ID: 1147368762

View in Genome Browser
Species Human (GRCh38)
Location 17:39976921-39976943
Sequence GAGGCTCTAGTCGGGCTGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147368748_1147368762 22 Left 1147368748 17:39976876-39976898 CCTGAGCTGCTCTCCTCCCTTGG 0: 1
1: 0
2: 0
3: 60
4: 376
Right 1147368762 17:39976921-39976943 GAGGCTCTAGTCGGGCTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 91
1147368755_1147368762 5 Left 1147368755 17:39976893-39976915 CCTTGGGGACGAGGAGCTGACCC 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1147368762 17:39976921-39976943 GAGGCTCTAGTCGGGCTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 91
1147368754_1147368762 6 Left 1147368754 17:39976892-39976914 CCCTTGGGGACGAGGAGCTGACC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1147368762 17:39976921-39976943 GAGGCTCTAGTCGGGCTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 91
1147368747_1147368762 29 Left 1147368747 17:39976869-39976891 CCTGCAACCTGAGCTGCTCTCCT 0: 1
1: 0
2: 0
3: 33
4: 268
Right 1147368762 17:39976921-39976943 GAGGCTCTAGTCGGGCTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 91
1147368746_1147368762 30 Left 1147368746 17:39976868-39976890 CCCTGCAACCTGAGCTGCTCTCC 0: 1
1: 0
2: 1
3: 34
4: 264
Right 1147368762 17:39976921-39976943 GAGGCTCTAGTCGGGCTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 91
1147368753_1147368762 9 Left 1147368753 17:39976889-39976911 CCTCCCTTGGGGACGAGGAGCTG 0: 1
1: 0
2: 1
3: 18
4: 181
Right 1147368762 17:39976921-39976943 GAGGCTCTAGTCGGGCTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147368762 Original CRISPR GAGGCTCTAGTCGGGCTGAG TGG Exonic
901255713 1:7824808-7824830 GAGTCTCTAGTCTGGCGGATGGG + Intronic
912746371 1:112248760-112248782 GAGGCTCCTGGAGGGCTGAGAGG - Intergenic
914785332 1:150824126-150824148 GAGTCTCTGGCCGGGCTCAGTGG - Intronic
1063167829 10:3479870-3479892 GAGGCTATTGTCTGACTGAGAGG + Intergenic
1066000354 10:31099246-31099268 GAGACTCCAGGCGGTCTGAGTGG - Intergenic
1070777381 10:79117818-79117840 GAGGCTCAGGGCGGGCAGAGGGG - Intronic
1071518645 10:86315478-86315500 GAGGCTGTAGTAGTTCTGAGAGG - Intronic
1072119703 10:92395623-92395645 GTGGCTCCAGTTGGGGTGAGTGG + Intergenic
1073216996 10:101842000-101842022 GAGGCCCTAGTCAGGATCAGGGG - Intronic
1073351450 10:102822871-102822893 GAGGCTCTGGTGAGGATGAGAGG - Intergenic
1076062789 10:127426761-127426783 GAGGCTCTGCTCGGGATGAAGGG + Intronic
1076299399 10:129413392-129413414 AAGGCTCTAGTCTGGCAGATGGG - Intergenic
1078999361 11:16738491-16738513 GAGGCTCAATTCGCGCTGTGTGG - Exonic
1083592967 11:63905936-63905958 GGGACTCTAGTCTCGCTGAGCGG + Intronic
1083826633 11:65207623-65207645 GAGACTCAAGCCGGGCTCAGTGG + Intronic
1089530042 11:119121748-119121770 GAGGTTCCAGTCGGGGTGAGGGG - Intronic
1090206226 11:124885824-124885846 GAGACTCAAGTCGGGGTAAGAGG + Intronic
