ID: 1147360009

View in Genome Browser
Species Human (GRCh38)
Location 17:39924528-39924550
Sequence TAGGGGGTGAGGCTGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2827
Summary {0: 1, 1: 0, 2: 14, 3: 271, 4: 2541}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147360009_1147360024 17 Left 1147360009 17:39924528-39924550 CCATCCCCCAGCCTCACCCCCTA 0: 1
1: 0
2: 14
3: 271
4: 2541
Right 1147360024 17:39924568-39924590 CCCTCTGCCGACAAAGCCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 166
1147360009_1147360026 18 Left 1147360009 17:39924528-39924550 CCATCCCCCAGCCTCACCCCCTA 0: 1
1: 0
2: 14
3: 271
4: 2541
Right 1147360026 17:39924569-39924591 CCTCTGCCGACAAAGCCCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 144
1147360009_1147360017 -7 Left 1147360009 17:39924528-39924550 CCATCCCCCAGCCTCACCCCCTA 0: 1
1: 0
2: 14
3: 271
4: 2541
Right 1147360017 17:39924544-39924566 CCCCCTATGGCACTCCCATGAGG 0: 1
1: 0
2: 1
3: 4
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147360009 Original CRISPR TAGGGGGTGAGGCTGGGGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr