ID: 1147363047

View in Genome Browser
Species Human (GRCh38)
Location 17:39943458-39943480
Sequence GGGTGTCAGGGCATCCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147363047 Original CRISPR GGGTGTCAGGGCATCCAGCT AGG (reversed) Intronic
900191468 1:1354029-1354051 AGGAGTGAGGACATCCAGCTAGG - Exonic
900192352 1:1356796-1356818 GGGTGTCACAGCATCCACTTTGG - Intronic
900615451 1:3563669-3563691 GGGTGTCAGGGGAGCCAGAGGGG - Intronic
900678523 1:3903378-3903400 GGGTGTCAGGCCTTACAGCTGGG - Intergenic
901053357 1:6437036-6437058 TGGAGTCAGAGCCTCCAGCTTGG - Intronic
901664684 1:10819593-10819615 GGGTGTGGGGGCAATCAGCTGGG + Intergenic
902480919 1:16711127-16711149 TGGAGTCAGAGCCTCCAGCTTGG + Intergenic
902840940 1:19073510-19073532 GCCTGCCAGGGCTTCCAGCTGGG + Intergenic
903211498 1:21821813-21821835 GGTTGCCAGGCCAGCCAGCTGGG - Intronic
904915517 1:33967640-33967662 GGAAGTCAGGGCTTCCATCTGGG + Intronic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
906254482 1:44337545-44337567 GGGTGTAAGGGAATGCAGCTTGG - Intronic
907408970 1:54271616-54271638 GGTTGGGAGGGCACCCAGCTCGG - Intronic
909267291 1:73577053-73577075 TGGTTTCAGGGAAGCCAGCTGGG - Intergenic
910999580 1:93148513-93148535 CGGTATCAGGGCATACAGCATGG + Intergenic
914884956 1:151577177-151577199 GGGGTTCAGAGCTTCCAGCTTGG - Intronic
918122413 1:181551178-181551200 TGGTGTCAGGGCATCCTGTTGGG + Intronic
920204254 1:204280368-204280390 GGGGTTCTGGGCATCCAGCCTGG - Intronic
920388084 1:205581952-205581974 GAGGGTCAGGGCTTCCAGCCGGG - Intronic
920865516 1:209748919-209748941 GGGTGGGAGGGAATCAAGCTGGG - Intergenic
921164200 1:212494379-212494401 GGGTGTTAGTGCATCCACCTGGG - Intergenic
922412813 1:225392233-225392255 GAGTCTCAGGGCCTCCTGCTGGG - Intronic
922511605 1:226172801-226172823 GGGTGTGGTGGCATACAGCTGGG + Intronic
923666749 1:236004831-236004853 GGCTGTCAGGGCATCACACTGGG + Intronic
923879261 1:238085413-238085435 GGCTGTCAGGCCACCGAGCTTGG + Intergenic
924123827 1:240829290-240829312 GGGAGGAAGGGCACCCAGCTGGG + Intronic
1063807431 10:9661627-9661649 GGCTGTCAGGGCTTCCAGCAGGG - Intergenic
1063862341 10:10324743-10324765 GGTGGTCAGAGCACCCAGCTTGG + Intergenic
1066288519 10:33992102-33992124 TGTTGCCAGGGCAACCAGCTGGG + Intergenic
1068939846 10:62670107-62670129 GGGTTTCACAGCAGCCAGCTGGG + Intronic
1069549797 10:69355228-69355250 GTGTGTCAGGGCTTATAGCTTGG + Intronic
1072733310 10:97862867-97862889 GGGTGTCACGGCAGCCTGCAGGG + Intronic
1074335499 10:112570188-112570210 TGGAGTCAGGGCATACATCTGGG + Intronic
1075293834 10:121254822-121254844 GGTTGTCAAGGCAGCCAGTTTGG + Intergenic
1075780481 10:125014175-125014197 GTGTGTCCCTGCATCCAGCTTGG - Intronic
1075834836 10:125444467-125444489 AAGTGTGAGGGCATCCAGGTTGG + Intergenic
1076911591 10:133392741-133392763 GGCAGTCAGGGCCTCCTGCTAGG - Intronic
1081595863 11:44459080-44459102 GGGTGTCAGGGCAGACATTTTGG + Intergenic
1083329982 11:61892978-61893000 GCTTGTCAGGACATCCAGCAAGG + Intergenic
1083749564 11:64753797-64753819 GGGAGTCGGGGCGTCCAGCCAGG - Intronic
1084599206 11:70134899-70134921 GGGTGTCAGAGCATCCGGAGAGG + Intronic
1085307027 11:75492274-75492296 CTGTGTCAGGTCACCCAGCTGGG + Intronic
1085383707 11:76143310-76143332 GGGTTGCAGGGCATCCAGCCTGG + Intergenic
1088684343 11:112272392-112272414 AGGTGTCAGGGCACCCACCCAGG - Intergenic
1092022008 12:5210699-5210721 GGTTGTCAGGGCATGATGCTGGG - Intergenic
1092830891 12:12443468-12443490 GGGTGGCAGGAAATCCAGGTGGG + Intronic
1093071901 12:14714639-14714661 GGGTATCATGGCAACCAGCCAGG - Intergenic
1093426936 12:19038300-19038322 TGGTGTCAGGGCCTGCAACTGGG - Intergenic
1098349095 12:69538937-69538959 GGGTGTCATGGCATCTAGGAGGG - Intronic
1100188636 12:92165380-92165402 GGGTATCCTTGCATCCAGCTGGG - Intergenic
1106582523 13:31030635-31030657 GGGTGTGAGGGCACCCAGAGAGG + Intergenic
1112318813 13:98388867-98388889 GGGGCTCAGGGCCTCCAGCAGGG - Intronic
1113539521 13:111095307-111095329 GGGTGGCAGGGCAGCAAGCCTGG + Intergenic
1114069851 14:19097972-19097994 CGCTGTCCGGGCATCCAGCTCGG + Intergenic
1114076107 14:19161970-19161992 TGGGGTCTGGGCATCCACCTAGG + Intergenic
1114086052 14:19237601-19237623 TGGGGTCTGGGCATCCACCTAGG - Intergenic
1114092411 14:19302030-19302052 CGCTGTCCGGGCATCCAGCTCGG - Intergenic
1117518833 14:56530158-56530180 GGCTGTCAGGGGAACTAGCTGGG - Intronic
1118718924 14:68580096-68580118 GGGTCTCAGGGCAGGCAGGTAGG - Intronic
1119339541 14:73865194-73865216 GGTTGTCGGGCCTTCCAGCTTGG - Intronic
1119780985 14:77276750-77276772 GGGAGCCAGGCCCTCCAGCTCGG + Exonic
1121235121 14:92386462-92386484 GGGTGCCGGGGGATCCAGCCAGG + Intronic
1122596128 14:102893808-102893830 TGTTGTCAGGCCAGCCAGCTCGG + Intronic
1122810622 14:104285985-104286007 GGGTCTCAGGGCATCTTCCTTGG - Intergenic
1202897594 14_GL000194v1_random:19222-19244 TGGGGTCTGGGCATCCACCTAGG - Intergenic
1127559113 15:60118291-60118313 GTGTGTTAGTGCAACCAGCTCGG + Intergenic
1127647357 15:60971919-60971941 AGGTTTCAGGGAATGCAGCTTGG - Intronic
1129102974 15:73283597-73283619 GGGTTTCCTGGCTTCCAGCTGGG - Intronic
1129217100 15:74106751-74106773 GGGTGTCCGGGCCCCCAGGTGGG - Intronic
1129407574 15:75329306-75329328 GGGTGTCCGGGCCCCCAGGTGGG + Intergenic
1130049533 15:80472141-80472163 AGTTGTCAGGGCATGCAGTTAGG + Intronic
1130674382 15:85939187-85939209 GGGTGTTAGGGAAAGCAGCTTGG + Intergenic
1130866616 15:87938710-87938732 GGGTGTTCCGGCATCCATCTGGG - Intronic
1131313020 15:91307810-91307832 GGGTGTAAGGGCAACAAGCAGGG + Intergenic
1131557765 15:93414334-93414356 GGGTGACATGGAATTCAGCTGGG - Intergenic
1132591604 16:728576-728598 GGGGGGCAGGGTACCCAGCTCGG - Exonic
1133445948 16:5861202-5861224 GGATGTGTGGGCAGCCAGCTGGG + Intergenic
1135411614 16:22239239-22239261 TGGTGCCACGGCATCCAGCCAGG + Intronic
1135652120 16:24215420-24215442 GGGTCAAAGGGCAACCAGCTTGG + Exonic
1137013443 16:35347195-35347217 ATGTGTCAGGGCATCCTGGTGGG + Intergenic
1137033588 16:35547729-35547751 GCATATCAGGGCATCCAGGTGGG + Intergenic
1137618093 16:49858514-49858536 CGCTGTCAGGGTGTCCAGCTAGG - Intergenic
1139182293 16:64762408-64762430 TGTTGCCAGGGCAACCAGCTGGG + Intergenic
1139434195 16:66926693-66926715 GGGTGGGAGGGCATCCATTTGGG + Intergenic
1142620632 17:1163524-1163546 GGATGTCGGAGCATCCAGGTGGG + Intronic
1142620649 17:1163625-1163647 GGATGTCGGAGCATCCAGGTGGG + Intronic
1142620732 17:1164130-1164152 GGATGTCGGAGCATCCAGGTGGG + Intronic
1143117884 17:4590894-4590916 GGGCGGCAGGGCAGGCAGCTTGG + Intronic
1146005637 17:29158935-29158957 GGGTGTCAGGGCAGGCAGGAAGG + Intronic
1147363047 17:39943458-39943480 GGGTGTCAGGGCATCCAGCTAGG - Intronic
1147888107 17:43698187-43698209 GGGTGGGAGGGCATCCAGCTTGG + Intergenic
1150492892 17:65586599-65586621 GGGGGTCAGGGCATCAACATGGG + Intronic
1151070037 17:71198967-71198989 CGGTGTCATGACCTCCAGCTAGG + Intergenic
1152019487 17:77772940-77772962 GGGGATCAGGGCATCCTGGTGGG - Intergenic
1152238178 17:79149234-79149256 AGGTGGCAGGGCATCCATCTGGG + Intronic
1152656867 17:81523896-81523918 GCGTTGCAGGGCATCCAGCCTGG + Intergenic
1152681488 17:81670600-81670622 GCGAGTCGGAGCATCCAGCTGGG + Intronic
1160738871 19:676925-676947 GGGAGCCAGGCCCTCCAGCTGGG + Intronic
1164432133 19:28197739-28197761 GGGCATCAGGGCATCCAGAGAGG + Intergenic
1164899071 19:31902956-31902978 TGGTGGCAGGGCAGCCAGGTTGG - Intergenic
1165008267 19:32823928-32823950 GGACGTCAGGGCAGCCAGGTGGG + Intronic
1166862041 19:45816440-45816462 GGGAGTCTGGGGATCCAGATGGG + Intronic
1167264014 19:48474412-48474434 GGGGGTGAGGGCAGACAGCTTGG - Intronic
1167266517 19:48485563-48485585 GGGGGTCAGGGGAGCCATCTGGG + Exonic
1167566764 19:50261709-50261731 AGGTGTCAGGGCCTCCAGGATGG + Intronic
1167624041 19:50575173-50575195 GGGTGTCTTGGCATCTAGTTTGG - Intergenic
1167745846 19:51351491-51351513 TGGGGCCAGGGCCTCCAGCTGGG - Intronic
1202714956 1_KI270714v1_random:37032-37054 TGGAGTCAGAGCCTCCAGCTTGG + Intergenic
931402974 2:61948927-61948949 GGGTCTCAGAGGAGCCAGCTTGG + Intronic
932474169 2:71991075-71991097 GAGTGTCAGGGTATGCACCTGGG - Intergenic
933238611 2:79894311-79894333 GGGGGGCAGGGCAACCAGTTAGG - Intronic
934648727 2:96074457-96074479 GAGAGTCAGGGCCTCCTGCTTGG - Intergenic
937891162 2:126940043-126940065 GGGCTTCAGGGGAGCCAGCTGGG - Intergenic
937916960 2:127103956-127103978 GGTTGCCAGGGCCTCCAGCATGG - Intronic
940792630 2:158044479-158044501 GAGAGTCAGGTCAGCCAGCTAGG + Intronic
940855356 2:158724866-158724888 GGCTGTCAGGGCATGCTCCTTGG + Intergenic
944632658 2:201643042-201643064 GGGTGCCGGGGCTTCCAGCCAGG - Intronic
946532286 2:220583924-220583946 GGGTGCCATGGCAACCAGATGGG + Intergenic
948803552 2:240443472-240443494 GGGTGACAGGGCAGCCACCCAGG + Intronic
1169191963 20:3663492-3663514 GGGTATCAGCGCAGACAGCTGGG - Intergenic
1170480952 20:16764421-16764443 GGCTGAGAGGGCATGCAGCTAGG - Intronic
1175214539 20:57384759-57384781 GGGAGCCAGGGCATCCATTTGGG + Intergenic
1175864228 20:62166086-62166108 GGGTTTCAGGGCAGCCAGGGTGG - Intronic
1176617278 21:9035211-9035233 TGGGGTCTGGGCATCCACCTAGG - Intergenic
1178395017 21:32235411-32235433 GGGAGTGAGGGCAACCAGATAGG - Intergenic
1178908384 21:36654548-36654570 GGGTATCAGAGCAGCCAGCCCGG - Intergenic
1180091703 21:45536822-45536844 GGGTGTCGGGGTGACCAGCTGGG + Intronic
1180183157 21:46126930-46126952 GGGTGTCAGTGCTTCCACCCCGG - Intronic
1180291915 22:10855592-10855614 TGGGGTCTGGGCATCCACCTAGG + Intergenic
1180488317 22:15820536-15820558 CGCTGTCCGGGCATCCAGCTCGG + Intergenic
1180494719 22:15885014-15885036 TGGGGTCTGGGCATCCACCTAGG + Intergenic
1181042246 22:20197674-20197696 GGGTGCCAGTGCCACCAGCTGGG + Intergenic
1183571322 22:38655843-38655865 GTGTATCAGGGCATCCAGTGAGG - Intronic
1183677867 22:39309854-39309876 GGGAGACAGGAGATCCAGCTGGG + Intergenic
1183711402 22:39505881-39505903 GGGTGTAAGGCCTGCCAGCTGGG + Intronic
1183747443 22:39699720-39699742 GGGTGTCAGGACTCCCAGCTGGG - Intergenic
1184337330 22:43861752-43861774 GGGCGTCAGGGCTTTCAGCGTGG - Intronic
1184832146 22:46995722-46995744 GGGTGACAGGGCACACAGCAAGG - Intronic
949626493 3:5872691-5872713 GGATGACAGTACATCCAGCTTGG + Intergenic
950778627 3:15372344-15372366 GGGTGTCTGGGCATCCAATCAGG + Intergenic
953336641 3:42099292-42099314 GAGACTCAGGCCATCCAGCTGGG - Intronic
953886446 3:46717101-46717123 GGGTGTCAGGGCCTGGAGCAGGG + Intronic
959320139 3:104863012-104863034 AGGTTACAGGGCAACCAGCTAGG + Intergenic
961269853 3:125680552-125680574 TGGTGACAGGGTATCCACCTTGG - Intergenic
961860908 3:129916454-129916476 GGGTGTCATGGCCTCCTGCCTGG - Intergenic
962746940 3:138403870-138403892 GGGTGTCTTGGCATCCAGTTGGG - Exonic
963217593 3:142766698-142766720 GTGTTTGAGGGCATCCAGCATGG - Intronic
967227431 3:187305476-187305498 GGGAGACAGGGAAACCAGCTGGG + Intergenic
967315371 3:188147686-188147708 GGGTGACAGTGACTCCAGCTCGG - Intergenic
968040277 3:195582998-195583020 AGGTGACAGTGCATCCACCTTGG + Intronic
969892152 4:10269845-10269867 GGATGAAAGGGCATCCACCTGGG + Intergenic
970950921 4:21754380-21754402 GTGTTTCAGGGCAGCCAACTTGG + Intronic
976012480 4:80507725-80507747 GGGTGTAAGAGCATCAAACTGGG - Intronic
979987501 4:127333106-127333128 AGGTCTCAGGGCTTCCATCTAGG - Intergenic
981011093 4:139925865-139925887 GGGTGTCAGTCCATTCACCTTGG + Intronic
985132440 4:186752206-186752228 GGGTCTCAGGACGTCCAGCTTGG - Intergenic
986129548 5:4914685-4914707 GAGTCTGAGGGCCTCCAGCTAGG - Intergenic
987087327 5:14483202-14483224 GGCAGGGAGGGCATCCAGCTGGG - Intronic
990792277 5:59495664-59495686 GGGTGGCAAGACATGCAGCTAGG + Intronic
990979951 5:61593350-61593372 GGTTTTCAGGGCCTCCAACTTGG - Intergenic
992072986 5:73165771-73165793 GGGTATCAGGGCTTAGAGCTTGG + Intergenic
997239429 5:132295578-132295600 GAGGGCCAGGGCTTCCAGCTGGG - Intronic
999232103 5:150067737-150067759 GGGTGTCCTGGCACCCAGCACGG - Intronic
999470508 5:151850570-151850592 AGGTTTCATGGAATCCAGCTAGG - Intronic
1000197318 5:158972237-158972259 GAGTGACAGGGCATCCAGCTGGG - Intronic
1000574139 5:162954813-162954835 AGTGGTCAGGGCATACAGCTTGG + Intergenic
1001487108 5:172127597-172127619 GGGTGTCAGAGCCTCCAGTGAGG - Intronic
1001771766 5:174302221-174302243 GGGTGTTAGGGGCTCCAGCCTGG + Intergenic
1002575352 5:180170981-180171003 GGGATTCAGGGCCTCCAGTTTGG - Intronic
1002779985 6:358510-358532 GGGTGTCAGAGCAACCAGACTGG + Intergenic
1002789124 6:424831-424853 GGGTGTCAGGGCCTCCTCCTGGG + Intergenic
1002835425 6:861472-861494 GGGTGTCAGGGCTTCCACTGGGG - Intergenic
1003365807 6:5473889-5473911 GGGTGTAAAGGTATCCAGCAGGG - Intronic
1006183071 6:32165590-32165612 GGGTGTGAGGGTATATAGCTAGG - Intronic
1007269378 6:40624485-40624507 GGGTGTCAGGGACTGCATCTAGG + Intergenic
1007397520 6:41586133-41586155 GGGTGTCAGGGCAGCCTTCTGGG - Intronic
1007727057 6:43922925-43922947 AGGGGGCAGGGCAACCAGCTGGG + Intergenic
1009902561 6:69826245-69826267 GTGATTCAGGGCATTCAGCTAGG + Intergenic
1014090579 6:117399584-117399606 GAGGGTTAGGGCATCCAGCCTGG + Intronic
1015512181 6:134048854-134048876 GGGAGTCAGGCCAACCAGCTTGG - Intronic
1016845277 6:148563077-148563099 GGGTGACTGGGTATCCACCTAGG + Intergenic
1017765340 6:157602663-157602685 GGCAGGCAGGGCATCCAGCCTGG + Intronic
1017859824 6:158385327-158385349 TGCAGTCAGGGCATCCAGCGTGG + Intronic
1018684624 6:166294363-166294385 GGCTGTCAGAGCAACCAGTTGGG - Intergenic
1020061528 7:5156065-5156087 GGGGGGCAGGGCATGAAGCTTGG - Intergenic
1020166629 7:5812595-5812617 GGGGGGCAGGGCATGAAGCTTGG + Intergenic
1020276322 7:6626879-6626901 GGGTCTCAGGGCAGGCTGCTGGG - Intergenic
1030128048 7:106173293-106173315 GGCTTTCATGGCATCCAGGTGGG - Intergenic
1031235303 7:119168404-119168426 GGGTCACTGGGCATCCAGCATGG + Intergenic
1039896295 8:41719113-41719135 GGGAGTCTGGGGATCCAGCAGGG - Intronic
1045184564 8:99824175-99824197 GTGTGTCAGGGCCTCCTTCTTGG - Intronic
1047932789 8:129747710-129747732 TGGTGGCAGGACAACCAGCTGGG + Intergenic
1050028707 9:1363000-1363022 CGGTGCCAGCACATCCAGCTTGG + Intergenic
1060602794 9:124889242-124889264 GGTCCTCAGGGCCTCCAGCTCGG + Exonic
1060804723 9:126567699-126567721 GGTTCTCAGGTCTTCCAGCTTGG - Intergenic
1062067685 9:134537494-134537516 AGGTCTCAGGCCAACCAGCTGGG + Intergenic
1062282579 9:135758641-135758663 GGGTGTCGGGCCACCAAGCTGGG + Intronic
1062630299 9:137460278-137460300 GGAAGTCAGGGCTTCCAGCAGGG + Exonic
1189704136 X:43743087-43743109 GGGGGGCAGGACATGCAGCTTGG + Intronic
1195475909 X:105285039-105285061 AGCTGTTAGGGCATTCAGCTTGG - Intronic
1199844266 X:151679348-151679370 TGGGGTCAGGGCCTCCATCTGGG - Intergenic
1200790209 Y:7292824-7292846 GTGAGCCAGGGCACCCAGCTGGG + Intergenic