ID: 1147363757

View in Genome Browser
Species Human (GRCh38)
Location 17:39946936-39946958
Sequence GTGAGGCAGCTGGACAGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147363748_1147363757 22 Left 1147363748 17:39946891-39946913 CCAGGGATCACAGGACCCTGGGT No data
Right 1147363757 17:39946936-39946958 GTGAGGCAGCTGGACAGCCTCGG No data
1147363745_1147363757 29 Left 1147363745 17:39946884-39946906 CCATGGACCAGGGATCACAGGAC No data
Right 1147363757 17:39946936-39946958 GTGAGGCAGCTGGACAGCCTCGG No data
1147363749_1147363757 7 Left 1147363749 17:39946906-39946928 CCCTGGGTTTTGAGAAACCACGG No data
Right 1147363757 17:39946936-39946958 GTGAGGCAGCTGGACAGCCTCGG No data
1147363751_1147363757 6 Left 1147363751 17:39946907-39946929 CCTGGGTTTTGAGAAACCACGGA No data
Right 1147363757 17:39946936-39946958 GTGAGGCAGCTGGACAGCCTCGG No data
1147363754_1147363757 -10 Left 1147363754 17:39946923-39946945 CCACGGAAGCCTGGTGAGGCAGC No data
Right 1147363757 17:39946936-39946958 GTGAGGCAGCTGGACAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147363757 Original CRISPR GTGAGGCAGCTGGACAGCCT CGG Intergenic
No off target data available for this crispr