ID: 1147359409

View in Genome Browser
Species Human (GRCh38)
Location 17:39921725-39921747
Sequence ATGTGGGCAGGGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1351
Summary {0: 1, 1: 0, 2: 7, 3: 132, 4: 1211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147359409_1147359417 -7 Left 1147359409 17:39921725-39921747 CCTGCTTCCCTCCCTGCCCACAT 0: 1
1: 0
2: 7
3: 132
4: 1211
Right 1147359417 17:39921741-39921763 CCCACATCCCAAAGGAGATTGGG 0: 1
1: 0
2: 2
3: 25
4: 449
1147359409_1147359415 -8 Left 1147359409 17:39921725-39921747 CCTGCTTCCCTCCCTGCCCACAT 0: 1
1: 0
2: 7
3: 132
4: 1211
Right 1147359415 17:39921740-39921762 GCCCACATCCCAAAGGAGATTGG 0: 1
1: 0
2: 0
3: 13
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147359409 Original CRISPR ATGTGGGCAGGGAGGGAAGC AGG (reversed) Intronic
900182142 1:1315787-1315809 AGGCGGGCAGCGAGGGAGGCAGG + Intronic
900182162 1:1315827-1315849 GCGGGGGCAGGGAGGGAGGCGGG + Intronic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900438166 1:2641149-2641171 GTGTGGGGAGGGTGGGAAGGGGG + Intronic
900485382 1:2920358-2920380 ATGGGGGCAGGGAGAGCCGCTGG + Intergenic
900569051 1:3349421-3349443 AAGTGGCCATGGCGGGAAGCAGG + Intronic
901059416 1:6465277-6465299 GGGAGGGCAGGGTGGGAAGCAGG - Intronic
901194676 1:7433746-7433768 AGTTGGGCTGGGAGGGAAGTGGG + Intronic
901433320 1:9231652-9231674 AGGTGGGGAGGGAGGGAAACAGG - Intergenic
901634610 1:10664811-10664833 AGGTGGGGAGGGAGGGAGGGAGG - Intronic
901657600 1:10779187-10779209 AGGTGGGGAGGCAGGGAAGACGG - Intronic
901696389 1:11011311-11011333 AGGTGGGAAGGGAGGGAAGGGGG + Intergenic
901739607 1:11333739-11333761 AGGGGGGCAGGGAGGGAAGTGGG + Intergenic
901876922 1:12172143-12172165 AAGCGGGCAAGGAGGGAAGCTGG + Intronic
901898523 1:12337029-12337051 AGGGAGGCAGGGAGGGAAGAAGG - Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902377836 1:16038406-16038428 ATGTGGGGAGGGAGGGCCCCAGG + Intergenic
902382984 1:16061322-16061344 ATGTGGGGAGGGAGGGCCCCAGG + Intronic
902461067 1:16577281-16577303 ATGGGGGCAGGCAGGGGGGCAGG - Intronic
902592573 1:17485551-17485573 ATGTTGGCAGGAAGGCAAGGTGG + Intergenic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902625867 1:17676022-17676044 ATGTGTGCAGGTATGGATGCAGG + Intronic
902994042 1:20210059-20210081 GTGGGGGCAGAGAGGGGAGCTGG + Intergenic
903003023 1:20279822-20279844 ATGTGGGCCAGGAAGGAGGCTGG + Intergenic
903273895 1:22208824-22208846 GTGTGGGCAGGGAGCGACGGTGG + Intergenic
903332479 1:22603086-22603108 CCGTTGGCAGGCAGGGAAGCAGG + Exonic
903757543 1:25672988-25673010 ATGCGGGGAGAGAGGGCAGCTGG + Intronic
903827856 1:26158352-26158374 GTGTGGGCAGAGAAGGAAGCGGG + Intergenic
903840023 1:26232454-26232476 ATGTGAGGAGGGAGGGAACAGGG - Intergenic
903892414 1:26578511-26578533 ATCTGGGGTGGAAGGGAAGCTGG + Intergenic
903953554 1:27010423-27010445 ATGTGTGCAGGGATGGGGGCGGG - Intronic
903963674 1:27072877-27072899 ATGGGGGCAGGCATGGAGGCAGG + Intergenic
903963682 1:27072901-27072923 ATGGGGGCAGGCACGGAGGCAGG + Intergenic
903963690 1:27072925-27072947 ATGGGGGCAGGCACGGAGGCAGG + Intergenic
903963718 1:27073010-27073032 ATGGGGGCAGGTAAGGAGGCAGG + Intergenic
904256410 1:29257644-29257666 ATGGGGGCTGGAAGGGAAGTTGG + Intronic
904594848 1:31637140-31637162 TTGTGGGGAGGGCAGGAAGCAGG + Intronic
904625296 1:31798918-31798940 ATGTGTGGAGGGGAGGAAGCCGG + Intronic
904823790 1:33261789-33261811 AAGTGGGAAGGGAGAGGAGCAGG + Intronic
905203037 1:36326651-36326673 CTGTGGGCAAGAAGGGGAGCAGG + Intronic
905308657 1:37035021-37035043 ATGGGGTTGGGGAGGGAAGCCGG - Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905940055 1:41856048-41856070 ATATGGGCAGGAGGGGCAGCAGG - Intronic
906108169 1:43307017-43307039 TTGTGGGTAGGGTGGGAGGCTGG + Intronic
906209112 1:44002491-44002513 AGGTGGGAAGTGAGGGAAACCGG - Exonic
906366330 1:45213129-45213151 ATTGGGGCAGGGAGGCAATCAGG + Intronic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
906659376 1:47571700-47571722 ATGGAGGGAGGGAGGGAAGAAGG - Intergenic
906740463 1:48177874-48177896 AGGGGGGCAGGTAGGGAAGAGGG + Intergenic
907281199 1:53348578-53348600 ATCAGGGCTGGGAGGAAAGCAGG - Intergenic
907288334 1:53396375-53396397 GTGTGGCCAGGGTGGGGAGCAGG - Intergenic
907382863 1:54105480-54105502 AAGGGGGCAGGAAAGGAAGCAGG - Intronic
907423666 1:54364745-54364767 GTCTGGGCAGGGAGAGAGGCAGG - Intronic
907459538 1:54597226-54597248 ATGGGATAAGGGAGGGAAGCAGG - Intronic
907499134 1:54865790-54865812 AGGTGGGAAGGGAGGGAGGGAGG - Intronic
907506538 1:54923163-54923185 GGGTGGGGAGGGAGGGAGGCAGG - Intergenic
909218827 1:72927929-72927951 ATCTGGGCAAGGAAGGAAGTAGG - Intergenic
909503159 1:76357970-76357992 ATGTTGGCAGGGAGGCAGGTAGG - Intronic
910474828 1:87595635-87595657 AGGAGGGAAGGGAGGGAAGAGGG - Intergenic
910581101 1:88825845-88825867 ATGTGGCCAGAGAGGAAGGCAGG - Intronic
910770619 1:90827487-90827509 ACCTTGGCAGGGAGGGCAGCAGG + Intergenic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
911053956 1:93695139-93695161 GGGTGGGCAGGGAAGGAAGAAGG - Intronic
911086512 1:93982232-93982254 GAGGGGGCAGGGAGGGAAGGGGG - Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912936577 1:114008269-114008291 ATGAAGGCAGTGAGGGAGGCTGG + Intergenic
912970027 1:114272389-114272411 ATGTGGGGCGGGAGGAGAGCAGG + Intergenic
913640455 1:120807723-120807745 ATGGGGGCAGGCAGGGGGGCAGG + Intronic
913641228 1:120814007-120814029 ATGGGGGCAGGCAGGGGGGCAGG + Intronic
913693999 1:121306628-121306650 AGGGAGGGAGGGAGGGAAGCGGG - Intronic
914084187 1:144437909-144437931 ATGGGGGCAGGCAGGGGGGCAGG - Intronic
914143565 1:144973439-144973461 AGGGAGGGAGGGAGGGAAGCGGG + Intronic
914212060 1:145588901-145588923 ATGGGGGCAGGCAGGGGGGCAGG - Intergenic
914277256 1:146136317-146136339 ATGGGGGCAGGCAGGGGCGCAGG - Intronic
914362269 1:146945091-146945113 ATGGAGGGAGGGAGGGAAGGAGG - Intronic
914364784 1:146968564-146968586 ATGGGGGCAGGCAGGGGGGCAGG + Intronic
914486895 1:148118584-148118606 ATGGGGGCAGGCAGGGGGGCAGG - Intronic
914489406 1:148141987-148142009 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
914538302 1:148587265-148587287 ATGGGGGCAGGCAGGGGGGCAGG - Intronic
914587228 1:149073732-149073754 ATGGGGGCAGGCAGGGGGGCAGG - Intronic
914960769 1:152204463-152204485 AGATGGGGAGGGAGTGAAGCAGG - Intergenic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915286446 1:154856360-154856382 ATGTTGGCAGGGTGGGCTGCGGG - Intronic
915300966 1:154951435-154951457 CTGTGGGAAGGAAGGGAGGCGGG - Intronic
915466127 1:156099079-156099101 CCGTTGGCAGGGAGGGAGGCAGG + Intronic
915476673 1:156156597-156156619 GTGTGGGCTGGGAGTGAAGAGGG + Intronic
915716573 1:157950168-157950190 AGGTAGGGAGGGAGGGAAGGAGG + Intergenic
915799443 1:158773667-158773689 ATGTGGTGGGGGAGGGAAGATGG - Intergenic
916554987 1:165886771-165886793 AAGAAGGCAGGGAGGGAAGGAGG - Intronic
916602243 1:166304385-166304407 TTGTGGGTGGGGCGGGAAGCGGG + Intergenic
916647181 1:166797505-166797527 GTCTGGGCAGCGAGGGGAGCCGG + Intergenic
916841668 1:168607846-168607868 ATGGGGGTAGGGAGAGGAGCAGG + Intergenic
917021276 1:170590846-170590868 AGGAAGACAGGGAGGGAAGCGGG + Intergenic
917485156 1:175448861-175448883 TTTTTGGCATGGAGGGAAGCAGG - Intronic
917967062 1:180185543-180185565 CTGGGGGCAGGAGGGGAAGCAGG - Intronic
918084564 1:181234841-181234863 ATGTGGGCAGAGGGGACAGCAGG - Intergenic
918146454 1:181760246-181760268 ATGGGGGTAGGGTGGGAAGGAGG - Intronic
918194183 1:182206520-182206542 ATGGGGGCAGGGAAGTTAGCGGG + Intergenic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
919347987 1:196411010-196411032 AGGTGGGAAGGGAGGGAGGGAGG - Intronic
919659856 1:200233895-200233917 ATCTGGGCAGGATGAGAAGCTGG - Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
920194639 1:204218739-204218761 ATGGGGGCTGGGAGGTAGGCTGG - Intergenic
920294151 1:204945683-204945705 ATGTGCACAGGGAGGGAGGGAGG + Intronic
920354467 1:205360328-205360350 AAGTGGGCAGGAAGGAACGCGGG + Intergenic
920481324 1:206325007-206325029 AGGGAGGGAGGGAGGGAAGCGGG - Intronic
920679587 1:208062416-208062438 AGCTGGGCAGTGAGGGAAGGAGG - Intronic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
920747926 1:208646478-208646500 AGGAGGGCAGGGAGGGAGGGAGG - Intergenic
921016532 1:211197319-211197341 AGGGGGGCCGGGAGGGAGGCCGG + Intergenic
921046963 1:211484748-211484770 AGGTGGGAAGAGAGGGAGGCAGG - Intronic
921051171 1:211512895-211512917 ATGTTGGCAGGCAGGGCACCTGG + Intergenic
921090441 1:211836854-211836876 ACGTGGGGAGGGAGGGGAGCAGG - Intergenic
921098851 1:211911149-211911171 AGGTGGTCAGGGAGGGGAGGAGG - Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
922215375 1:223516035-223516057 AGGTGGCGGGGGAGGGAAGCTGG - Intergenic
922468838 1:225862852-225862874 CTGTGGCCAGGGAGAGAAGGAGG + Intronic
922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG + Intronic
922851461 1:228736608-228736630 ATGTGGGCAGGGAAGGTGGTGGG - Intronic
922860256 1:228810398-228810420 ATGGGGGCAGGTAAGGAAGAGGG + Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922915751 1:229256227-229256249 AGGTGGGCAGGAAGGGGAGGTGG + Intergenic
923012185 1:230096625-230096647 ATGGGAGCAGGGAGGGAGGTTGG - Intronic
923353883 1:233134588-233134610 AGGCAGGCAGGGAGGGAGGCAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923452866 1:234136175-234136197 AGGAGGGAAGGGAGGGAAGAAGG - Intronic
923608198 1:235464493-235464515 ATGTGGGAAGTGAGGGAGGGAGG - Intronic
924035642 1:239933805-239933827 AGGAGGGGAGGGAGGGAGGCAGG + Intergenic
924257273 1:242194871-242194893 AGGAGGAAAGGGAGGGAAGCGGG + Intronic
924602579 1:245504391-245504413 ATGAAGGGAGGGAGGGAAGGAGG - Intronic
1062966052 10:1608630-1608652 ATGAAGGGAGGGAGGGAAGGAGG + Intronic
1063118861 10:3090479-3090501 GTGTGGCCAGGTAGGGAAACGGG + Intronic
1063123298 10:3119849-3119871 TTGTGGGGCGAGAGGGAAGCTGG - Intronic
1063289943 10:4735037-4735059 AAGGAGGCAGGGAGGGAAGGAGG - Intergenic
1064000018 10:11655714-11655736 TAGTGGACAGGGAAGGAAGCTGG - Intergenic
1064159086 10:12928656-12928678 ATGTGGGCAGGCTGGGAGGTCGG - Intronic
1064526431 10:16260813-16260835 ATGGAGGGAGGGAGGGAGGCAGG + Intergenic
1064679488 10:17795631-17795653 ATGTGGGGAGGGAGAGCATCAGG + Intronic
1064717145 10:18188283-18188305 AGGTGGGCAGGAAGGAAAGGAGG - Intronic
1064906920 10:20357085-20357107 GTGTGGGGAGGTAGGGAGGCAGG - Intergenic
1065139135 10:22703562-22703584 ATGAGGGCAAGGAGGAAAGTGGG + Intronic
1065506625 10:26436197-26436219 ATGGGGACAGAGAGGTAAGCAGG - Intergenic
1065926337 10:30436460-30436482 AAGGGGAGAGGGAGGGAAGCAGG - Intronic
1067429977 10:46236497-46236519 GTGTGAGCTGGGAGGGAAGATGG - Intergenic
1067443668 10:46327314-46327336 GTGTGAGCTGGGAGGGAAGATGG + Intronic
1067726571 10:48775175-48775197 AGGTGCACAGGGTGGGAAGCAGG + Intronic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1068219104 10:54020617-54020639 ATGGAGGCAGGGAGGAAAGGAGG + Intronic
1068738219 10:60438848-60438870 CTGTGGGGAGGGAGAAAAGCAGG + Intronic
1069817371 10:71207003-71207025 ATGGAGGAAGGGAGGGGAGCTGG - Intergenic