1091622703 12:2101413-2101435 GAGGCTCTAGGAGGGGTTAGGGG + Intronic
1092315994 12:7413943-7413965 GAATCTCTAGCCAGGCTGAGTGG + Intronic
1095612609 12:44147586-44147608 GAGGTTCTTGTTGGGGTGAGGGG + Intronic
1096578225 12:52568105-52568127 GTGGCTCCTGTCTGGCTGAGGGG - Intronic
1097156622 12:57016568-57016590 GAGGGTCTAGGGGAGCTGAGGGG + Intronic
1102997259 12:117360456-117360478 GAGGCTCTAGGGAGGCCGAGGGG - Intronic
1120038900 14:79729886-79729908 GAGGCACTAATTGGGCTGACTGG + Intronic
1122581802 14:102776426-102776448 GAGGCTCTGGGCCAGCTGAGGGG - Intergenic
1132585258 16:703405-703427 GAGGTTCTATGAGGGCTGAGTGG - Intronic
1134439835 16:14292709-14292731 GAGGCACTGGTCTGGGTGAGTGG - Intergenic
1134669064 16:16041217-16041239 GAGGCTCCAGTCAGGCACAGTGG - Intronic
1135142955 16:19937097-19937119 AAGGCTCCAGTCGGGCACAGTGG - Intergenic
1136398361 16:30005050-30005072 GAGGCTCTCGAGGGGCTGAGGGG + Intronic
1142196726 16:88742482-88742504 GGGGCTATTGTCCGGCTGAGCGG - Intronic
1143082100 17:4389306-4389328 GAGGCCCTAGTCTGGCCCAGGGG - Intergenic
1147368762 17:39976921-39976943 GAGGCTCTAGTCGGGCTGAGTGG + Exonic
1147791948 17:43019623-43019645 GAGGCTCTCGTGGGGGTGGGGGG - Intronic
1147894202 17:43739957-43739979 GAAGATCTAGACAGGCTGAGAGG + Intergenic
1148342934 17:46884164-46884186 CAGGCTCTGGTGGGGCTGTGTGG - Intronic
1149659833 17:58328533-58328555 AAGCCTCTGGCCGGGCTGAGGGG - Intronic
1152589906 17:81206484-81206506 GAGGCTCACATGGGGCTGAGAGG - Intronic
1155029468 18:21971702-21971724 GAGGCTTTAGTGGGGATAAGAGG - Intergenic
1155418464 18:25627601-25627623 GAAGCTCTAGTCAGGCTGATTGG - Intergenic
1160021486 18:75185172-75185194 AAGGCTCTGGTCCAGCTGAGAGG - Intergenic
1161067235 19:2244639-2244661 GCGGCTCGCGGCGGGCTGAGTGG + Intronic
1161636906 19:5394879-5394901 GCGGCTCTAGTCCGTCAGAGGGG - Intergenic
1162496359 19:11025304-11025326 GACGCTCTAGTGGGGAAGAGTGG - Intronic
1164785402 19:30926519-30926541 GAGGCTCCAGTCTGGCTGGCTGG - Intergenic
1165045113 19:33098373-33098395 GAGGCTCTTGTTGGGATAAGAGG + Intronic
1167791839 19:51688217-51688239 GAGGCTCTAGTCAGACTTAAGGG + Intergenic
931668547 2:64627050-64627072 GAGGCTCCCGTGGAGCTGAGGGG - Intergenic
935695285 2:105766139-105766161 GAGGCGCAGGTGGGGCTGAGTGG + Intronic
937001912 2:118475369-118475391 AATGCTGTAGTAGGGCTGAGGGG + Intergenic
937789704 2:125945420-125945442 GAGGCTCTGTAAGGGCTGAGTGG - Intergenic
938260418 2:129891924-129891946 GACGCTCTAGTGGGGCTGCAGGG - Intergenic
946706114 2:222460351-222460373 GAGGCTCCAGTGGGGCTGCTGGG + Intronic
1172110512 20:32541974-32541996 GAGGCTCTACTTGGGCTGGGAGG - Intronic
1173530563 20:43766458-43766480 GAGGCTGGAGTCGGGCTGGGAGG - Intergenic
1179724667 21:43335451-43335473 GAGGCCCAAGAGGGGCTGAGGGG + Intergenic
1183731955 22:39623081-39623103 GAGGCTGCAGGCGGGCTTAGGGG + Intronic
