ID: 1147366310

View in Genome Browser
Species Human (GRCh38)
Location 17:39961679-39961701
Sequence AAGGAAACGTTCAGTAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147366304_1147366310 20 Left 1147366304 17:39961636-39961658 CCTAAGTGTGGAATGGTCTAGTC No data
Right 1147366310 17:39961679-39961701 AAGGAAACGTTCAGTAAAGATGG No data
1147366306_1147366310 -10 Left 1147366306 17:39961666-39961688 CCATCAGCCCCTCAAGGAAACGT No data
Right 1147366310 17:39961679-39961701 AAGGAAACGTTCAGTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147366310 Original CRISPR AAGGAAACGTTCAGTAAAGA TGG Intergenic
No off target data available for this crispr