1070149883 10:73799176-73799198 ATCAGGGCAGGTGGGGAAGCTGG + Exonic
1070481209 10:76884523-76884545 ATGGGGGAAGTGAAGGAAGCTGG + Intronic
1070644257 10:78190532-78190554 AGGTGTGCAGAGAGGCAAGCAGG + Intergenic
1070960199 10:80493797-80493819 ATGTGCAGAGGAAGGGAAGCTGG + Intronic
1071232403 10:83603608-83603630 ATGAAGCCAGGGAGGGCAGCAGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071477724 10:86039124-86039146 ATGAGGGAAGGAAGGGAAGTGGG - Intronic
1071481875 10:86070683-86070705 ATGTGTGCAGGGATGGATGAGGG - Intronic
1071527518 10:86366839-86366861 AGGCGGGCAGGGAGGGGAGGGGG - Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071917996 10:90317564-90317586 GTGTGGGCAGAGAGGTAGGCAGG + Intergenic
1072009366 10:91290234-91290256 GTGTGGCCAGAGTGGGAAGCAGG + Intergenic
1072205838 10:93204700-93204722 ATGGGGCCTGAGAGGGAAGCTGG + Intergenic
1072524929 10:96263306-96263328 ATGTGTGAAGGAAGGGAATCTGG + Intronic
1072665469 10:97389482-97389504 ATGTGAGCACCGAGGGAAGGGGG + Intronic
1072805070 10:98418948-98418970 CTGAGGGCACGGAGGAAAGCTGG + Intronic
1072831663 10:98664349-98664371 TTGTGGGCTGGCAGGGAAGCAGG + Intronic
1073288604 10:102402558-102402580 ATGTGGGCAGGGTGGGTAGCTGG - Intergenic
1073349721 10:102810961-102810983 ATGAAGGGAGGGAGGGAAGAAGG - Intronic
1073426571 10:103458808-103458830 CAGTGGGCAGGGTGGGCAGCAGG - Exonic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074609129 10:115004429-115004451 ACGGAGGGAGGGAGGGAAGCAGG - Intergenic
1075245354 10:120817679-120817701 AGGTGAGGAGGGAGGGAAGAGGG - Intergenic
1075400684 10:122159390-122159412 ATGTGAGCAGGGACAGAACCTGG - Intronic
1076404660 10:130203836-130203858 AGGTGGGCAGGGATGGACGGAGG - Intergenic
1076652901 10:132002249-132002271 GTGTGGGCAGGGAGGATGGCAGG - Intergenic
1076806338 10:132861024-132861046 ATGTGTGCAGGCAGGGAGACAGG + Intronic
1077143039 11:1033268-1033290 ACGAGAGCAGGGAAGGAAGCTGG - Intronic
1077198490 11:1293401-1293423 GTGTGGGCAGAGAGGGGAGGAGG + Intronic
1077227452 11:1444639-1444661 AGAGGGGGAGGGAGGGAAGCTGG - Intronic
1077253305 11:1570206-1570228 TGGTGGGAAGGGAGGGAACCTGG - Intronic
1077272194 11:1686659-1686681 AGGGAGGCAGGGAGGGAAGAAGG - Intergenic
1077272285 11:1686934-1686956 AGGGAGGCAGGGAGGGAAGAAGG - Intergenic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1077337225 11:2010828-2010850 ACATGGGGAGGGAGGGAGGCAGG - Intergenic
1077479048 11:2804460-2804482 ATGAGGGGAGGGAGGGATGGAGG + Intronic
1077479926 11:2808985-2809007 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
1077601268 11:3576588-3576610 ATGTGGGCAGGCAGGGCAGGTGG - Intergenic
1077662903 11:4085038-4085060 ATCTGGGCTGGGAGGGAAAGAGG + Intronic
1077876262 11:6309940-6309962 AGGGGGACAGGGAGGGAAGGGGG - Intergenic
1077888747 11:6404070-6404092 AGGAAGGCAGGGAGGGAAGAAGG + Intronic
1078170441 11:8925395-8925417 ATGTGGGAGGGAAGGGAGGCGGG + Intronic
1078316541 11:10298020-10298042 ATGGGAGCAGGAAGGGAAGAAGG + Intergenic
1078356963 11:10639649-10639671 ATCTGGGCAGGGAGGCAAGCAGG - Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078605981 11:12776007-12776029 CAGTGGGCAGGGAGGGGTGCAGG + Intronic
1078707800 11:13761983-13762005 GTGTGGACAGGGTGGAAAGCAGG - Intergenic
1079100032 11:17535356-17535378 AGGTGGCCAGGCAGGGAAGTGGG - Intronic
1079241312 11:18724096-18724118 ATGGGGGCAGGGAAGGGATCGGG - Intronic
1079593938 11:22217787-22217809 ATGGGAGGAGGGAGAGAAGCAGG + Intronic
1079891987 11:26067288-26067310 ATGTGGGAAGGAGGGGAAGTAGG - Intergenic
1080368964 11:31611856-31611878 AAGTGGGCAGAGAGGGCAGTGGG + Intronic
1080573310 11:33576697-33576719 GTGTAGCCAGGGAAGGAAGCGGG + Intronic
1080687305 11:34525909-34525931 ATGTTCCCAGGGAGGGAAACTGG - Intergenic
1080701450 11:34647791-34647813 ATGTGAGGTGGGTGGGAAGCAGG - Intronic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1081734634 11:45394337-45394359 ATGTGGGGAGTGAGGAAGGCGGG + Intergenic
1081804176 11:45881288-45881310 ACGTGAGGAGGGAGGGAAGGAGG - Exonic
1081855274 11:46299416-46299438 ATGTGGGAAGGGAGTGATGCAGG - Intronic
1081877533 11:46419808-46419830 AGGTGGGGAGGGAGGAAGGCAGG + Intronic
1083148538 11:60775812-60775834 ATGTGGTGAGGGAGGGCAGCTGG - Exonic
1083261856 11:61527522-61527544 AGGAGGGCAGGGAGGGAGGGAGG - Intronic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083433269 11:62626017-62626039 ATGGGGGAAGGAGGGGAAGCCGG - Intronic
1084176557 11:67425351-67425373 ATGAGGGCAGGGAGGTGAGGGGG - Exonic
1084257185 11:67951162-67951184 ATGTGGGCAGGCAGGGCAGGTGG - Intergenic
1084268186 11:68015499-68015521 AGGGGGGCATGGAGGGCAGCTGG + Intronic
1084359819 11:68661923-68661945 CTGTTGGCTGGGAGGGGAGCTGG + Intergenic
1084692594 11:70735720-70735742 ATGTGCAGAGGGAGGGAAGTGGG + Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085421544 11:76366069-76366091 ATGTTCTCAGGGAGGGGAGCAGG - Intronic
1085525795 11:77162783-77162805 ACATGGGCAGGGAGGGGAGTGGG + Intronic
1085737589 11:79052629-79052651 ATGTGGCGAGGGAGGGAGGGAGG + Intronic
1086962431 11:92992443-92992465 ATGAGAGGAGGGAGAGAAGCAGG - Intergenic
1087425919 11:97985242-97985264 CTGAGGGCAGGGAGGGAGACAGG + Intergenic
1087906100 11:103699707-103699729 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
1087915460 11:103804596-103804618 ATGTGGCCAATGAGAGAAGCAGG - Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088456070 11:110034279-110034301 ATGAGGTCAGAGAAGGAAGCAGG - Intergenic
1088537218 11:110874420-110874442 AGGGAGGGAGGGAGGGAAGCAGG - Intergenic
1089029382 11:115308767-115308789 ATGAAGGGAGGGAGGGAAGGAGG - Intronic
1089202245 11:116731562-116731584 AGGTGAGCAGGGAGAGAAGATGG + Intergenic
1089219428 11:116858513-116858535 ATGTGCACTGGGAGGGAAGGTGG + Exonic
1089255705 11:117192805-117192827 ATGCGGTCCTGGAGGGAAGCAGG - Exonic
1089559438 11:119336427-119336449 GGGTGGGCAGGCAGGGAAGGAGG - Exonic
1089561920 11:119347415-119347437 AGTTTGGCAGGGAGGGAAGTGGG + Intergenic
1089759966 11:120716008-120716030 ATGTGGGCAGTGGGGGAAGGCGG + Intronic
1090374603 11:126279994-126280016 AGGGGGCCAAGGAGGGAAGCTGG + Intergenic
1090406570 11:126479308-126479330 AGGTTGGGAGGGAGGGAGGCAGG - Intronic
1091304889 11:134530579-134530601 ATGCGGACGGGGAGGGAAGAGGG - Intergenic
1202820209 11_KI270721v1_random:66010-66032 ACATGGGGAGGGAGGGAGGCAGG - Intergenic
1091449457 12:563316-563338 GTGTGGGCAGGGCAGGAGGCTGG - Exonic
1091490644 12:929743-929765 AGGTGAGCAGGTAGGGAAGTAGG - Intronic
1091564675 12:1639654-1639676 ATGAGGCCAGGGCGGTAAGCGGG - Intronic
1091712494 12:2752007-2752029 ATGTGGGAAAGCAGGGGAGCTGG - Intergenic
1091787044 12:3249349-3249371 TGGTGGGCAGGAAGGAAAGCAGG - Intronic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1091856633 12:3745955-3745977 ATGGGGTCAGGGAGGTCAGCGGG - Intronic
1091996185 12:4995974-4995996 ATGTGGGAGGGGATGGAAACGGG + Intergenic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092288090 12:7141439-7141461 ATTTGGGAAGGGAGGTAGGCTGG + Intronic
1092427417 12:8385948-8385970 ATGTGGGCAGGCAGGGTAGGTGG - Intergenic
1092789064 12:12056172-12056194 TTGTGGTCAGGGAGAGAAACTGG - Intronic
1092968903 12:13672578-13672600 CTGTGGGCAGGGAGGATGGCAGG - Intronic
1093385765 12:18551428-18551450 ATGTGGGAGGGGAGGTAGGCAGG - Intronic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094172329 12:27506584-27506606 ATGTGGGCAAGGGTGGAATCAGG - Intergenic
1094491326 12:30962764-30962786 ATGGGGGCAGGGAGACTAGCGGG + Intronic
1095752629 12:45729072-45729094 AGGCTGGCGGGGAGGGAAGCAGG + Intergenic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095943711 12:47741629-47741651 GTGGGGGAAGGGAGGGAGGCCGG + Intronic
1096179753 12:49544147-49544169 ATGCGGGGAGGGAGGGAGGGAGG - Intronic
1096417379 12:51425380-51425402 ACGTGGGCAGAAAGGGTAGCAGG + Intronic
1096580307 12:52580796-52580818 GTGGGCCCAGGGAGGGAAGCTGG - Intergenic
1096677204 12:53232250-53232272 AGTTGGGCAGGGAGGGAGGTTGG - Exonic
1096746797 12:53734051-53734073 ATGTGGGCAATGAAGGAAACAGG + Intergenic
1096871706 12:54596656-54596678 ATGAGTCCAAGGAGGGAAGCAGG - Intergenic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097323694 12:58252511-58252533 AAATAGGCAGGGAGGGAAGGAGG - Intergenic
1097737136 12:63194772-63194794 AAGTGGCCAGGGAGGGGAGATGG - Intergenic
1099182274 12:79482524-79482546 AGGTGGGGAGGAAGGGAAGGTGG + Intergenic
1099763801 12:86956116-86956138 ATGTGGGGAAGGAGGGCATCAGG - Intergenic
1099943414 12:89217415-89217437 AGGTGGGCAGGCAGGCAGGCAGG + Intergenic
1101148185 12:101861521-101861543 AGGGGGGGAGGGAGGGAAGGAGG - Intergenic
1101348287 12:103905626-103905648 AGGAGGGGAGGGAGGGAAGGAGG + Intergenic
1101574364 12:105983805-105983827 CTGTGGTCAGGGAGGGAATCAGG + Intergenic
1101609117 12:106274447-106274469 AGGTGGGGAGGGAGGGTTGCTGG - Intronic
1101716569 12:107318154-107318176 ATGCGGGCAGGGACAGCAGCAGG + Intergenic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1102164356 12:110794824-110794846 AGGTGGGCTGGGTGGGAGGCAGG + Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102237679 12:111304333-111304355 AAGTGAGCAGGGAGGGCAGAGGG + Intronic
1102483996 12:113243925-113243947 ATGTAGGCAGGGAGAGGGGCTGG - Intronic
1102670935 12:114618212-114618234 AAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1102792554 12:115659466-115659488 ATGGGGGCAAGGAGAAAAGCAGG - Intergenic
1103040348 12:117690036-117690058 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1103462204 12:121113954-121113976 ATGGGGGCAGGGATGGCGGCGGG - Intergenic
1103735629 12:123059096-123059118 ATCTAGGCAGGGAGAGAACCAGG + Intronic
1104348992 12:128028661-128028683 CTGTGGGCAGGGCGGGAATGTGG + Intergenic
1104388579 12:128372694-128372716 ATGTGGGCTGAGAGAGAAGTTGG + Intronic
1104414827 12:128589404-128589426 GTGTGGGTTGGGAGGGAGGCAGG - Intronic
1104466373 12:128994073-128994095 AAGGGGGCAGGAAGGGAAGATGG - Intergenic
1104475098 12:129064542-129064564 AGGAGGGCAGGCAGGGCAGCTGG + Intergenic
1104498809 12:129265539-129265561 ATGAGGGCCGGGAGGGACACCGG - Intronic
1104738343 12:131153843-131153865 ATGTGAGCAGGCTGGGCAGCAGG - Intergenic
1104916422 12:132267189-132267211 ATGAGGGCAGGGAAGGAGGCAGG + Intronic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105940970 13:25147692-25147714 CTGGGGGTAGGGAGGGAATCAGG + Intergenic
1106124604 13:26890026-26890048 AGGGGGACAGGGAAGGAAGCTGG + Intergenic
1106283907 13:28302597-28302619 ATGTGGGCACGGAGGGGGACGGG - Exonic
1106512280 13:30422000-30422022 ATGTGGGAGGGGAGAGAAGGAGG + Intergenic
1106578578 13:30998870-30998892 CTGTGGGCAGGGAGGAGAGCAGG + Intergenic
1106847846 13:33755942-33755964 ATGTGGTTAGGGAGGCAGGCAGG - Intergenic
1107410721 13:40156035-40156057 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1107448964 13:40491630-40491652 ATGTTTGCAGGGAGGCAAGAAGG + Intergenic
1108068979 13:46607949-46607971 CTGAGGGCAGGGAGGGATGTGGG + Intronic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1110508133 13:76314392-76314414 ATATGGGCAGAGAGGGAAAAGGG + Intergenic
1110641526 13:77830203-77830225 AGGGGGGGAGGGAGGGAAGAAGG - Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111623218 13:90750447-90750469 GTGTAGGCAGGGAGGACAGCAGG - Intergenic
1112465703 13:99642733-99642755 AGGGAGGGAGGGAGGGAAGCAGG - Intronic
1112759118 13:102673030-102673052 AAGTGGGCAGGGAGGCAATGTGG - Intronic
1113476951 13:110590747-110590769 AGGAGGGCAGGGCGGGAAGGTGG - Intergenic
1113504514 13:110806013-110806035 TTGTGGGCAGAGAGGGAAAGTGG + Intergenic
1113600276 13:111563450-111563472 GTGAGGGGAGGGAGGGAAACAGG - Intergenic
1113663055 13:112120161-112120183 ATGAGGGAAGGGTGGGAGGCAGG + Intergenic
1113698327 13:112364588-112364610 ATCTGGGAAGGGAGGGAACAGGG + Intergenic
1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG + Intergenic
1113754744 13:112803715-112803737 AGGAGGTCAGGGAGGGAAGGAGG - Intronic
1113942405 13:114025111-114025133 GGGGGGGCAGGGAGGGAGGCCGG - Intronic
1114276871 14:21154622-21154644 AGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1114550722 14:23531431-23531453 AGCTGGGCAGGGAGGGCAGCAGG - Intronic
1115079143 14:29429451-29429473 TTGTTGGCTGGGAGGGAGGCAGG - Intergenic
1116890654 14:50264727-50264749 AAGTGGGGAGGGAGGGAGGAAGG + Intronic
1116982943 14:51190537-51190559 ATCTGGGCAGGGAGGAATGAGGG - Intergenic
1117395930 14:55310616-55310638 ATGTTGGCAGGCAGGCAGGCAGG - Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118916798 14:70114587-70114609 ATGGGGGCAGGGAGGAGAGATGG - Intronic
1119463912 14:74837714-74837736 ACCAGGGCAGGGTGGGAAGCTGG + Intronic
1119483232 14:74973007-74973029 ATGTTGCCAGGGAGGGCTGCAGG + Intergenic
1120077319 14:80173296-80173318 CTCTTGGCAGGGAAGGAAGCAGG + Intergenic
1120368496 14:83602374-83602396 TTGTGGGGAGGGAGGGCATCAGG - Intergenic
1120844892 14:89117037-89117059 TTGTGGACAGGGAGGGAAATTGG - Intergenic
1121209066 14:92193003-92193025 ATGTGGGATGGGAGGGGAGGCGG + Intergenic
1121221391 14:92288235-92288257 AAGTGGCCAGGGAGGCAAGCTGG - Intergenic
1121316558 14:92964403-92964425 GGGTGGGGAGGGAGGGGAGCTGG + Intronic
1121444740 14:93971372-93971394 ATGTGAGCAGAGAGGGCAGGGGG - Intronic
1121587909 14:95076406-95076428 ATGGGGTCAGGGAGTGAAGTGGG - Intergenic
1121681978 14:95801364-95801386 ATTAGGCCAGGGAGGCAAGCTGG + Intergenic
1122029336 14:98901210-98901232 ATAAGGGCTGGGAGGGAAGAGGG - Intergenic
1122542434 14:102505789-102505811 CTGGGGGCAGGGTGGGCAGCAGG + Exonic
1122596836 14:102899582-102899604 AGCTGGCCAGGAAGGGAAGCAGG - Intronic
1123173958 14:106400307-106400329 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1123182167 14:106481241-106481263 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1202895094 14_GL000194v1_random:2204-2226 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1202944736 14_KI270726v1_random:15489-15511 ACCTGGGCAGGAAGGGAAGAGGG + Intergenic
1124056663 15:26246486-26246508 ATGTGGGGAGGGAGGAAATGAGG - Intergenic
1124119222 15:26874949-26874971 ATGTGGACAGAGATCGAAGCCGG - Intronic
1124398078 15:29322771-29322793 AAGTGGGCAGGAAGGGAAGGAGG - Intronic
1124651563 15:31477881-31477903 AGGTGGGTAGGGAGGGAGGGTGG + Exonic
1125991552 15:44113689-44113711 AAGTGGGGAGGAGGGGAAGCGGG - Intronic
1126235955 15:46384481-46384503 ATGTGGCCAGGGGGAGAAGGGGG - Intergenic
1126475939 15:49065243-49065265 AAGAGTGCAGGGAGAGAAGCAGG + Intergenic
1127353183 15:58172888-58172910 ATCTGAGCAGGGAGAGAAGGAGG - Intronic
1127832769 15:62765392-62765414 CTGTGGGCCGGGAGGGATGCGGG - Intronic
1128155382 15:65388643-65388665 AGGTGGGCAGGGAGGGGACTGGG + Intronic
1128220296 15:65964161-65964183 AAGCGGGCAGGGAGGGGAGCTGG + Intronic
1128332268 15:66763496-66763518 AGGTGGGCAGGGGGCCAAGCTGG - Intronic
1128603825 15:69019284-69019306 AAGGGGGCAGGGAGGGATGTAGG + Intronic
1128729868 15:70013889-70013911 GTGTGGGCAGGGAGAGAGGGAGG + Intergenic
1128793379 15:70449044-70449066 ATGGAGGGAGGGAGGGAGGCAGG + Intergenic
1128793389 15:70449064-70449086 AGGGGGGCAGGGAGGGATGGAGG + Intergenic
1128982587 15:72197933-72197955 AGGTGGGGAAGGAGAGAAGCTGG - Intergenic
1128998399 15:72313603-72313625 ACGTGAGCATGGAGGGAAGCTGG - Intronic
1129137483 15:73567665-73567687 AAGCGGGCAGGGGTGGAAGCAGG + Intronic
1129194380 15:73955445-73955467 AAGAGGACAGGGAGGGATGCTGG - Intergenic
1129384091 15:75185978-75186000 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1129686387 15:77688445-77688467 ATGGGGAGAGGGAGGGAAGAGGG + Intronic
1129914987 15:79260908-79260930 ATGAGGGCAGGGAGAGAAAAAGG + Intergenic
1129937509 15:79463163-79463185 ATGTGGGCCTTGAGGGAGGCAGG - Exonic
1129949194 15:79571253-79571275 ATGTAGAGAGGGAGGGAAGGGGG - Intergenic
1130027704 15:80284075-80284097 AGTTTGGAAGGGAGGGAAGCTGG - Intergenic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130972210 15:88741964-88741986 ATCTGGGCCGGGAGGGGTGCGGG - Intergenic
1130978026 15:88792188-88792210 ATGAGGGGAGGGAGGCAGGCAGG + Intergenic
1131016397 15:89061082-89061104 AAATGGGGAGGGAGGGAAGGAGG + Intergenic
1131177883 15:90221247-90221269 TGGTGGGCAGAGAAGGAAGCTGG - Intronic
1131687992 15:94792042-94792064 AGCTGGGCAGAGAGGGAAGTTGG + Intergenic
1132066096 15:98732498-98732520 GTCTGGGGAAGGAGGGAAGCTGG + Intronic
1132081992 15:98874097-98874119 ATGTGGACAGGGCGGGCAGGAGG + Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132524124 16:405949-405971 ACGTGGTCAGGAAGGGGAGCAGG + Intronic
1132700104 16:1218672-1218694 ATATGGGCTGGGTGGGAAGCAGG + Intronic
1133304328 16:4800297-4800319 ATGTGGGGAGGTAGAGAACCTGG - Intronic
1133370829 16:5244430-5244452 ATGTGGGCAGGCAGGGTAGGTGG + Intergenic
1133531892 16:6663081-6663103 AAGTGGGCAGGGATGGATACAGG + Intronic
1133839271 16:9394057-9394079 AGGGAGGAAGGGAGGGAAGCAGG - Intergenic
1133839430 16:9394540-9394562 AGGGTGGAAGGGAGGGAAGCAGG - Intergenic
1133839442 16:9394572-9394594 AGGGTGGAAGGGAGGGAAGCAGG - Intergenic
1133839454 16:9394604-9394626 AGGGTGGAAGGGAGGGAAGCAGG - Intergenic
1134030771 16:10990605-10990627 CAGTGGGCAGGGATGGGAGCAGG + Intronic
1134084720 16:11348569-11348591 AGGGAGGCAGGGAGGTAAGCGGG + Intronic
1134207210 16:12248048-12248070 ATGAAAGCAGGGAGGGCAGCGGG - Intronic
1134219903 16:12345721-12345743 ATGTGGGCACAGTGGGAAGGTGG + Intronic
1134384212 16:13756898-13756920 ACTTGAGGAGGGAGGGAAGCCGG - Intergenic
1134504001 16:14790798-14790820 CTGAGGTCAGGGAGGGAGGCAGG + Intronic
1134576571 16:15338110-15338132 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134634813 16:15784242-15784264 ATGATGGCAGGGAGAGAAGAGGG + Intronic
1134725868 16:16418389-16418411 CTGAGGTCAGGGAGGGAGGCAGG + Intergenic
1134793720 16:17014725-17014747 ACTTGAGCAGGGAGGGAAGGAGG - Intergenic
1134839846 16:17393034-17393056 AAGTGGGCAGGAGGGGAAGGAGG - Intronic
1134941565 16:18293470-18293492 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1135049993 16:19185074-19185096 AAGCGGGAAGGGAGGGAAGGAGG - Intronic
1135155589 16:20050211-20050233 ATGTGTGCAGTGATGGGAGCGGG + Intronic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135269462 16:21056437-21056459 GTATGGGAAGGGAGGGAGGCAGG - Intronic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1135860529 16:26051865-26051887 AGGGAGGCAGGGAGGGAGGCAGG - Intronic
1135869556 16:26136804-26136826 ATGTGGGGAGGGAGGAAGTCAGG - Exonic
1135927654 16:26709744-26709766 AAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1136285578 16:29238501-29238523 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1136403436 16:30030539-30030561 ACTTGGGCAGGGAGGCAGGCGGG + Exonic
1136984389 16:35085137-35085159 AGGTGGAAAGTGAGGGAAGCTGG + Intergenic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137679699 16:50329670-50329692 CTGTGGTCAGGAAGGGCAGCCGG + Intronic
1137679967 16:50332981-50333003 AAGGGGGCAGGGAGGGAAGGGGG + Intronic
1137739468 16:50753492-50753514 ATGGAGGCAAGGAGAGAAGCTGG - Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1138174378 16:54883405-54883427 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1138344462 16:56311622-56311644 ATGTCAGCAGGGAGGGAGGAGGG - Intronic
1138370756 16:56524603-56524625 ATTTGGGCAGGGAGGCCACCTGG + Intergenic
1138540293 16:57683782-57683804 CTGCCGGCAGGGATGGAAGCTGG + Intronic
1138583390 16:57955985-57956007 ATGGGGACAGGGAGAGGAGCTGG - Intronic
1139398229 16:66658214-66658236 AGGTAGGGAGGGAGGGAAGGAGG + Intronic
1139517532 16:67460653-67460675 ATGGGGGGAGGGGGGAAAGCTGG - Intronic
1140213900 16:72992331-72992353 ATGGGGGAAGGCAGGGAAGCTGG - Intronic
1140245662 16:73245763-73245785 AGGTGAGCAGAGAGGGTAGCTGG + Intergenic
1140469549 16:75206512-75206534 AGCTGGGCAGGGAGGGAGCCAGG - Intronic
1140476062 16:75239768-75239790 AGCTGGGGAGGGAGGGGAGCGGG - Intronic
1140729128 16:77840262-77840284 AGGTGGGGAGGCAGGGAGGCAGG + Intronic
1141094883 16:81156078-81156100 ACCTGGGAAGGGAGGGAAGGAGG - Intergenic
1141233956 16:82198021-82198043 CTGTCGGCAGGGAGGTCAGCGGG + Intergenic
1141427171 16:83951967-83951989 AAGGAGGTAGGGAGGGAAGCAGG - Intronic
1141427212 16:83952075-83952097 AGGCAGGGAGGGAGGGAAGCAGG - Intronic
1141475124 16:84267756-84267778 CTGAGGTCAGGGAGGGAACCTGG + Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141610587 16:85178876-85178898 GGGTGGGCAGGGAGGGATGAGGG + Intronic
1141630301 16:85284004-85284026 ATGGGGGCGGGGAGGGAGGCAGG + Intergenic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141699976 16:85637918-85637940 GAGGGGGCAGGGATGGAAGCAGG + Intronic
1141718515 16:85741391-85741413 AGGAAGGCAGGGAGGGAAGGAGG + Intronic
1141841090 16:86574582-86574604 AAGTGGGCGGGGAGGGAAGGAGG + Intergenic
1142090911 16:88208653-88208675 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1142235382 16:88920065-88920087 ATCTGGGGAAGGAGGGAGGCAGG - Intronic
1142271397 16:89091463-89091485 ATGTGGTGTGGGAGGGAAGCAGG + Intronic
1142299295 16:89247315-89247337 GTGGGGGCAGGGAGGGCGGCGGG + Intergenic
1142359530 16:89619664-89619686 AGGGGTGCAGGGAGGGGAGCAGG - Intronic
1142730186 17:1849120-1849142 CTGTTGGCAGGGAGGTAAACTGG - Intronic
1143096429 17:4480850-4480872 AGGTGGGAAGGCAGGGAAGGGGG - Intronic
1143239680 17:5433518-5433540 AGGTGGGGAGTGAGGGAAGAGGG - Intronic
1143278376 17:5731456-5731478 AGGTGGGATGGGAGGGAAGGAGG + Intergenic
1143375251 17:6463408-6463430 ACGAGTGCAGGGAGGGAGGCAGG + Intronic
1143375256 17:6463420-6463442 AGGGAGGCAGGGAGGGAAGGAGG + Intronic
1143375263 17:6463440-6463462 AGGGAGGCAGGGAGGGAAGAAGG + Intronic
1143453382 17:7050328-7050350 AGGTGGACAGGGAGGGAGGCGGG + Intergenic
1143465123 17:7131384-7131406 ATGGGGCCAGAGAGGGAGGCAGG + Intergenic
1143610421 17:8014783-8014805 GGGTGGGCTGGGAGGGCAGCTGG + Intronic
1143801516 17:9386534-9386556 AAGTCAGGAGGGAGGGAAGCAGG + Intronic
1144124957 17:12194631-12194653 ATGGGGAAAGGGTGGGAAGCAGG + Intergenic
1144136361 17:12299023-12299045 AGGTAGGCAGGGAAGGTAGCAGG - Intergenic
1144275960 17:13668187-13668209 CTGGGAGCAGGGAGTGAAGCTGG - Intergenic
1144764759 17:17726281-17726303 GTGTGGGAAGGGTGGGGAGCAGG - Intronic
1144796343 17:17893814-17893836 ATGTGGGGAGGGAAGGAAAAGGG + Intronic
1145066088 17:19762298-19762320 ATGTGGGCAGAGACGCAGGCAGG - Intergenic
1145278763 17:21453623-21453645 ATGTGGGCTGGGAGGGGACACGG - Intergenic
1145733276 17:27209912-27209934 GGGAGGGGAGGGAGGGAAGCAGG - Intergenic
1146086333 17:29833714-29833736 AAGTAGGGAGGGAGGGAAGGAGG - Intronic
1146548231 17:33757426-33757448 ATCCAGCCAGGGAGGGAAGCTGG - Intronic
1146820903 17:35983001-35983023 ATGGATGGAGGGAGGGAAGCAGG - Intergenic
1147327694 17:39677605-39677627 AGGGGGGCAGGGAGGGGAACTGG + Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147487679 17:40833481-40833503 AGCAGGGGAGGGAGGGAAGCAGG - Intronic
1147611988 17:41807240-41807262 ATGAAGGTAGGGAGGGGAGCAGG + Intronic
1147742081 17:42675499-42675521 GAGGGGGGAGGGAGGGAAGCAGG - Intronic
1147979036 17:44263428-44263450 ATGGGGTCAGGGAGAGAAGTAGG - Intronic
1147979094 17:44263689-44263711 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
1148113461 17:45161130-45161152 ATGGGGGTGGGGAGGGAAGCTGG + Intronic
1148226340 17:45900328-45900350 ATCTGGGCAGGCAGGGAACCTGG - Intronic
1148236329 17:45971676-45971698 GTGTTGGCAGGGAGGGAGGTGGG + Intronic
1148382504 17:47210062-47210084 GTGAGGGCAGGGTGGGAAGGAGG + Intronic
1148630655 17:49105750-49105772 AAGGGGGCAGGGAGGGACCCAGG + Intergenic
1148645307 17:49216787-49216809 ATTTGGACATGGAGGAAAGCAGG - Intronic
1149896378 17:60431672-60431694 AGGTGGGGAGGGAGGGAGCCTGG + Intergenic
1150021647 17:61621203-61621225 ATGGTGGCAGGGAGGGAAATGGG - Intergenic
1150045538 17:61909551-61909573 ATGTTGGGAGGGTGGGAAGGGGG - Intronic
1150177061 17:63068967-63068989 ATTTGGGGAGGGATGGAAGAAGG + Intronic
1151169753 17:72236614-72236636 GGGGGGGCAGGGAGGGAGGCAGG + Intergenic
1151229570 17:72674147-72674169 ATGTGGCAAGGGAGGGAAGGAGG - Intronic
1151376820 17:73694837-73694859 ATGTGGAGAGAGAGGGCAGCTGG - Intergenic
1151509525 17:74549774-74549796 ATGAGGACAGGGAGGGATCCAGG + Intergenic
1151893289 17:76963784-76963806 AGGGGAGCAGGGAGAGAAGCCGG - Intergenic
1151951486 17:77356670-77356692 ATGTGGGGGGGGAGGGGAGGGGG - Intronic
1152026781 17:77815102-77815124 AAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152271002 17:79324834-79324856 CTCTGGGCAGGCAGAGAAGCAGG + Intronic
1152337593 17:79707237-79707259 ACGTGGGCAGGGGAGGAAGAAGG - Intergenic
1152471199 17:80490928-80490950 ATGTTGGCAGGGAGGGGCGGGGG + Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152888003 17:82863836-82863858 ATGGGGGCAGAGAGGGTAGCAGG + Intronic
1153556691 18:6322420-6322442 ATGGAGGCAGGGAGGGAGGAAGG + Intronic
1153802037 18:8679844-8679866 AAGGGGGCAGGGAGTGAAGTAGG + Intergenic
1153808105 18:8727875-8727897 AGGGAGGGAGGGAGGGAAGCAGG - Intronic
1154315940 18:13303457-13303479 AGGAGGGCAGGGAAGGAAACGGG - Intronic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1154508694 18:15069859-15069881 AGGTGGGCTGGGAGGGAAAGGGG - Intergenic
1154515319 18:15157893-15157915 AGGAAGGCAGGGAGGGAGGCTGG - Intergenic
1155095336 18:22549856-22549878 ATGTGGGAAGGGAGGGAGAGAGG + Intergenic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1155162329 18:23206138-23206160 CGGTGGGCAGGGAGGAAGGCAGG - Intronic
1155336504 18:24770433-24770455 ATGTGGGTAGGGTAGGAGGCAGG - Intergenic
1155595424 18:27480579-27480601 ATTTGGGAATGGAGGGAAACCGG + Intergenic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157395389 18:47336772-47336794 GTGTGGACAGGGAGGGAAGTGGG + Intergenic
1157576678 18:48748355-48748377 ATGAAGGGAGGGAGGGAAGGAGG + Intronic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1159134302 18:64318981-64319003 ATGGAGGGAGGGAGGGAGGCAGG - Intergenic
1159442048 18:68493827-68493849 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1159944255 18:74432074-74432096 ATGTGGGCAGGGGGGTAAATTGG + Intergenic
1159951877 18:74489999-74490021 ATGTAGGGAGGGAGGGAGGGAGG + Intergenic
1160159754 18:76462015-76462037 ATGTGGGAAGGGTGGGAGCCAGG - Intronic
1160356139 18:78229672-78229694 ATGGAGGGAGGGAGGGATGCAGG - Intergenic
1160363122 18:78301124-78301146 AGGTGGGGAGGGCGGGAAGGAGG - Intergenic
1160391470 18:78536707-78536729 AGGGAGGGAGGGAGGGAAGCAGG + Intergenic
1160517424 18:79486392-79486414 CTGCGGACAGGGCGGGAAGCCGG - Exonic
1160859887 19:1233316-1233338 TTGTGGGCTGGGTGGGGAGCCGG - Intronic
1161041618 19:2113497-2113519 CTGGGGGCAGCGAGGGCAGCTGG - Intronic
1161201024 19:3014798-3014820 ATGTGGGGAGGCAGGGCAGGTGG + Intronic
1161758903 19:6156290-6156312 AGTTGGGGAGGAAGGGAAGCTGG + Intronic
1161913912 19:7214848-7214870 AGGTGGGGACGGAGGGAAGAAGG - Intronic
1161995852 19:7710794-7710816 AAGGAGGCAGGGAGGGAAGGAGG - Intergenic
1162104713 19:8363493-8363515 AGGTAGGGAGGGAGGGAAGAAGG - Intronic
1162242687 19:9368136-9368158 ATCTGGGCAGTGAGTTAAGCTGG + Intronic
1162671289 19:12259935-12259957 AAGAGGACAGGGAGGGAAGGTGG - Intronic
1162765013 19:12913911-12913933 ATGTGCGAGGAGAGGGAAGCTGG + Intronic
1162791738 19:13066535-13066557 CTGTGAGCAGGGAGGGAATGAGG + Intronic
1162865321 19:13541630-13541652 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
1163169229 19:15519163-15519185 ATGTGGGCACAGAGGAAAGGGGG + Intronic
1163234464 19:16022769-16022791 GTGTGGGCAGGAGGGGATGCAGG - Intergenic
1163301475 19:16449995-16450017 AGATGGGCTGGGAGGGAAGTGGG + Intronic
1163318075 19:16555115-16555137 GGCTGGGCAGGGAAGGAAGCCGG - Intronic
1163381061 19:16969120-16969142 ATCTGGGCAGGGTGAGAACCTGG - Intronic
1163491892 19:17621733-17621755 ACCTGGGCAGGAAGGGCAGCTGG - Intronic
1163633293 19:18427653-18427675 ATCTGGGCAGGGAGGGAGTGGGG - Intronic
1163731475 19:18951999-18952021 ATGTAGGCAGGGAGGGCTACAGG + Intergenic
1164400788 19:27900785-27900807 AGGTGGGCAGCAAGGGAGGCTGG - Intergenic
1164646138 19:29859889-29859911 ATGGGGACTCGGAGGGAAGCTGG - Intergenic
1164683427 19:30150922-30150944 ACATGGGCAGGCAGGGAGGCCGG + Intergenic
1164848192 19:31452380-31452402 AGGTGGACAGGGAGGGATGAGGG + Intergenic
1164926345 19:32132764-32132786 ATGTGGCCAGAGAGGACAGCAGG + Intergenic
1164975629 19:32570953-32570975 AGGTAGGAAGGGAGGGAAGGAGG - Intergenic
1164976184 19:32574427-32574449 ATGAGGGGAGGGAGGGAAATTGG - Intergenic
1165386317 19:35512536-35512558 ATGTGGGCTTGGAGGGAGGGAGG + Intronic
1165487667 19:36105158-36105180 AAGTGGGGAGGGAGGGTAGAAGG + Intergenic
1165797134 19:38525930-38525952 GTCTTGGCAGGGAGGGAAGGAGG - Intronic
1165811183 19:38612778-38612800 ATGGGGACAGGAAGGGAAGGAGG + Intronic
1166012284 19:39951359-39951381 CTAAGGGCAGGGTGGGAAGCAGG - Intergenic
1166094438 19:40530403-40530425 AGGCGGGCAGGGAGGCAGGCAGG + Intronic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166302293 19:41918110-41918132 ATGTGGGCAGTGTGGGAATGGGG - Intronic
1166709097 19:44925719-44925741 ATGTGGTGATGGTGGGAAGCAGG + Intergenic
1166719298 19:44988238-44988260 ATGTGGGGAGGGAGGGGAGGAGG - Intronic
1166876845 19:45902629-45902651 AAGAGGGGAGGGAGGGAGGCGGG - Intergenic
1167436520 19:49481563-49481585 AGGTGGGCCAGGAGGGAAGAAGG + Intronic
1167587410 19:50382829-50382851 AGCTGGGGAGGGAGGGCAGCCGG - Exonic
1167656445 19:50767434-50767456 GTGAAGGCAGAGAGGGAAGCGGG - Intergenic
1168167508 19:54561107-54561129 ATGGGGGCAGGAATGCAAGCTGG + Intergenic
1168288135 19:55344585-55344607 ATTTGGGCAGGGAGTGTGGCAGG + Intronic
1168297950 19:55386830-55386852 AAGTCGGCCGAGAGGGAAGCCGG - Intronic
1168323620 19:55525737-55525759 GTGTGGGCACGGCGGGAACCTGG + Intergenic
925131796 2:1499012-1499034 ATTTGGGCAAGGAGAGACGCAGG - Intronic
925199201 2:1952758-1952780 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925428697 2:3772551-3772573 ATGTGGGCAGGGAGGGTCGGAGG + Intronic
926016939 2:9461718-9461740 AGGTGTGCAGGGTGGGAAGGAGG + Intronic
926079502 2:9972947-9972969 ATGTGGGCGGTGTGGGAAGGTGG + Intronic
926842774 2:17101010-17101032 ATGGGAGAAGGGAGGGACGCAGG + Intergenic
927148647 2:20183233-20183255 ATGAGGGGAGGGAGGAGAGCAGG + Intergenic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
927945723 2:27134176-27134198 AAGTGGGCAGGGCCCGAAGCTGG + Intronic
928174471 2:29024469-29024491 AGGGAGGGAGGGAGGGAAGCAGG + Intronic
928494403 2:31817449-31817471 AAGTGGGCAAGGAGGGAGGTGGG - Intergenic
928498600 2:31862940-31862962 AGGTGGGGAGGGAGGGAGGGAGG + Intergenic
928535122 2:32232666-32232688 ATGTTTGCAGGGATGGAAGATGG + Intronic
929171129 2:38934476-38934498 ATGGAGGGAGGGAGAGAAGCGGG - Intronic
929576474 2:43055792-43055814 AGCAGGGCAGTGAGGGAAGCGGG + Intergenic
929866361 2:45720564-45720586 ATGTGGGCAAAGAGGGATACTGG - Intronic
929930551 2:46252408-46252430 ATTTGGGCCTGGGGGGAAGCAGG + Intergenic
930016162 2:46971957-46971979 AGGTAGGGAGGGAGGGAGGCAGG + Intronic
930025848 2:47028745-47028767 ATGTGGGCACAGTGGGAATCTGG - Intronic
930206696 2:48594090-48594112 AAATGGGCAGAGAGAGAAGCTGG - Intronic
930365429 2:50433715-50433737 AGTTGGGGAGGGAGGGAAGGTGG + Intronic
930601748 2:53451818-53451840 AAGGGGGCAGGGAGGGAACGGGG - Intergenic
930694201 2:54394696-54394718 ATGTGTGGAGGGAGGGAGGGAGG - Intergenic
930770160 2:55122574-55122596 ATGTGAGCAGGAAGATAAGCTGG + Intergenic
930919856 2:56739405-56739427 AAGAGAGAAGGGAGGGAAGCAGG - Intergenic
931277612 2:60756998-60757020 TTGTGGGTAGGTGGGGAAGCAGG - Intronic
931289012 2:60856158-60856180 ATGGGGGAAGGGAGGACAGCAGG + Intergenic
931391676 2:61849966-61849988 AGGTGGGGAGGGAGGGAGGGAGG + Intronic
931556971 2:63516917-63516939 ATGAGGACAGGGAGAGAAACAGG + Intronic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932172842 2:69573146-69573168 ATGTGGGCTGGGGAGGAAGGTGG + Intronic
932278562 2:70470175-70470197 AAGAGGGGAGGGAGGGAAACAGG + Intronic
932488813 2:72105305-72105327 CTGTGGGGAGGCTGGGAAGCAGG - Intergenic
932539376 2:72636290-72636312 AAGAAGGCAGGGAGGGAGGCAGG + Intronic
932852750 2:75201961-75201983 ATGGAGGCAGGGAGAGAAGGCGG - Intergenic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
933206497 2:79513240-79513262 AGGTGGGGAGGGAGGGAGGCAGG - Intronic
933345976 2:81086228-81086250 AGGGAGGGAGGGAGGGAAGCAGG - Intergenic
933941825 2:87251588-87251610 ATGTGGGCAGAAAGAGGAGCTGG - Intergenic
934064616 2:88329484-88329506 ATGGGTACAGGGAGGGAAGCAGG - Intergenic
934118525 2:88818187-88818209 TTCTGGGCAGGGAGGGATCCTGG - Intergenic
934753696 2:96810641-96810663 ATGTGGGAAGCCACGGAAGCAGG + Exonic
935210861 2:100938554-100938576 AAGGGGGGAGGGAGGGAAGGAGG - Intronic
935326914 2:101945920-101945942 ATGGGGGTAGGGTGGGGAGCTGG - Intergenic
935626249 2:105174492-105174514 ATGGGGGCTGGGAGGGAAGGAGG + Intergenic
936162075 2:110091516-110091538 TTCTGGGCAGGGAGGGATCCTGG - Intronic
936182587 2:110279838-110279860 TTCTGGGCAGGGAGGGATCCTGG + Intergenic
936338398 2:111609981-111610003 ATGTGGGCAGAAAGAGGAGCTGG + Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937293724 2:120797549-120797571 ATGTCGTCAGGGAGGCATGCTGG + Intronic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937338384 2:121075881-121075903 AGGTGGGCAGGGAGGCGAGCTGG - Intergenic
937479201 2:122241544-122241566 ATGGGGGGAGGGAGGAAAGGAGG + Intergenic
937851135 2:126637532-126637554 AGGTGGCCAGAGACGGAAGCAGG + Intergenic
938093477 2:128447764-128447786 ATGGGGGCAGGAAGGGGGGCGGG + Intergenic