1183875409 22:40776010-40776032 AAGGCCCTAGTGGGGCAGAGTGG - Intronic
1185031935 22:48448734-48448756 GAGGCTCTTGTCAGGCTGTAGGG - Intergenic
950776568 3:15355547-15355569 GAAACCCTAGTCAGGCTGAGGGG - Intergenic
951139726 3:19146970-19146992 GAGGCTCTAGGCTAGCTGGGCGG - Intergenic
953539046 3:43798192-43798214 GAAGCTCTAGTGGGGCCAAGGGG + Intergenic
954337802 3:49929851-49929873 GCGGGCCGAGTCGGGCTGAGCGG - Exonic
959316610 3:104816024-104816046 GAAGCCTTAGTTGGGCTGAGAGG - Intergenic
962753220 3:138449914-138449936 GAAGCTCTAGGAGGGCTGACTGG - Intronic
967988169 3:195111470-195111492 GAGGGTCTGGCTGGGCTGAGTGG + Intronic
969275757 4:6134827-6134849 GAGGCTCTGGTGGGGGAGAGAGG - Intronic
969872005 4:10110480-10110502 GAGGCCACAGTGGGGCTGAGAGG + Intronic
973893946 4:55394237-55394259 GAGGCTCCAGTCTTGCCGAGTGG - Intergenic
977447919 4:97155203-97155225 CAGGGCCTAGTCGGGCTCAGAGG - Intergenic
977941109 4:102860532-102860554 GAATCTCTAGTCAGGCTGACTGG - Intronic
982560446 4:156923176-156923198 GGGGATCTAGTGGGGCAGAGTGG - Intronic
992690539 5:79236671-79236693 GACGCTCGAGTCGGACTGGGTGG + Exonic
997360362 5:133290981-133291003 GAGGCTCTAGGGAGACTGAGGGG - Intronic
998871813 5:146560296-146560318 GAGCCACTAGTCAGGCAGAGAGG - Intergenic
1001013057 5:168115854-168115876 GAGGCTCTATCTGGGCTCAGGGG + Intronic
1002562209 5:180090245-180090267 GAGGCTCAGGTCTGGCTGAAGGG + Intergenic
1003427365 6:6006664-6006686 CAGCCTCCAGCCGGGCTGAGCGG + Intronic
1006084920 6:31588773-31588795 GAGGCTCGAGATGGACTGAGAGG - Exonic
1006726329 6:36201616-36201638 GAAGCTCAAGGCGGGGTGAGTGG + Exonic
1019340408 7:506407-506429 GAGTCTCTAGGTGGGCGGAGTGG - Intronic
1021868839 7:24983483-24983505 GAGGCTCTATTTGGACTTAGCGG - Intergenic
1026326391 7:69314354-69314376 GAGGCTCCAGGAGGGCTGGGTGG - Intergenic
1031886544 7:127251492-127251514 GGGGCTCCTGGCGGGCTGAGTGG - Intronic
1038441741 8:27575421-27575443 GGGACTCTGGTCAGGCTGAGAGG + Intergenic
1041959222 8:63593669-63593691 GAATCTCTAGTCTGGCTGACAGG - Intergenic
1043392011 8:79800950-79800972 GAGGCTCTAGGTGTGCAGAGAGG + Intergenic
1045871763 8:106935115-106935137 GTGGCTCTAGGAGGCCTGAGAGG + Intergenic
1047402357 8:124557591-124557613 GAGGGGATAGTCGGGGTGAGGGG + Intronic
1048133476 8:131722644-131722666 CTGGCTTTAGTCTGGCTGAGAGG - Intergenic
1051223855 9:14878329-14878351 GAGGCTTTAGTGGGGGAGAGAGG - Intronic
1057220201 9:93253393-93253415 GAGGCTATGGTAGAGCTGAGTGG + Intronic
1059331222 9:113536960-113536982 AAGGGTCTAGGCTGGCTGAGGGG - Intronic
1059962479 9:119578813-119578835 GAGGCTCTAGCCCAGGTGAGAGG - Intergenic
1061660271 9:132125488-132125510 GAGGCAGGAGGCGGGCTGAGAGG - Intergenic
1061850559 9:133412478-133412500 AAGGCTCTTGTCAGGCTGAAGGG + Exonic
1185471620 X:387045-387067 GAGGCTTTGGTGGGGCCGAGCGG + Intergenic
1189324831 X:40105970-40105992 GAGGCTAGAGTAGGGCTGAGGGG - Intronic