ID: 1147363674

View in Genome Browser
Species Human (GRCh38)
Location 17:39946617-39946639
Sequence CCGACCAAAGGGGTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147363674_1147363687 -3 Left 1147363674 17:39946617-39946639 CCCTCCACCACCCCTTTGGTCGG No data
Right 1147363687 17:39946637-39946659 CGGGGGTGCTCCTGCTGGGCTGG No data
1147363674_1147363686 -7 Left 1147363674 17:39946617-39946639 CCCTCCACCACCCCTTTGGTCGG No data
Right 1147363686 17:39946633-39946655 TGGTCGGGGGTGCTCCTGCTGGG No data
1147363674_1147363685 -8 Left 1147363674 17:39946617-39946639 CCCTCCACCACCCCTTTGGTCGG No data
Right 1147363685 17:39946632-39946654 TTGGTCGGGGGTGCTCCTGCTGG No data
1147363674_1147363688 0 Left 1147363674 17:39946617-39946639 CCCTCCACCACCCCTTTGGTCGG No data
Right 1147363688 17:39946640-39946662 GGGTGCTCCTGCTGGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147363674 Original CRISPR CCGACCAAAGGGGTGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr