ID: 1147361289

View in Genome Browser
Species Human (GRCh38)
Location 17:39932237-39932259
Sequence TAATATCCACAACATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147361289_1147361294 22 Left 1147361289 17:39932237-39932259 CCCTCCTCATGTTGTGGATATTA No data
Right 1147361294 17:39932282-39932304 GAAACACTCAAAACAATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147361289 Original CRISPR TAATATCCACAACATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr