ID: 1147369414

View in Genome Browser
Species Human (GRCh38)
Location 17:39981217-39981239
Sequence GTCGCTGTCACCCGCGATCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147369414_1147369419 1 Left 1147369414 17:39981217-39981239 CCGCGATCGCGGGTGACAGCGAC 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1147369419 17:39981241-39981263 CCTGTGATTTGGCTTCTTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 194
1147369414_1147369415 -10 Left 1147369414 17:39981217-39981239 CCGCGATCGCGGGTGACAGCGAC 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1147369415 17:39981230-39981252 TGACAGCGACCCCTGTGATTTGG 0: 1
1: 0
2: 1
3: 3
4: 61
1147369414_1147369420 2 Left 1147369414 17:39981217-39981239 CCGCGATCGCGGGTGACAGCGAC 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1147369420 17:39981242-39981264 CTGTGATTTGGCTTCTTGCTGGG 0: 1
1: 0
2: 0
3: 30
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147369414 Original CRISPR GTCGCTGTCACCCGCGATCG CGG (reversed) Intronic
1064418199 10:15168595-15168617 CTCGCTGTCCTCCGCCATCGCGG + Exonic
1104932253 12:132345934-132345956 GTCGCTGGGACCCGCCAACGTGG + Intergenic
1122247386 14:100413473-100413495 GTCGCAGTGAGCCGAGATCGTGG - Intronic
1131977442 15:97960769-97960791 GCCGCTGTCACAGGCGCTCGCGG - Exonic
1132812891 16:1810127-1810149 GTCGCTGTCACCCAGGCTGGAGG - Intronic
1147369414 17:39981217-39981239 GTCGCTGTCACCCGCGATCGCGG - Intronic
928186427 2:29115305-29115327 GACGCTGTCAGCCGGGGTCGCGG + Intronic
945290693 2:208124407-208124429 GTCTCTGGCCCCCGCGATGGAGG + Intronic
991779115 5:70115125-70115147 GTTGCAGTCAGCCGAGATCGTGG + Intergenic
991858407 5:70990598-70990620 GTTGCAGTCAGCCGAGATCGTGG + Intronic
991871564 5:71115480-71115502 GTTGCAGTCAGCCGAGATCGTGG + Intergenic
993649793 5:90506165-90506187 GTTGCTGTGAGCCGAGATCGTGG + Intronic
1017772182 6:157651953-157651975 CTGGCTGTCACCCGCGCTAGAGG + Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1185864594 X:3612290-3612312 GTCGCCGTCACCAGCTATCTTGG + Exonic
1187541741 X:20203322-20203344 GTTGCTGTGAGCCGAGATCGTGG - Intronic