938493096 2:131776197-131776219 CTGTGGGCTGGGACGGCAGCTGG - Intergenic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
938730505 2:134143386-134143408 AAGTGGGCAGGGAGTGAAGTGGG + Intronic
938782020 2:134593204-134593226 ATTTAGACAGGGAGGGAAGGGGG + Intronic
938806639 2:134812391-134812413 ATTTTGGCATGGAGGGAAACTGG - Intergenic
938828570 2:135031648-135031670 ATGTGGGGAAGAAGGGAAGTGGG + Intronic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
939255425 2:139738129-139738151 ATGTCAGCAGGGTAGGAAGCAGG + Intergenic
940329009 2:152454666-152454688 ATGTGGGCAGAAAGGGATGCTGG + Intronic
940667406 2:156625590-156625612 ATGTGGGGAGGTAGGGAGGAAGG + Intergenic
940966204 2:159839707-159839729 ATGTTGAAAGGGATGGAAGCTGG + Intronic
941072058 2:160966671-160966693 ATCAGGGCAGGGAGAGGAGCAGG + Intergenic
942325464 2:174772637-174772659 ATGAAGGAAGGGTGGGAAGCAGG - Intergenic
943499199 2:188666032-188666054 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943499228 2:188666112-188666134 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943499242 2:188666161-188666183 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
944217965 2:197274625-197274647 ATGTAGGAAGGGAAGGACGCAGG - Intronic
944352179 2:198742113-198742135 ATGGAGGCAGGCAGGGAAGGAGG - Intergenic
944361749 2:198865332-198865354 GGGTGGGCAGGGAGGGCAGCTGG - Intergenic
944651743 2:201837403-201837425 AGGTGGGGAGGGAGGGAGGGAGG + Intronic
944841444 2:203627828-203627850 AGGTGGGGAGGGTGGTAAGCTGG - Intergenic
945139330 2:206667209-206667231 ATGAGGTCAGAGAGGGAAGGGGG - Intronic
945170427 2:206989493-206989515 ATGGGGACAGGGAGGGAGGTGGG + Intergenic
945364381 2:208933522-208933544 AGTTGGGCAGGGAGGTAAACTGG - Intergenic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
945929733 2:215842809-215842831 AGAGGGGCAGGGATGGAAGCTGG - Intergenic
946121906 2:217523490-217523512 GCCTGGGAAGGGAGGGAAGCTGG + Intronic
946141921 2:217698665-217698687 TTCTGGAGAGGGAGGGAAGCGGG + Intronic
946299655 2:218814783-218814805 GTGTGGGCAGGGAGGGGTGGAGG + Intronic
946410226 2:219511876-219511898 AGGGAGGCAGGCAGGGAAGCGGG + Intergenic
946429157 2:219615403-219615425 ATGAGGGCAGGGTGGGAAATGGG + Intronic
946519081 2:220446615-220446637 AAGGGGGCAGGGAGGGAGGGGGG - Intergenic
946659135 2:221980491-221980513 ATGGGGGCAGGGAATGAAGATGG + Intergenic
946865141 2:224035917-224035939 ATGTGGGCAGTGCGGGAGCCTGG + Intronic
946899937 2:224362321-224362343 AGGTGGGAAGGAAGGGAAGGAGG + Intergenic
946953705 2:224905782-224905804 GAGTGGGCAGAGAGGAAAGCGGG - Intronic
947023349 2:225708922-225708944 ATGAGGTCAGGGAGAGAGGCAGG + Intergenic
947718026 2:232351591-232351613 ATGTGTGCAGGGAGGGGACAGGG - Intergenic
947854099 2:233311641-233311663 ATGGGGGCAGGTAGAGAAGTGGG - Intronic
947971865 2:234331546-234331568 ACGTGGGGAGGGAGGGAAAGAGG - Intergenic
948080327 2:235200334-235200356 AGGTAGGGAGGGAGGGAAGGAGG + Intergenic
948458011 2:238116258-238116280 AAGAGGGGAGGGAAGGAAGCTGG - Intronic
948484238 2:238270573-238270595 AGCTGGGCAGGGAGGAGAGCTGG + Intronic
948646912 2:239411136-239411158 ATGAGGGAAGGTAGGGAAGGTGG - Intergenic
948687118 2:239676447-239676469 ATGCAGGCAGGGAGGGGTGCGGG + Intergenic
1168889823 20:1287798-1287820 AAGGGGGAAGGGAGAGAAGCCGG + Intronic
1168937239 20:1675966-1675988 AGGGAGGCAGGGAGGGAAGCAGG - Intergenic
1168949368 20:1786158-1786180 AGGTGGGTAAGGAAGGAAGCAGG + Intergenic
1169207661 20:3749297-3749319 CTGTGGGCAGAGATGCAAGCAGG + Exonic
1169228447 20:3870854-3870876 ATGAGGGGAAGCAGGGAAGCAGG - Exonic
1169430211 20:5529778-5529800 GTGTGGGCCGTCAGGGAAGCAGG - Intergenic
1169513953 20:6296408-6296430 GTGTTGGCAGGGAGTGAGGCTGG - Intergenic
1170571411 20:17634873-17634895 AGCTGGACAGGGAGGGGAGCTGG - Intronic
1170813198 20:19691400-19691422 ATGTGAGCAGGGAGAGTGGCAGG + Intronic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171324903 20:24282719-24282741 ATATTGGCAGGGAGGGCAGAGGG + Intergenic
1171406783 20:24917149-24917171 AGGTGGGCAGGGATGGAAGGTGG - Intergenic
1171525223 20:25803833-25803855 ATGTGTTCGGGGAGGGAATCAGG + Intronic
1171534408 20:25873487-25873509 ATGTGTTCAGGGAGGGAACCAGG + Intergenic
1171551604 20:26052051-26052073 ATGTGTTCGGGGAGGGAATCAGG - Intergenic
1171792727 20:29543354-29543376 ATGTGTTCGGGGAGGGAACCAGG - Intergenic
1171855743 20:30341048-30341070 ATGTGTTCGGGGAGGGAACCAGG + Intergenic
1171907568 20:30912378-30912400 ACGTGGGTAGTGAGGGGAGCTGG - Intergenic
1172028908 20:31968155-31968177 ATGTTGGCGGAGAGGGAGGCGGG - Exonic
1172537963 20:35688791-35688813 AGGGAGGCAGGGAGGGAAGAAGG + Intronic
1172758379 20:37304403-37304425 ATGTGGGAAGGAAGGGAATAGGG - Intronic
1172845169 20:37925828-37925850 AGGAGGACAGGGAGAGAAGCAGG - Intronic
1172858744 20:38030248-38030270 AAGGAGGGAGGGAGGGAAGCAGG + Intronic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1173175445 20:40761682-40761704 ATGTGAGAAGGGAAGGAAGTGGG - Intergenic
1173494073 20:43506576-43506598 ATCTGGCCTGGGAGGGAATCAGG + Intergenic
1173665602 20:44760915-44760937 ATGTGGGCAGGGGGGGATGTGGG + Intronic
1173870877 20:46341473-46341495 GAGTGGGCAGGGAGGGACGGGGG - Intergenic
1174141950 20:48421219-48421241 ATGTGAGAAGTGAGGGATGCAGG + Intergenic
1174164718 20:48576643-48576665 AGGGTGGCAGGGTGGGAAGCCGG - Intergenic
1174432015 20:50477215-50477237 ACAGGGGCAGGGAGGGAGGCAGG + Intergenic
1174575803 20:51536283-51536305 ATGTGGCCCTGGAGGGCAGCAGG - Intronic
1174686919 20:52465131-52465153 AGACGGTCAGGGAGGGAAGCTGG - Intergenic
1174882248 20:54292655-54292677 ATGGGGGCAGGGAGGGATGGAGG + Intergenic
1175060075 20:56233946-56233968 ATGTGGGCTGGGCAGGAAGGGGG - Intergenic
1175340829 20:58228190-58228212 ATGTGGCCAGGGAAGGAGTCAGG + Intronic
1175372250 20:58499795-58499817 ATGGGGCTAGGGAGGGAAGCTGG - Intronic
1175802782 20:61810592-61810614 ATGGGAGCAGGGCGGGAGGCAGG - Intronic
1176614796 21:9018191-9018213 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1176710409 21:10145680-10145702 CTGTGGGCTGGGGGGGCAGCTGG - Intergenic
1176892294 21:14332497-14332519 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1177746380 21:25219504-25219526 AGGAAGGCAGAGAGGGAAGCAGG + Intergenic
1177988540 21:28010053-28010075 AGGTGGGCTGGGAGGGAAAGGGG + Intergenic
1178083459 21:29089815-29089837 AGGGAGGAAGGGAGGGAAGCAGG + Intronic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178493266 21:33067719-33067741 CTGTGTGCAGGGGAGGAAGCCGG + Intergenic
1179008578 21:37535400-37535422 ATGAGGGCAGAGAGGGGATCAGG + Intergenic
1179296511 21:40067720-40067742 ATGAGGGGAGGGAGGGAATGAGG - Intronic
1179370811 21:40804611-40804633 AAGTGGGCAGGGCAGGAGGCAGG - Intronic
1179459246 21:41522677-41522699 ATGTGGGGAGGGAGAGCATCAGG - Intronic
1179883948 21:44305529-44305551 ATGGGTGCTGGGAGGGAGGCAGG + Intronic
1179960512 21:44764869-44764891 ATGTGTGCCAGGAGGGAAGGGGG - Intergenic
1180735025 22:18010028-18010050 GGGAGGGGAGGGAGGGAAGCAGG + Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180869841 22:19139900-19139922 AGGTGGCCAAGGAGAGAAGCCGG - Exonic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181161164 22:20960748-20960770 GTGTGGGCAAGGAGGTAAGATGG - Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181441462 22:22938040-22938062 ATGTGGGTTGGGAGGCAGGCAGG - Intergenic
1181461594 22:23089085-23089107 AGGTGAGGAGGGAGGGAGGCAGG + Intronic
1181537867 22:23556056-23556078 ATGTGGGCAGGGAGGAGAGCTGG + Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181662447 22:24362244-24362266 GTGGGGGCTGGCAGGGAAGCAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181771809 22:25131265-25131287 ATGGGGGCAGGGAGGGAAAAGGG - Intronic
1181851452 22:25752821-25752843 AGGTGTGGAGGGAGGGACGCAGG + Intronic
1181961013 22:26621912-26621934 TTATAGGCAGGGAGGGAAGAGGG - Intergenic
1181967456 22:26666953-26666975 ATGTGGGGAGGGAGGGAGGGAGG + Intergenic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
1182727084 22:32456447-32456469 ATGAGGGAAGGGAGGGAGGGAGG - Intronic
1182881781 22:33739839-33739861 ATGAGGGCATGGAAGGAGGCGGG + Intronic
1182989380 22:34752311-34752333 ATGAGGTCAGAGAGGTAAGCAGG - Intergenic
1183237425 22:36630121-36630143 ATGTGGCCACAGAGGTAAGCAGG + Intronic
1183259058 22:36782543-36782565 AAGGGGGCAGTGAGGGAAGGCGG - Intergenic
1183487390 22:38096921-38096943 AGGCAGGCAGGGAGGGAAGAGGG + Intronic
1183629707 22:39025765-39025787 ATGAGGGCAGGCAGGGGGGCAGG - Intronic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184442065 22:44523052-44523074 GTGTGGGCCGCCAGGGAAGCAGG - Intergenic
1184490222 22:44804070-44804092 ATGGAGGGAGGGAAGGAAGCAGG - Intronic
1184763723 22:46560927-46560949 TTGTGTGCAGGGAGAGGAGCTGG + Intergenic
1185031126 22:48443557-48443579 AAGGGGGCAGGGAGGGAGGGAGG + Intergenic
1185035239 22:48472330-48472352 ATAAGGTCAGGGAGGGAAGGAGG - Intergenic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1203322947 22_KI270737v1_random:86267-86289 ATGAGGGAAGGGAGGGAGGGAGG - Intergenic
949852448 3:8432905-8432927 AAGAAGGCAGGGAGGGAAGAAGG + Intergenic
950545600 3:13636309-13636331 GTGTGTGCAGGGAGGCACGCGGG + Intronic
950687365 3:14628081-14628103 AAGTGGGCAGGGATGGATTCTGG + Intergenic
950706914 3:14788555-14788577 ATGTGGCCAGGGAGGTGAGATGG + Intergenic
950750373 3:15123558-15123580 ATGTGGGCAGGCAGGGCAGATGG + Intergenic
950978837 3:17280186-17280208 ATGGGGGCAGGGAGGTCTGCAGG + Intronic
951709318 3:25573175-25573197 GAGTGGGCAGGGAAGGAAGGCGG - Intronic
951720544 3:25693205-25693227 GTGGGAGGAGGGAGGGAAGCAGG - Intergenic
951738082 3:25889771-25889793 AGGAAGGGAGGGAGGGAAGCAGG - Intergenic
951896986 3:27618906-27618928 AGGTTGGTAGGGAGGGAAGGTGG - Intergenic
951919153 3:27834552-27834574 GTGTGGGGAGGGAGAGAATCAGG - Intergenic
951932695 3:27986370-27986392 GCTTGGGCTGGGAGGGAAGCAGG + Intergenic
952255110 3:31688245-31688267 ATTTGTGCAGGGAGGGATGGGGG - Intronic
952255302 3:31690000-31690022 AGGTTGGCAGAGAGGGAAGAAGG + Intronic
952590108 3:34942487-34942509 AAGTAGGAAGGGAGGGAAGGAGG - Intergenic
952722231 3:36545371-36545393 AGGTGGGAAGTGAGGGATGCAGG - Intronic
952926854 3:38326607-38326629 TTGTGGGGAGTGAGGGAGGCAGG - Intergenic
952946864 3:38483830-38483852 AGGAGGGGAGGGAGGGAGGCAGG - Exonic
953492289 3:43362351-43362373 AAGTTGGCAGGGAAGGAGGCTGG + Intronic
953557508 3:43958459-43958481 ACGTGGGAAGGGTGGGAAGACGG - Intergenic
953697800 3:45173279-45173301 ATGTGGCCAGTGATGGAGGCTGG + Intergenic
954139198 3:48596181-48596203 ATGAGGGCAGTGAGGAAAGGAGG - Intergenic
954363270 3:50133598-50133620 GTGGGGGCAGGGAGGGGTGCTGG - Intergenic
954413298 3:50380668-50380690 AAATGGGGAGGGAGGGGAGCAGG + Intronic
954880621 3:53833555-53833577 AGGTGGGCAGGAATGGGAGCAGG + Intronic
955740662 3:62088094-62088116 AAGTGGGGAGGGAGGGAATGGGG + Intronic
955945219 3:64187394-64187416 AGTTGGGAAGGGAGGGAAGAAGG - Intronic
956305420 3:67819125-67819147 GTGTGGGGTGGGCGGGAAGCAGG + Intergenic
956305606 3:67821086-67821108 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
956426019 3:69135971-69135993 GCTTGGGCAGGGAGGGAATCGGG + Intergenic
