intergenic
1019608244 7:1921001-1921023 CCAAAGAGAGGGTGGGGAGGTGG + Intronic
1019761610 7:2816971-2816993 CCAGGGGTAGGAGGTGGAAGTGG - Intronic
1020666016 7:11045055-11045077 CAGAATGTAGGATGGGGAAAAGG - Intronic
1020711584 7:11612928-11612950 CCAAAGGTAAGATAGTGAAACGG - Intronic
1021746342 7:23745109-23745131 CCACAGGTAGCATGTGCAAGTGG + Intronic
1022081702 7:27028849-27028871 ACAAAGGCAGCATGGTGAAGAGG + Intergenic
1022547179 7:31200352-31200374 CCAAGGTGGGGATGGGGAAGAGG - Intergenic
1022821040 7:33961303-33961325 CCAAAAGTAGGAAGTGGAAGAGG - Intronic
1023104130 7:36747021-36747043 CCAAAGGGAGGATGAAGTAGAGG - Intergenic
1023939204 7:44759366-44759388 CCCAGGGTAGGAAGGGGAGGGGG - Exonic
1024430609 7:49284318-49284340 CCGAAGCTAGCATGGGGAATGGG + Intergenic
1026044460 7:66897041-66897063 GCAAAGGCAGGTTGGGGGAGTGG - Intergenic
1027215541 7:76181196-76181218 CCAAAGCTTGGTTGGGGAGGGGG - Intergenic
1028103117 7:86845664-86845686 CTAAAATTAGGATGGGGGAGGGG + Intronic
1028382373 7:90212907-90212929 GAAAAGGAAGGATGGGGAGGTGG - Intronic
1028974261 7:96894019-96894041 CTAGAGGCAGGATGGGGTAGTGG - Intergenic
1029274013 7:99393531-99393553 TCTAGGGTGGGATGGGGAAGAGG + Intronic
1030451595 7:109719542-109719564 CCACAGTGAGGATGGGGGAGGGG + Intergenic
1030976148 7:116126038-116126060 CCAAATGCAGGGTGGGGATGTGG - Intronic
1031271545 7:119656267-119656289 TCAAGGGTAGGATGGGGTTGTGG - Intergenic
1032022863 7:128419707-128419729 CTAAATGTAGAATGGAGAAGAGG - Intergenic
1033285240 7:140035830-140035852 CCAAAAGAAGGAGGAGGAAGAGG + Intronic
1033578068 7:142705013-142705035 CCTGAGGCAGGGTGGGGAAGGGG - Intergenic
1033578213 7:142707049-142707071 CCTGAGGCAGGGTGGGGAAGAGG - Intergenic
1033804405 7:144937640-144937662 GGAAAGGAAGGAAGGGGAAGGGG - Intergenic
1034334233 7:150310200-150310222 ACAAAGGGAGGATGTGAAAGAGG - Intronic
1034580328 7:152035840-152035862 CCCAAGTGAGGATGGGGAAGGGG + Intronic
1035468320 7:159093963-159093985 TGAAGGGTAGGATGGGGAACAGG + Intronic
1036288352 8:7464090-7464112 CCAAAGTGAGGAAGGAGAAGTGG - Intergenic
1036333123 8:7847438-7847460 CCAAAGTGAGGAAGGAGAAGTGG + Intergenic
1036446871 8:8829206-8829228 CCAGACTCAGGATGGGGAAGGGG - Intronic
1036655992 8:10677871-10677893 ACAAGGGCAGGATGGGGAAATGG - Intronic
1038971948 8:32646554-32646576 ACAAAGCTGGGATGGGGATGGGG - Intronic
1039492581 8:37959073-37959095 CAGAGGGTATGATGGGGAAGGGG - Intergenic
1039714077 8:40089494-40089516 CCAAGAGTAGGAGGGGGAAGGGG + Intergenic
1039961322 8:42250141-42250163 TCAAAGGTAGTTTGGGGAAAGGG + Intergenic
1040474629 8:47765016-47765038 CCAAAGGCAGTAGTGGGAAGTGG - Intergenic
1040571626 8:48616539-48616561 CAAAAGACAGGGTGGGGAAGAGG - Intergenic
1041019991 8:53629076-53629098 CCAAAGGAAAGATGGGCAAAAGG - Intergenic
1043751965 8:83948905-83948927 AGAAAGGAAGGAAGGGGAAGAGG + Intergenic
1043856752 8:85273710-85273732 CCCAAGTGAGGATGGGGCAGGGG - Intronic
1045192918 8:99900913-99900935 CACAAGGGAGAATGGGGAAGAGG - Intergenic
1045453924 8:102356961-102356983 GCAAAAGTATGATGAGGAAGAGG + Intronic
1045826970 8:106409269-106409291 CCAAAGGGAGGATGGAGAGGAGG + Intronic
1047223876 8:122940444-122940466 CCAGAGGTGGGATGGGGTGGTGG - Intronic
1047638436 8:126792533-126792555 CAAGAGGTAGAATGGGGAAAGGG + Intergenic
1048119958 8:131568814-131568836 CAAAGGGTAGGAGGGGGATGAGG - Intergenic
1048813447 8:138309234-138309256 TGGAAGGTAGGGTGGGGAAGGGG + Intronic
1049062490 8:140286854-140286876 CCTAAGGTAGCCTGTGGAAGAGG + Intronic
1050419896 9:5452340-5452362 CCAAGGGTAGGATGGGTAGGAGG - Intronic
1051836242 9:21341305-21341327 CCTGAGATGGGATGGGGAAGTGG + Intergenic
1052016643 9:23476071-23476093 CCAGAGGCAGGAAGGAGAAGAGG - Intergenic
1052451251 9:28634392-28634414 GTAAAGGAAGGATGGGGAAAAGG - Intronic
1052891549 9:33704825-33704847 CCTGAGGCAGGGTGGGGAAGGGG - Intergenic
1056681528 9:88723170-88723192 CCGAAGCTAGCTTGGGGAAGAGG - Intergenic
1057820442 9:98326134-98326156 CCAAAGGAAAGATGGGGCCGGGG + Intronic
1058928526 9:109694035-109694057 CCAATTGTACGGTGGGGAAGGGG - Intronic
1059057960 9:111004389-111004411 GAAAAGGGAGGATGGGGTAGGGG - Intronic
1059399141 9:114058022-114058044 CCAGGGGTCGGATGGGGGAGCGG - Intergenic
1060102977 9:120856581-120856603 CCAAAATTGGGAGGGGGAAGAGG - Exonic
1060775622 9:126371576-126371598 CCACAGGTAGAATGAGGAAAGGG + Intronic
1060849466 9:126861859-126861881 ATAAAGGAAGGATGGGGGAGGGG - Intronic
1061013154 9:127967193-127967215 CCCAAGTTAGGAGGGAGAAGTGG + Intronic
1061276396 9:129571361-129571383 CCAAAGCCAGGAGGGAGAAGAGG + Intergenic
1061429629 9:130523033-130523055 CCAATGGTAGGATGGAGTAGGGG + Intergenic
1061484154 9:130911891-130911913 GCAAAGGGAAGATGGGGATGGGG + Intronic
1062507434 9:136885344-136885366 CCAAAGGCTGGATGGAGAGGGGG + Intronic
1185754596 X:2643255-2643277 TCAAAGGGAGGATGGGGCACCGG + Intergenic
1185765566 X:2723342-2723364 CCACAGGAAAGAAGGGGAAGAGG + Exonic
1186670714 X:11764810-11764832 CCAAAGGAAGGATGGCTGAGAGG - Intronic
1190369443 X:49727107-49727129 CCAAAGTTTGGAGGGGGCAGAGG - Intergenic
1191104624 X:56764795-56764817 GCAACAGTAGGATGGGGTAGGGG + Intergenic
1191606256 X:63065942-63065964 CCGGAGGTTGGTTGGGGAAGGGG + Intergenic
1191846116 X:65549512-65549534 CCAAAGGGAGGAGGGTGAACAGG + Intergenic
1192143765 X:68666745-68666767 GGAAAGGCAGGGTGGGGAAGTGG - Intronic
1192263818 X:69525074-69525096 GCCAGGGTAGGTTGGGGAAGGGG - Intronic
1194040863 X:88940797-88940819 CCTGAGGCAGGATGGGGAAGGGG + Intergenic
1195722588 X:107880431-107880453 CCAAAGGTAGTTTGGGGGAAGGG + Intronic
1195758696 X:108223950-108223972 TCAAGGGAAGGAAGGGGAAGAGG + Intronic
1196143426 X:112291153-112291175 CCAGAGGTAGGATGAGGTATTGG + Intergenic
1196180272 X:112681918-112681940 GCAAATGAAGGATGGGGATGGGG - Intergenic
1196794596 X:119491948-119491970 CTAAAGGTAGCCTGGGGGAGGGG + Intergenic
1197841936 X:130757503-130757525 AAAGAGGTATGATGGGGAAGAGG + Intronic
1198069952 X:133138448-133138470 CCAAAGGTAAGATGAATAAGTGG + Intergenic
1198820660 X:140644747-140644769 CCATATGTATGATGGGGCAGTGG + Intergenic
1198977850 X:142357398-142357420 CTAAAAGGAGGATGGGGAAAGGG - Intergenic
1199285069 X:146046273-146046295 CCCAAGGTAGGGTGGGGTGGCGG + Intergenic
1200002530 X:153069387-153069409 CCAAAAGTGGGGTGGGGGAGAGG + Intergenic
1200005194 X:153080623-153080645 CCAAAAGTGGGGTGGGGGAGAGG - Intergenic
1200090660 X:153634374-153634396 CTGTAGGTAGGATGGGGCAGTGG - Intergenic
1200215918 X:154368218-154368240 CCAGTGGTAGGATGTGGATGAGG + Intronic
1200819320 Y:7566075-7566097 CCAAAAGCAGGAAGGGAAAGAGG + Intergenic
1201291336 Y:12423364-12423386 CCATAGGAAGGTTGAGGAAGGGG - Intergenic