ID: 1147364648

View in Genome Browser
Species Human (GRCh38)
Location 17:39952186-39952208
Sequence AGGGGTCCCCTGGACATTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147364631_1147364648 30 Left 1147364631 17:39952133-39952155 CCAGAGCCCCTTCGCAAGGGAAA No data
Right 1147364648 17:39952186-39952208 AGGGGTCCCCTGGACATTGGCGG No data
1147364634_1147364648 22 Left 1147364634 17:39952141-39952163 CCTTCGCAAGGGAAAGACTTTGG No data
Right 1147364648 17:39952186-39952208 AGGGGTCCCCTGGACATTGGCGG No data
1147364633_1147364648 23 Left 1147364633 17:39952140-39952162 CCCTTCGCAAGGGAAAGACTTTG No data
Right 1147364648 17:39952186-39952208 AGGGGTCCCCTGGACATTGGCGG No data
1147364632_1147364648 24 Left 1147364632 17:39952139-39952161 CCCCTTCGCAAGGGAAAGACTTT No data
Right 1147364648 17:39952186-39952208 AGGGGTCCCCTGGACATTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147364648 Original CRISPR AGGGGTCCCCTGGACATTGG CGG Intergenic
No off target data available for this crispr