956593317 3:70939669-70939691 AAGAAGGCAGGGAGGGAAGAAGG - Intergenic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
956770665 3:72523230-72523252 TTGGGGGCTGGGTGGGAAGCAGG - Intergenic
957072124 3:75575642-75575664 ATGTGGGCAGGCAGGGCAGGTGG - Intergenic
957878807 3:86183717-86183739 ATGTGTCCAGGGAGGGACACTGG - Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
958832537 3:99106845-99106867 ATTTGGGCAATGAGGGAAACAGG + Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959581916 3:107991328-107991350 AGGAGGTCAGGGAGGGGAGCAGG - Intergenic
959672918 3:108999337-108999359 ATGGGGGCAGGGAGGGAATATGG + Intronic
960692507 3:120361548-120361570 ATGAGGCCAGAGAGGGAGGCTGG + Intergenic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
961217156 3:125168557-125168579 ATGTGGGCAGGGAGGCCACGGGG - Intronic
961282017 3:125771443-125771465 ATGTGGGCAGGCAGGGTAGGTGG + Intergenic
961476035 3:127146964-127146986 ATGTGGTCAGGCATGGAAGCTGG + Intergenic
961501249 3:127337525-127337547 ATAAGGGAAGGGAGGGAAGTGGG - Intergenic
961512163 3:127409681-127409703 CTGTGGGCTGGGAGGCCAGCAGG - Intergenic
961649791 3:128411578-128411600 ATGTGGGCAGGCAGGTGAGGGGG - Intergenic
962321660 3:134395707-134395729 ATGTGGGCAAGGAGGGATTCTGG + Intergenic
962366942 3:134793174-134793196 TTAAGGGGAGGGAGGGAAGCTGG + Intronic
962461492 3:135618515-135618537 ATGTGGGCAGAAAGGGAGCCTGG - Intergenic
962953888 3:140246731-140246753 ATGTGGGCAGGTAGGAAGGCAGG + Intronic
963071425 3:141308446-141308468 ATGGGGGAAGAGAGGGAAACTGG - Intergenic
963119415 3:141763607-141763629 TTGGGGGCAGGGAGGGGTGCTGG - Intergenic
963237617 3:142971190-142971212 ATGTGGGTAGGGAAGGAAAATGG + Intronic
963258247 3:143168090-143168112 ATGTGGGCAGGGAAGAAATCTGG - Intergenic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963769824 3:149378566-149378588 ATGGGGGGAGGGAAGGAAGGAGG + Intergenic
963851124 3:150211368-150211390 AGGTGGGCAGGCAGGGAAGAAGG + Intergenic
965617653 3:170611425-170611447 ATGTGGTCAGAGAGGTAAGTTGG - Intronic
965772197 3:172193139-172193161 AGGTGGGAAGGAAGGGAGGCAGG - Intronic
966086748 3:176077632-176077654 AATTGGGAAGGGAGGGAAGAAGG + Intergenic
966770600 3:183500350-183500372 GTGTGGCCAGGGAGGGAGGAAGG + Intronic
967154291 3:186678399-186678421 ATAGGGGGAGGGTGGGAAGCAGG - Intergenic
967324259 3:188223587-188223609 ATTTGTGCCTGGAGGGAAGCTGG + Intronic
967446878 3:189577654-189577676 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
967899980 3:194440054-194440076 ATGTGGGTAGGGAGGGAGGGAGG + Intronic
967899988 3:194440074-194440096 AGGTGGGGAGGCAGGGAAGAGGG + Intronic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968443278 4:635284-635306 AGGCGGGCAGGGAGGCAGGCAGG - Intronic
968461827 4:730064-730086 ATGAGGACAGGGAGGGCACCTGG - Intronic
968657557 4:1785260-1785282 CTGGGAGCAGGGAGGGGAGCTGG + Intergenic
968894392 4:3390191-3390213 AGGTGGTCAGGAAGGGAAGAGGG - Intronic
969015714 4:4102963-4102985 ATGTGGGCAGGCAGGGCAGGTGG - Intergenic
969172543 4:5375877-5375899 AGGAGGGCAGGGAAGGAAGTAGG + Intronic
969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG + Intronic
969278048 4:6150278-6150300 AGGTTGGGTGGGAGGGAAGCTGG - Intronic
969492529 4:7508181-7508203 ATGTAGGGAGGAAGGGAAGGGGG + Intronic
969493342 4:7512363-7512385 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
969683129 4:8654160-8654182 ATGTGGTGAGGGAGGGCACCAGG - Intergenic
969695318 4:8730925-8730947 GTGTGGGGAGGGAGGGAACCTGG + Intergenic
969738248 4:9005398-9005420 ATGTGGGCAGGCAGGGCAGGTGG + Intergenic
969797430 4:9536944-9536966 ATGTGGTCAGGCAGGGCAGGTGG + Intergenic
970001119 4:11367075-11367097 AAGGAGGCAGGGAGGGAAGGAGG + Intergenic
970367186 4:15371768-15371790 AAGGGGGCTGGGAGGGATGCAGG + Intronic
970435064 4:16025433-16025455 ATGTGGGAGGAGAGGGCAGCGGG - Intronic
970522382 4:16898778-16898800 ATGGAGGAAGGGAGGGAAGAAGG + Exonic
970820793 4:20210070-20210092 AGGCAGGCAGGGAGGGAGGCAGG + Intergenic
971254573 4:25002389-25002411 AGGTGGGCTGGCAGGGAAGTTGG + Exonic
972028517 4:34419623-34419645 ATGAGTGCTGGGAGTGAAGCAGG - Intergenic
972279832 4:37591009-37591031 ATTTGCACAGGGAGGTAAGCTGG + Exonic
972645334 4:40962721-40962743 GTGGGGGAAGGGAGGGAAGGAGG + Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
975436116 4:74353803-74353825 AAGTGGGCAGGAAGGGAAAGGGG + Intergenic
975811211 4:78171792-78171814 ATGTGAGGAGGGAGGAAAGAAGG - Intronic
976162150 4:82213855-82213877 TGTGGGGCAGGGAGGGAAGCAGG - Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
977434891 4:96981664-96981686 ATGGGGTCAGGTAGGGAGGCAGG + Intergenic
977607392 4:98996104-98996126 ATGTGGGCTGGGGCGGAAGCGGG + Intronic
978277400 4:106968183-106968205 ATGTAGGCAGAGAGGGAAAAAGG + Intronic
978471107 4:109068414-109068436 AGGAAGGGAGGGAGGGAAGCAGG + Intronic
978686385 4:111449902-111449924 AGGCTGGCAGGAAGGGAAGCAGG - Intergenic
979217142 4:118179500-118179522 AAGTGGTAAGGGAGGGAAGGTGG + Intronic
979231801 4:118354920-118354942 ATGTGGGAAGGGGAGGGAGCAGG - Intergenic
980038685 4:127914279-127914301 ATATGGGGAGGGAGGGAGGGAGG - Intergenic
980078618 4:128320513-128320535 AAGGAGGGAGGGAGGGAAGCAGG - Intergenic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
982053276 4:151524811-151524833 TTGGGGGCAGGGAGGACAGCAGG + Intronic
982054684 4:151536444-151536466 ATGGGGGCAGGGAGGGCAGGAGG - Intronic
982131331 4:152231222-152231244 ATGGGGGCAAGGAGGAAAGCAGG - Intergenic
982274818 4:153628116-153628138 AGTTGGGGAGGAAGGGAAGCAGG - Intronic
982296054 4:153830684-153830706 ATGGGGGCAAGGAGAGTAGCTGG + Intergenic
982529262 4:156517989-156518011 AAGGAGGGAGGGAGGGAAGCAGG + Intergenic
983296214 4:165872603-165872625 GTGGGCGCAGGAAGGGAAGCTGG - Intergenic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
983617476 4:169724263-169724285 AAGGGGGCAGGGGTGGAAGCAGG + Intergenic
983929134 4:173434120-173434142 ATGGGGCCAGGGTGGGAAGGTGG + Intergenic
984048275 4:174829986-174830008 ATGTGGGAGGGGAGGAAAACAGG - Intronic
984485776 4:180367409-180367431 ATGGGGGAAGGCAAGGAAGCAGG + Intergenic
984918972 4:184747543-184747565 ATGAGGCCAGGGAGGCAAGCAGG + Intergenic
985438843 4:189963743-189963765 TTGTGGGCTGGAATGGAAGCTGG + Intergenic
985669477 5:1200237-1200259 ATGTGGGCAGTGGGGGCAGGGGG + Intergenic
985672417 5:1213424-1213446 ATGTGGGATGGGCGGGAAGTTGG - Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
986212821 5:5690188-5690210 GTGAGGGAAGTGAGGGAAGCAGG - Intergenic
986794168 5:11192660-11192682 ATGTGGGCAGCTTTGGAAGCTGG + Intronic
987122422 5:14779475-14779497 ATATGGGCAGTCAGGTAAGCAGG - Intronic
987381254 5:17288006-17288028 ATGAGAGGAGGGAGGGAATCTGG - Intergenic
987940131 5:24523089-24523111 ATGGGGGCAGGAAGGGAGGGTGG + Intronic
989069622 5:37497166-37497188 AGGGGGGAAGGGAGGGAAGGAGG - Intronic
989105296 5:37857402-37857424 ATGTTGGAAGGAAGGGAAACAGG - Intergenic
989136493 5:38161177-38161199 AGGTGGAAAGGGAGGGAAGGAGG + Intergenic
989559097 5:42830525-42830547 AGGTAGGTAGGGAGGGAAGTAGG - Intronic
989697717 5:44223157-44223179 ATGAGGGGAGGGAGGGAGGGAGG + Intergenic
989725948 5:44586982-44587004 ATGTGTGCAGGGATGGATGAGGG - Intergenic
989992752 5:50787299-50787321 ATGAGAGCAGGGAAGGAACCTGG - Intronic
990182309 5:53174594-53174616 GTGTGGGAAGGGAGGGAGGGAGG - Intergenic
990253561 5:53942159-53942181 ATGTGGGCACTGAGAGAAACTGG + Intronic
990816567 5:59792447-59792469 AAGTGGGCATGGAGTGAAGGAGG + Intronic
990982710 5:61616018-61616040 ATGTGGGCACTGAGGGAGCCGGG - Intergenic
991601773 5:68358273-68358295 GTTTGGGCAGGTAGGGGAGCAGG - Intergenic
992392309 5:76340483-76340505 ATGTGGGCACAGTGGGCAGCAGG + Intronic
992519999 5:77540720-77540742 ATGTAGGGAGGGAGGGAGGGAGG + Intronic
992530728 5:77649292-77649314 ATGAAGGCATGGAGGGAAGTAGG - Intergenic
992617106 5:78555524-78555546 ATGTGGGCAGAGGGGGAAAGAGG + Intronic
992882890 5:81128128-81128150 TGGTGGGGAGGAAGGGAAGCGGG + Intronic
992889154 5:81188116-81188138 AGGAGGGCAGGGCTGGAAGCAGG - Intronic
993484208 5:88462520-88462542 ATGTGGTAGAGGAGGGAAGCAGG + Intergenic
993995683 5:94719681-94719703 ATGTGGGGAGGGAGGGCATCAGG + Intronic
994285319 5:97957571-97957593 AAGTGGGCAGAGAGGGAAAAAGG - Intergenic
994305522 5:98199269-98199291 ATGGGGGCAGGGTGGGGGGCAGG + Intergenic
994613797 5:102078352-102078374 ATGCCTGCATGGAGGGAAGCAGG + Intergenic
995028687 5:107454762-107454784 ATATAGGCAGGGAGGGAATGAGG + Intronic
995550802 5:113279228-113279250 ATGTGGGTTGGGTGGGAAACTGG - Intronic
995982205 5:118117955-118117977 AAGTGGGGAGGGAGGGAGGCAGG - Intergenic
996176706 5:120368402-120368424 ATGAGCTCAGGGAGGGAGGCTGG + Intergenic
996266994 5:121553458-121553480 AGGAAGGGAGGGAGGGAAGCAGG + Intergenic
996711440 5:126547307-126547329 AGGTGGGCAGGGAGGGAGTAGGG + Intronic
997033574 5:130160330-130160352 TAGTGGGCAAGGAGGAAAGCAGG - Intronic
997234476 5:132264864-132264886 AAGAGGGCAGATAGGGAAGCTGG - Intronic
997376736 5:133402924-133402946 ATGGTGGCGGGGAGGGAAGGAGG + Intronic
997405887 5:133646369-133646391 ATGAGGTCAGAGAGGTAAGCAGG + Intergenic
997418848 5:133750439-133750461 GTGATGGGAGGGAGGGAAGCTGG - Intergenic
997430197 5:133832625-133832647 ATGTATGTAGGGAGGAAAGCTGG - Intergenic
997746893 5:136307281-136307303 AGGTGGGGAGGGAGGGAATGGGG - Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998565626 5:143213645-143213667 TTGGGGGAAGGGAGGGAAGCAGG - Intronic
998601097 5:143586022-143586044 AAGTGAACAGGGAGGGAAGGAGG - Intergenic
998704306 5:144741064-144741086 ATGGAGGGAGGGAGGGAGGCAGG - Intergenic
999037889 5:148373953-148373975 ATGTGGGCGTGGGGAGAAGCAGG - Intergenic
999233397 5:150076213-150076235 ATGTGGGTTGGGTGGGAACCTGG - Intronic
999248911 5:150170031-150170053 ATGAGGTCAGGGAGGCAGGCAGG - Intronic
1000256248 5:159541268-159541290 ATGAGGGCAGAGAGGTAGGCAGG + Intergenic
1000984930 5:167855956-167855978 AGGAGGGAAGGGAGGGAAGAAGG + Intronic
1001106071 5:168855713-168855735 CTGGGGGCAGGGAGGGAATGGGG + Intronic
1001295505 5:170496086-170496108 AAGTGAGCAGGGAGGGGAGGAGG - Intronic
1001390739 5:171377150-171377172 ATATGGGCAGGCACGGTAGCTGG + Intergenic
1001408744 5:171495403-171495425 AGGTGGGGAGGGAGAGAGGCAGG + Intergenic
1001498244 5:172205922-172205944 ATGGGGGCAGGGAGAAAAGATGG + Intergenic
1001560813 5:172667877-172667899 GTGGGAGCAAGGAGGGAAGCGGG - Intronic
1001840323 5:174870691-174870713 AACTGGGCAGGGAGAGAAGTAGG - Intergenic
1002000793 5:176195307-176195329 ATATGGGCAGGGAAGGGGGCAGG + Intergenic
1002083943 5:176757950-176757972 ATTTGAGCAGGGAGGGTGGCAGG + Intergenic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002253543 5:177943663-177943685 ATATGGGCAGGGAAGGGGGCAGG - Intergenic
1002272271 5:178080332-178080354 ATGCGGGCAGGGGAGGAAGAAGG - Intergenic
1002500978 5:179647514-179647536 ATGTGGGCACTGAGAGAACCTGG + Intergenic
1002606321 5:180385063-180385085 ATGGGGGGAGGGTGGGAAGAGGG + Intergenic
1002784433 6:391356-391378 ATGTGGCCAGGGCGGGAAATGGG - Intergenic
1002838842 6:888215-888237 ATGTGCTCAGGGAGGTATGCTGG + Intergenic
1002896726 6:1383989-1384011 TTGGGGGAAGGGAGGGCAGCGGG + Intergenic
1002898474 6:1392533-1392555 AGGGGAGCAGGGAGGGCAGCTGG - Intronic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003173217 6:3736366-3736388 TGGTGGACAGGGAGGGAAGGGGG - Intronic
1003199711 6:3947820-3947842 ATGTAGGGAGGGAGGGAGGAGGG + Intergenic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003380978 6:5624485-5624507 AGCTAGGCAGGGAGAGAAGCCGG + Intronic
1003387518 6:5683012-5683034 ACGTGTTCAGAGAGGGAAGCAGG + Intronic
1003517568 6:6829959-6829981 AGGAAGGCAGGGAGGGAAGAAGG + Intergenic
1003644001 6:7899518-7899540 ATGTAGGCAGGGAGAGAGGGAGG + Intronic
1003673446 6:8181278-8181300 AGGAAGGGAGGGAGGGAAGCAGG - Intergenic
1003773641 6:9335745-9335767 GGGAGGGTAGGGAGGGAAGCAGG - Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004179333 6:13367456-13367478 ATGGGGGTCGGGAAGGAAGCAGG - Intronic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1005374712 6:25170459-25170481 GTGGGGGCAGTGAGGGGAGCAGG + Intergenic
1005926469 6:30449588-30449610 ATGTGGGCAGGGAGAAGAGGAGG + Intergenic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006829851 6:36962066-36962088 ACGTGGGCAGGGAAGGAGCCTGG + Intronic
1006946092 6:37785345-37785367 AGGTGGGCAGGCAGGGACGGGGG + Intergenic
1007079656 6:39090434-39090456 AGGAGTGCAGGGAGGGAAGTTGG - Intergenic
1007208475 6:40171975-40171997 AGCAGGGCAGGGAAGGAAGCTGG + Intergenic
1007226997 6:40322009-40322031 GGTTGGGCAGGGATGGAAGCGGG + Intergenic
1007292302 6:40797044-40797066 AGGAGGGGAGGGAGAGAAGCTGG - Intergenic
1007387208 6:41528096-41528118 AACTGGGCGGGGAGGGAAGTGGG - Intergenic
1007408358 6:41647583-41647605 ATCGGGGGAGGGTGGGAAGCAGG - Intronic
1007436916 6:41820361-41820383 GTGGTGGTAGGGAGGGAAGCTGG - Intronic
1007582100 6:42965850-42965872 GTGAGAGCAGGGAGGGAAACTGG + Intronic
1007688296 6:43680546-43680568 ATGGGCCCAGGGAGGGAAACGGG + Intronic
1007749736 6:44064558-44064580 GTGTGGGCAGGGAAGGGATCTGG + Intergenic
1008111879 6:47504223-47504245 ATGAGGCCAGGGAATGAAGCTGG - Intronic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1008541375 6:52549242-52549264 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
1008717770 6:54310013-54310035 AGGTGTGGAGGGAGGGAAGAAGG - Intronic
1009243110 6:61203266-61203288 AGGAGGGAAGGGAGGGAAGGAGG + Intergenic
1009576087 6:65463015-65463037 ATGAGGGCAGGAATAGAAGCAGG - Intronic
1010022904 6:71181837-71181859 ATGTGGCCAGAGAGACAAGCAGG + Intergenic
1010196033 6:73241140-73241162 AAGTAGGCAGCCAGGGAAGCTGG - Intronic
1011017783 6:82777703-82777725 ATGGAGGGAGGGAGGGAAGGAGG + Intergenic
1011382973 6:86762493-86762515 AGGTGGGCAAGGAGGAAAGAGGG - Intergenic
1011632321 6:89339516-89339538 AGGGGGGAAGGGAGGGAAGTGGG + Intronic
1012398948 6:98828830-98828852 GGGTGGGCGGGGAGGGGAGCAGG - Intergenic
1012671302 6:102051236-102051258 AGGAAGGGAGGGAGGGAAGCAGG - Intronic
1013703639 6:112805710-112805732 ATGTGGGGAGAGATGGAAGGAGG - Intergenic
1013775240 6:113672273-113672295 AGGGAGGCAGGGAGGGAAGGAGG + Intergenic
1014005235 6:116410288-116410310 TTGTGGGAAGGGAGGGAACTGGG - Intronic
1014773538 6:125483759-125483781 ATGTTGTCAGGCAGGGAAGCAGG - Intergenic
1014921822 6:127222454-127222476 AGGAAGGAAGGGAGGGAAGCGGG + Intergenic
1016273423 6:142318711-142318733 ATCTGGGCAGAGAAGGGAGCAGG + Intronic
1016987082 6:149903698-149903720 ATGTGGGCAGTTGGAGAAGCTGG + Intergenic
1016999549 6:149986724-149986746 ATGTGGGCAGCTGGAGAAGCTGG - Intergenic
1017007069 6:150035637-150035659 ATGTGGGCAGCTGGAGAAGCTGG + Intergenic
1017481578 6:154861587-154861609 ATGTGTGCAGGGATGGCAGTGGG + Intronic
1017835499 6:158173794-158173816 GAGTGGGGAGGGTGGGAAGCAGG + Intronic
1017956222 6:159179917-159179939 AGTTAGGCTGGGAGGGAAGCAGG - Intronic
1018271193 6:162079659-162079681 AGGTGGGGAAGGAGGGAAGTGGG - Intronic
1018859821 6:167703623-167703645 ATGTGGCCAGTGAGGAAGGCAGG + Intergenic
1019076733 6:169393979-169394001 AGCTGGGAAGGGAGGGAGGCAGG + Intergenic
1019117152 6:169774425-169774447 AGGTGGGCAGGTAGGGAGGAGGG + Intronic
1019290309 7:247021-247043 AAGGAGGCAGGGAGGGAAGGGGG + Intronic
1019319561 7:409460-409482 AGGTGGGCCGGGCGGGGAGCAGG - Intergenic
1019346082 7:531530-531552 AGGTGAGCAGGGAGGTGAGCAGG + Intergenic
1019480702 7:1265377-1265399 ATGTGGTCAGGGAGGGCGGCAGG + Intergenic
1019558154 7:1642698-1642720 AGGCAGGCAGGGAGGGAGGCAGG - Intergenic
1019847842 7:3524352-3524374 ATGGTGGCAAGGATGGAAGCGGG + Intronic
1019879393 7:3845103-3845125 AGGTTGGCGGGGAGGGATGCTGG + Intronic
1020012531 7:4814574-4814596 TGGTGAGCAGCGAGGGAAGCAGG + Intronic
1020264388 7:6550938-6550960 ATGTGGGCAGGGAGTGGGCCGGG - Intronic
1020363368 7:7353664-7353686 ATGTGGTCAGTCAGGGAAGAAGG + Intergenic
1020569543 7:9841784-9841806 CTGTTGGAAGGAAGGGAAGCAGG + Intergenic
1020877264 7:13713516-13713538 AAGGGGGAAGGGAGGGAAGGAGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021277073 7:18664630-18664652 ATGTGTGAGGGGTGGGAAGCAGG - Intronic
1021463642 7:20916789-20916811 ATGTGGGCAGGGAACTAAGGAGG + Intergenic
1021816130 7:24449259-24449281 ATTTGGGCAGAGAGAGACGCAGG - Intergenic
1023002820 7:35829049-35829071 ATGAGGTCAGGGAGGCAAGCAGG - Intronic
1023533240 7:41181379-41181401 ATGTGTGAAGGGAGGACAGCTGG + Intergenic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1023935560 7:44737522-44737544 AGGTGGGCAGGGAGGAGAGAAGG - Intergenic
1023991408 7:45131007-45131029 ATGTGGGCAGGGAGCTCTGCAGG + Intergenic
1024004553 7:45215970-45215992 ACATGGGCGGGGAGGGAAGAGGG + Intergenic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1025321606 7:58100272-58100294 ATGAGGGAAGGAAGGGAAGGAGG + Intergenic
1026471087 7:70694515-70694537 ATGTGCGGAGGGAGGGAGGAGGG - Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027421696 7:78023336-78023358 AGGTAGGCAGGCAGGGAGGCAGG - Intronic
1027761308 7:82282501-82282523 CTGTGGGCAGGAAGGTTAGCAGG + Intronic
1027769922 7:82393148-82393170 AGGCAGGCAGGGAGGGAGGCCGG + Intronic
1028243782 7:88451926-88451948 ATGAGGGGAGGGAGGGAGGTGGG - Intergenic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028558070 7:92143694-92143716 ATGTGTGCAGGGAGAGGCGCGGG - Intronic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028994564 7:97085892-97085914 AGGTGGGCTGGGTGGGAGGCGGG - Intergenic
1029074383 7:97924597-97924619 ATGTGGGCAGGCAGGGTAGGTGG - Intergenic
1029164052 7:98573583-98573605 AGGAAGGAAGGGAGGGAAGCAGG + Intergenic
1029434513 7:100555050-100555072 AAGAGGGCAGGGAGTGAACCTGG + Intronic
1029472019 7:100760603-100760625 GAGTGGGCAGGGTGGGCAGCAGG - Intronic
1029545159 7:101206677-101206699 AAATGGGCAGGGAGGGGAGCTGG + Intronic
1029673103 7:102047493-102047515 ATGGAGGGAGGGAGGGAAGGAGG + Intronic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1029788406 7:102816758-102816780 ATGTGGGGAGGCAGGGAGGATGG - Intronic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030824040 7:114132990-114133012 ATGAAGGCAGGGAAGGAAACAGG + Intronic
1031540611 7:122990842-122990864 AGGGAGGCAGGGAGGGAAGGAGG - Intergenic
1032229208 7:130059782-130059804 ATCTGGGCAGGGGGAGGAGCTGG - Intergenic
1033236016 7:139638322-139638344 AAGCGGGCAGGGAGGGGAGCAGG - Intronic
1033281452 7:140009470-140009492 ATGTGTGCAGGGAGGAGCGCCGG + Intronic
1033451007 7:141462469-141462491 ATGTGGGGAGAGAGGAGAGCTGG + Intronic
1033925752 7:146458149-146458171 ATGTGGGGAGGGAGAGCATCAGG + Intronic
1034252790 7:149705839-149705861 ATGTGGGCAGGGAAGACAGCTGG - Intergenic
1034746956 7:153531380-153531402 ATGTGGGCAAGGATGAAAGAGGG - Intergenic
1034808192 7:154106795-154106817 ATGTGGGGAGGGACGGATGAAGG + Intronic
1034934868 7:155192404-155192426 ACGTGGGGAGGGAGGAAAACTGG + Intergenic
1035012624 7:155733029-155733051 AGGTGGCCAGAGAGTGAAGCAGG + Intronic
1035163614 7:156969698-156969720 ATGTAGTCAGGGAAGGAAGGAGG + Exonic
1035404617 7:158588888-158588910 ATGGGGGCTGGGATGGCAGCGGG + Intergenic
1035695287 8:1591321-1591343 ATGTGGGCCAGGTGGGAAGGAGG + Intronic
1035939306 8:3878106-3878128 ATGTGGGCAGGGAAGGAGGAAGG - Intronic
1036208642 8:6824304-6824326 AGGTGGGGAGGGAGAGAAGGGGG + Intronic
1036243322 8:7096693-7096715 ATGTGGACAGGCAGGGCAGGTGG + Intergenic
1036588860 8:10149449-10149471 GCCTGGGCAGGGAGGGCAGCAGG - Intronic
1036829407 8:12010499-12010521 ATGTGGGCAGGCAGGGTAGGTGG - Intergenic
1036898507 8:12654737-12654759 ATGTGGGCAGGAAGGGCAGGTGG - Intergenic
1037564463 8:20105852-20105874 ATGTGGGGAGGGAGGGACAGTGG + Intergenic
1037728083 8:21500662-21500684 ATGTGGGCAGAGAAGCAAGCTGG + Intergenic
1037812123 8:22093093-22093115 GTGTGGGCAGGCAGGGACACTGG + Intronic
1037891816 8:22627654-22627676 AGGTGGGCAGGGAGAGAGGAGGG - Intronic
1039086970 8:33789626-33789648 ATGTGGGGAAAGATGGAAGCTGG + Intergenic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039415879 8:37393726-37393748 CTTTGGGAAGGGTGGGAAGCTGG - Intergenic
1039433526 8:37544116-37544138 ATGTGGGCTGGGAGGGATACAGG - Intergenic
1039473099 8:37826120-37826142 AAGTGAGCGGGGAGGGAAGGGGG + Intronic
1039559741 8:38503658-38503680 GTGTGGGCTGGGAGGGAAAAGGG - Intergenic
1040913585 8:52545500-52545522 GTGTGTGCAGGGAGGGAGGTGGG - Intronic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1041502408 8:58553314-58553336 AAGGGGGCAAGGAGGGACGCCGG + Intronic
1041713337 8:60912281-60912303 AAGTGGGGAGTGAGGAAAGCAGG + Intergenic
1041775140 8:61514961-61514983 GGGTGGACAGGGAGGGAAGGAGG + Intronic
1041788282 8:61660278-61660300 ATTTGGGCAGGGGGAGAAGTAGG + Intronic
1041947970 8:63468205-63468227 AGATGGGAAGGGAGGGAGGCAGG - Intergenic
1042104960 8:65316296-65316318 ATGCAGGCAGGGAGGAAAGAGGG + Intergenic
1042671388 8:71267214-71267236 ATGTGGTCAGGGATGAAGGCAGG - Intronic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043784422 8:84380242-84380264 ATGTGAGGAGTGAGGGAACCTGG - Intronic
1044256845 8:90073509-90073531 ATCTGGGCAGAGGGAGAAGCTGG - Intronic
1044457116 8:92401497-92401519 AGGTGGGGAGGGAGAGGAGCAGG - Intergenic
1044891752 8:96843330-96843352 AAGGAGGAAGGGAGGGAAGCAGG + Intronic
1045254467 8:100508160-100508182 ATGTGGGCAGCCACGGAATCGGG + Intergenic
1045507447 8:102788813-102788835 AGGTGAACAGGGAGGGAAGAGGG - Intergenic
1045658008 8:104406651-104406673 AAGTGGTCAGGAAGGGAAGATGG - Intronic
1045848237 8:106661962-106661984 ATGTGGGAAGGAATAGAAGCAGG + Intronic
1046747650 8:117893513-117893535 ATTTGGGCAGTGAGGCAAGAAGG + Intronic
1046859114 8:119070513-119070535 ATGGAGGGAGGGAGGGAAGGAGG - Intronic
1046971719 8:120230503-120230525 TTGAGGCCAGGAAGGGAAGCAGG - Intronic
1047211744 8:122846134-122846156 ATGTTGGCAGAGAGGGGAGGAGG + Intronic
1047397422 8:124514259-124514281 TGGGGAGCAGGGAGGGAAGCGGG + Intronic
1047832272 8:128647760-128647782 AGGTGGGCAGGGAGGGAGGCAGG - Intergenic
1047878972 8:129171474-129171496 AAGAAGGCAGGGAGGGATGCAGG + Intergenic
1048201746 8:132380505-132380527 AAGTGGGCAGCTTGGGAAGCAGG - Intronic
1048336182 8:133504107-133504129 AGGTGGGGAGGGAGGGCATCTGG + Intronic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049154108 8:141056493-141056515 AGGTAGGCAGGGAGGGACGAGGG + Intergenic
1049414588 8:142489384-142489406 GTGTGCGCAGGGAGCGAGGCGGG - Exonic
1049470825 8:142774353-142774375 TTCTGGGCAGGGAGGGAAAGGGG - Intronic
1049606964 8:143534237-143534259 CTCTGGCCTGGGAGGGAAGCAGG + Intronic
1049618863 8:143588893-143588915 AGGTGGGCAGGGGAGGAAGCTGG + Intronic
1050268658 9:3918320-3918342 TTGTGAGCAGGGAGGGAGACTGG + Intronic
1050423347 9:5489892-5489914 AGGTGGCCAGGAAGGAAAGCTGG + Intergenic
1051099324 9:13502902-13502924 ATGGGGAAAGGGAGAGAAGCAGG - Intergenic
1051238403 9:15025791-15025813 AAGGGGGCAGGGGTGGAAGCAGG - Intergenic
1051724636 9:20076445-20076467 ATGGAGGCAGGGATGGAAGGAGG + Intergenic
1051847982 9:21474367-21474389 TGGTGGGGAGGGAGGGAAGGTGG - Intergenic
1052033661 9:23656777-23656799 ATGCTGCCAGGGAGGGAAGCAGG + Intergenic
1052261079 9:26516863-26516885 AAGAGGGGAGGGAGGGAACCTGG + Intergenic
1052526143 9:29622083-29622105 AGGGAGGCAGGGAGGGAGGCAGG + Intergenic
1052526148 9:29622095-29622117 AGGGAGGCAGGGAGGGAGGCAGG + Intergenic
1052752334 9:32504248-32504270 ATGTGGGCACGGGGGGAATGTGG + Intronic
1052825227 9:33169259-33169281 ATGTGGGTGGGGAGGGAAATAGG - Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1053270559 9:36746639-36746661 ATGTGGTGAGGGAGGGATGGTGG + Intergenic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1053462257 9:38280135-38280157 AGGTGGGGAGGTAGAGAAGCTGG + Intergenic
1053793563 9:41704341-41704363 ATGTGTTCGGGGAGGGAACCAGG + Intergenic
1054151615 9:61610489-61610511 ATGTGTTCGGGGAGGGAACCAGG - Intergenic
1054181974 9:61916356-61916378 ATGTGTTCGGGGAGGGAACCGGG + Intergenic
1054994638 9:71371963-71371985 ATGTGGGAAGGGAGAGCATCAGG - Intronic
1055449503 9:76418132-76418154 AAGTGGGCAGAGAGGGGAGGAGG + Intergenic
1055693840 9:78861563-78861585 ATGTGGACAGAGAGAGAATCAGG - Intergenic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1055965217 9:81859332-81859354 AAGTGGGGAGGGAGGGGAGGGGG + Intergenic
1055969752 9:81900295-81900317 AGGGAGGGAGGGAGGGAAGCAGG - Intergenic
1056075258 9:83031854-83031876 ATGGGGGCAGGGATGGAAGGTGG - Intronic
1056177205 9:84046557-84046579 ATATGGGGAGGGAGAGAAGGGGG - Intergenic
1056538812 9:87553873-87553895 TTGTGGGCAGAAAGGGAGGCAGG + Intronic
1056782344 9:89560270-89560292 TAGTGGGCAGGGAAGGGAGCTGG + Intergenic
1057249921 9:93492902-93492924 AAGTGGGATGGGAGTGAAGCAGG + Intronic
1057276164 9:93676994-93677016 ATGGGGGCAGGCAGGGCAGGGGG - Intronic
1057310096 9:93937354-93937376 AAGTGTGCAGGGAGGGAGGGTGG + Intergenic
1057472838 9:95373180-95373202 AAGTGGGCAGGGGCTGAAGCAGG - Intergenic
1057611724 9:96550207-96550229 AGGTGGGTAGGAAGGGAAGAGGG - Intronic
1058039906 9:100292380-100292402 ATGAAGGCAGTGATGGAAGCAGG + Exonic
1058448073 9:105071321-105071343 ATGTGGGCAGGCACGGCAGGAGG - Intergenic
1058643316 9:107107870-107107892 AGGAAGGCAGGGAGGGAAGAAGG + Intergenic
1058763611 9:108160497-108160519 ATGTGAGCAGGGAGTGGAGAGGG - Intergenic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059495494 9:114705654-114705676 ATGTGGCCAGGGAGTGAGTCTGG + Intergenic
1059667863 9:116466119-116466141 TTGCGGGGAGGGTGGGAAGCGGG + Intronic
1059835862 9:118151535-118151557 ACGGGGGCAGGGATTGAAGCTGG + Intergenic
1059975814 9:119715762-119715784 AGGTGGGGAGGGAGGGAAAGGGG + Intergenic
1060277623 9:122193862-122193884 AGGGGAGCTGGGAGGGAAGCGGG + Intronic
1060444317 9:123673897-123673919 ATCTGGACAGGGAAGGAGGCAGG - Intronic
1060685364 9:125606200-125606222 AGGAAGGCAGGGAGGGAAGAAGG + Intronic
1060755027 9:126206356-126206378 AGCTGGGCTGGGAGGGAGGCTGG - Intergenic
1061012942 9:127966063-127966085 GGGTGGGCCGGGAGGGAGGCTGG + Intronic
1061136889 9:128739908-128739930 GTGTGGGCAGGGCAGGGAGCGGG - Intronic
1062010837 9:134265821-134265843 ATGAAGGTAGGGAGGGAAGGAGG - Intergenic
1062080812 9:134622488-134622510 ATGGAGGCAGGGAGGAAGGCAGG - Intergenic
1062080834 9:134622575-134622597 ATGGAGGCAGGGAGGAAGGCAGG - Intergenic
1062080865 9:134622674-134622696 ATGGAGGCAGGGAGGAAGGCAGG - Intergenic
1062080896 9:134622775-134622797 ATGGAGGCAGGGAGGAAGGCAGG - Intergenic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062345212 9:136111285-136111307 GTGTGGGCAGGGAGGGCCGCTGG - Intergenic
1062694241 9:137865015-137865037 CTGTGGCCTGTGAGGGAAGCGGG + Intronic
1202795173 9_KI270719v1_random:114675-114697 CTGTGGGCTGGGGGGGCAGCTGG - Intergenic
1203771939 EBV:53932-53954 CTTTGGGCGGGGAGGGAAGCAGG + Intergenic
1185509484 X:652444-652466 ATGTGAGCTGGGAGGGAAGTGGG + Intronic
1185612145 X:1399079-1399101 ATGTGGGAAGGGAGGAAGGAGGG + Intergenic
1185612158 X:1399121-1399143 ACGTGGGAAGGGAGGGAGGAGGG + Intergenic
1185712355 X:2314309-2314331 AGGGAGGCAGGGAGGGAAGGAGG + Intronic
1185766959 X:2733128-2733150 AGGAAGGCAGGGAGGGAGGCAGG - Intronic
1186064940 X:5753080-5753102 AAGGAGGCAGGGAGGGAGGCAGG + Intergenic
1186064945 X:5753092-5753114 AGGGAGGCAGGGAGGGAGGCAGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186246601 X:7622426-7622448 AGGAAGGCAGGGAGGGAAGGAGG - Intergenic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186367390 X:8909871-8909893 ATGGGAGGAGGGAAGGAAGCTGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186442880 X:9601193-9601215 ATGTGGACAGAGATGGGAGCTGG - Intronic
1186523317 X:10224730-10224752 ATGTGGGGAGGGAGAGCATCAGG - Intronic
1186578659 X:10793543-10793565 ATGTGGGCAGGAGAGGGAGCAGG - Intronic
1186795476 X:13043790-13043812 CCGTGGGCAGGAAGGGCAGCAGG - Exonic
1187245616 X:17550696-17550718 AGGTGGGCAGAGGGGGAAGTGGG - Intronic
1188327526 X:28823789-28823811 ATGTGATCAGGGAGGCAAGAAGG - Intronic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1189255912 X:39638982-39639004 ATAAGGCCAGGAAGGGAAGCTGG - Intergenic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1192176406 X:68888641-68888663 ATGTGGTCAGAGAGGGAGGCAGG + Intergenic
1192202574 X:69076139-69076161 AATTTGGCAGGCAGGGAAGCTGG + Intergenic
1192478201 X:71461867-71461889 AGGTGGGGAGGGAGGAGAGCTGG + Intronic
1192569255 X:72189343-72189365 AGGTGGGGCAGGAGGGAAGCGGG - Intronic
1192587845 X:72333951-72333973 ATGTTCGCAGGGAGGAAAGGTGG + Intronic
1192899983 X:75486514-75486536 AGGTGGGCAGGCAGGCAAGGAGG + Intronic
1193188841 X:78545384-78545406 GTGTGGACAGGCAGGGAATCTGG + Intergenic
1193320912 X:80120049-80120071 AGGAGGGCAAGGTGGGAAGCAGG + Intergenic
1194826918 X:98575964-98575986 ATGTGGACTTGGAGGGAAGGGGG + Intergenic
1195172902 X:102286298-102286320 GTGTGGCCAGGCAGGGACGCTGG + Intergenic
1195185964 X:102400797-102400819 GTGTGGCCAGGCAGGGACGCTGG - Intronic
1195202536 X:102564761-102564783 AGGTGGGGAAGGAGGGAAGGTGG - Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195563467 X:106313216-106313238 AAGTGGGGAGGGTGGGAAGAGGG - Intergenic
1195593719 X:106663272-106663294 ATGTGAGGAGGTAGGGAAGAGGG - Intronic
1195720739 X:107865545-107865567 GGGTGGGCGGGGAGGGAAACAGG - Intronic
1195824758 X:108987348-108987370 AGGGAGGGAGGGAGGGAAGCAGG - Intergenic
1196874059 X:120141257-120141279 ATGGGGGGAGGTAGGGAAGGGGG - Intergenic
1196904563 X:120418926-120418948 ATGTGGACAGTGAGGGTAGCAGG - Intergenic
1197239024 X:124103563-124103585 TTGGGGGCAGGGTGGGAAGGGGG - Intronic
1197383125 X:125769886-125769908 TCATGGGGAGGGAGGGAAGCAGG - Intergenic
1197700779 X:129597964-129597986 ATGTGTACAGGGAGAGAAACTGG - Intergenic
1197802417 X:130365489-130365511 AAGTGGGCAGGGAGTGAAAGTGG + Intronic
1198019484 X:132644213-132644235 AAGGGGGGAGGGAGGGAAGGAGG + Intronic
1198103351 X:133440588-133440610 ATGTGAGCAGGGAGGAAGGGGGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198200089 X:134407839-134407861 AGGAGGTCAGGGAGGGAGGCAGG + Intronic
1198427698 X:136536241-136536263 ATGTGGGGAGGGAGGGAGCTGGG + Intronic
1198499235 X:137226205-137226227 AAGTGGCCAGGAAGGGAAGAAGG - Intergenic
1199259783 X:145758986-145759008 AAGTGGACAGGGAGAGAAGCAGG + Intergenic
1199766509 X:150945490-150945512 ATGAAGGCAGGGTGGGAAGTAGG - Intergenic
1199825837 X:151498419-151498441 GTGTGGACAGGGAGGGAGGTGGG + Intergenic
1199844781 X:151683340-151683362 ATGTTGCCAGGTAGAGAAGCGGG + Intergenic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1199982924 X:152930727-152930749 GTGTGGCCAGGGAGGTAGGCAGG + Intronic
1200082597 X:153585890-153585912 AAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1200147498 X:153934339-153934361 ATTTGGGCATGGGGGAAAGCAGG - Intronic
1200683629 Y:6242442-6242464 ATGTGTCCAGGGAGGGAACCTGG - Intergenic
1200686212 Y:6262734-6262756 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1200686247 Y:6262904-6262926 ATATGGGAAGGCAGGGCAGCGGG + Intergenic
1200738880 Y:6831590-6831612 AGGGAGGCAGGGAGGGAGGCAGG - Intergenic
1200831884 Y:7693362-7693384 GTGTGTCCAGGGAGGGAACCTGG + Intergenic
1200834362 Y:7718335-7718357 AGGTGGGGAGGCTGGGAAGCAGG - Intergenic
1200989094 Y:9333650-9333672 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1200989130 Y:9333820-9333842 ATATGGGAAGGCAGGGCAGCGGG + Intergenic
1200991751 Y:9353980-9354002 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1200991787 Y:9354150-9354172 ATATGGGAAGGCAGGGCAGCGGG + Intergenic
1200994405 Y:9374260-9374282 GTGTGTCCAGGGAGGGAACCCGG - Intronic
1200994441 Y:9374430-9374452 ATATGGGAAGGCAGGGCAGCGGG + Intronic
1200997068 Y:9394606-9394628 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1200997104 Y:9394776-9394798 ATATGGGAAGGCAGGGCAGCGGG + Intergenic
1200999584 Y:9463144-9463166 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1200999620 Y:9463314-9463336 ATATGGGAAGGCAGGGCAGCGGG + Intergenic
1201002242 Y:9483452-9483474 GTGTGTCCAGGGAGGGAACCCGG - Intronic
1201002278 Y:9483622-9483644 ATATGGGAAGGCAGGGCAGCGGG + Intronic
1201004901 Y:9503739-9503761 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201004937 Y:9503909-9503931 ATATGGGAAGGCAGGGCAGCGGG + Intergenic
1201007559 Y:9524066-9524088 GTGTGTCCAGGGAGGGAACCCGG - Intergenic
1201007595 Y:9524236-9524258 ATATGGGAAGGCAGGGCAGCGGG + Intergenic
1201010190 Y:9544256-9544278 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1201018464 Y:9626973-9626995 GTGTGTCCAGGGAGGGAAACTGG + Intergenic
1201049006 Y:9911944-9911966 ATGTGTCCAGGGAGGGAACCTGG + Intergenic
1201060421 Y:10038984-10039006 TTGTGCCCAGGGAGGGAAACTGG + Intergenic
1201438392 Y:13984811-13984833 GTGCGGGGAGGGAGGGAAGTGGG - Intergenic
1201446181 Y:14057897-14057919 GTGCGGGGAGGGAGGGAAGTGGG + Intergenic
1201918252 Y:19205701-19205723 ATCGGGGGAGGGAGAGAAGCAGG - Intergenic
1202115011 Y:21464337-21464359 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1202119242 Y:21507662-21507684 GTGTGTCCAGGGAGGGAACCTGG - Intergenic
1202121694 Y:21531202-21531224 GTGTGTCCAGGGAGGGAACCTGG - Intronic
1202157311 Y:21898180-21898202 GTGTGTCCAGGGAGGGAACCTGG + Intronic
1202159758 Y:21921721-21921743 GTGTGTCCAGGGAGGGAACCTGG + Intergenic
1202161862 Y:21942123-21942145 ATGTGCCCAGGGAGGGAAACTGG + Intergenic
1202229494 Y:22644250-22644272 ATGTGCCCAGGGAGGGAAACTGG - Intergenic
1202313662 Y:23551915-23551937 ATGTGCCCAGGGAGGGAAACTGG + Intergenic
1202557141 Y:26118680-26118702 ATGTGCCCAGGGAGGGAAACTGG - Intergenic