ID: 1147374637

View in Genome Browser
Species Human (GRCh38)
Location 17:40016354-40016376
Sequence AAGGATAAGGCTAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 307}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147374622_1147374637 25 Left 1147374622 17:40016306-40016328 CCCTGAGCAGCTGCCCCAGCCAG 0: 1
1: 0
2: 0
3: 48
4: 464
Right 1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 307
1147374627_1147374637 11 Left 1147374627 17:40016320-40016342 CCCAGCCAGGCCCTGCAGCTGGT 0: 1
1: 0
2: 6
3: 47
4: 404
Right 1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 307
1147374625_1147374637 12 Left 1147374625 17:40016319-40016341 CCCCAGCCAGGCCCTGCAGCTGG 0: 1
1: 1
2: 26
3: 87
4: 765
Right 1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 307
1147374628_1147374637 10 Left 1147374628 17:40016321-40016343 CCAGCCAGGCCCTGCAGCTGGTG 0: 1
1: 0
2: 7
3: 69
4: 447
Right 1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 307
1147374632_1147374637 0 Left 1147374632 17:40016331-40016353 CCTGCAGCTGGTGAGTGTCAGGA 0: 1
1: 0
2: 0
3: 32
4: 276
Right 1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 307
1147374621_1147374637 26 Left 1147374621 17:40016305-40016327 CCCCTGAGCAGCTGCCCCAGCCA 0: 1
1: 0
2: 3
3: 56
4: 455
Right 1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 307
1147374629_1147374637 6 Left 1147374629 17:40016325-40016347 CCAGGCCCTGCAGCTGGTGAGTG 0: 1
1: 1
2: 5
3: 55
4: 445
Right 1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 307
1147374623_1147374637 24 Left 1147374623 17:40016307-40016329 CCTGAGCAGCTGCCCCAGCCAGG 0: 1
1: 0
2: 7
3: 77
4: 721
Right 1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 307
1147374630_1147374637 1 Left 1147374630 17:40016330-40016352 CCCTGCAGCTGGTGAGTGTCAGG 0: 1
1: 0
2: 3
3: 32
4: 323
Right 1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG 0: 1
1: 0
2: 2
3: 25
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147374637 Original CRISPR AAGGATAAGGCTAATGAGGA GGG Intronic
901572095 1:10169208-10169230 CAGGACAAGGGTAGTGAGGAAGG + Intronic
901905795 1:12408754-12408776 AAAGATAAGGCTAGAGAGAAAGG - Intronic
901912589 1:12472507-12472529 AAGCAGAAAGCTAATTAGGATGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904983700 1:34527289-34527311 AAGGATAAGGCCCACGAGGGCGG - Intergenic
906449849 1:45936109-45936131 AAGAATATGGCTAAAGAGGGAGG - Intronic
906451696 1:45954864-45954886 AAGGTTAAGGCAAATGAAGCTGG + Intronic
908467062 1:64406738-64406760 ATGGAAAAGGCTAGTGAGGGAGG + Intergenic
908959564 1:69679296-69679318 AAGGATAAAGCTAATGTAGTGGG + Intronic
910431968 1:87167826-87167848 AAGGATAAAGCTATAGAGGCAGG + Intronic
910450481 1:87338662-87338684 AAGGAAAAGGCTGCAGAGGAGGG - Intronic
910646110 1:89517186-89517208 AGGGACAAGGCCAATGAGGCTGG + Intergenic
911419815 1:97626694-97626716 AATGGTCAGGCTAATGCGGAAGG - Intronic
913591308 1:120329322-120329344 AAGGATATGGCCCAAGAGGAAGG + Intergenic
913652056 1:120925777-120925799 AAGGATATGGCCCAAGAGGAAGG - Intergenic
914169051 1:145203293-145203315 AAGGATATGGCCCAAGAGGAAGG + Intergenic
914524171 1:148447248-148447270 AAGGATATGGCCCAAGAGGAAGG + Intergenic
914599504 1:149188623-149188645 AAGGATATGGCCCAAGAGGAAGG - Intergenic
914642234 1:149619888-149619910 AAGGATATGGCCCAAGAGGAAGG - Intergenic
916067721 1:161150008-161150030 GAGGATAAGGCTTATAAGGCTGG - Intergenic
917046457 1:170866055-170866077 ACAGATAAGGCTAGTGAGAAGGG - Intergenic
917137835 1:171804768-171804790 AAGTATAAGGCTTATGAACAAGG - Intronic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918106873 1:181423106-181423128 AGGGATGAGGCTGATGATGAAGG - Intronic
918174954 1:182035499-182035521 AAGGATAAGGATAAGGATAAGGG + Intergenic
918268831 1:182874919-182874941 AAGGATAAGGATGATGATGGTGG + Exonic
920460571 1:206136454-206136476 AAGGGTGAGGCTAAGGGGGAAGG + Intergenic
920780380 1:208985284-208985306 AAAGGTAATGGTAATGAGGAAGG - Intergenic
921319117 1:213920036-213920058 GAGGATATGGCAAATGGGGAAGG - Intergenic
921495120 1:215830039-215830061 AACAATAAGGCTGATCAGGAGGG + Intronic
921513639 1:216063383-216063405 AAGACTCAGGATAATGAGGAGGG - Intronic
921536308 1:216352871-216352893 GAGGATCAGGATAATGAGAAAGG + Intronic
921650982 1:217677766-217677788 AAGTATAAGGCTAGTGAGAGTGG + Intronic
922766536 1:228159145-228159167 AAGGAGAAGGCTGAGGAGAAGGG - Exonic
923230521 1:231982336-231982358 AAGGAGAAAGGTAAGGAGGAAGG - Intronic
923863215 1:237913432-237913454 AAGGAGGAAGCTGATGAGGAGGG + Intergenic
923867117 1:237951393-237951415 GGGGATGAGGCTAATGATGAAGG + Intergenic
923901473 1:238330414-238330436 ACGGATAGGGCTCAAGAGGAAGG - Intergenic
1062882101 10:987721-987743 GAGGAGAAGGTTGATGAGGATGG - Intergenic
1065141170 10:22719636-22719658 AAGGATGTGGCTGTTGAGGAGGG - Intergenic
1065463694 10:25996210-25996232 AAGGATAAGAATTATGGGGAGGG - Intronic
1065643797 10:27813873-27813895 AAAGGTAAGGATAGTGAGGAAGG + Intronic
1066285521 10:33962430-33962452 AATGATTAAGCTAGTGAGGAAGG - Intergenic
1067131590 10:43570194-43570216 AAGGATGAGGGTAAAGATGAAGG + Intronic
1067702884 10:48586436-48586458 AAGGATTAGGATAATGGAGATGG + Intronic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1069555832 10:69397604-69397626 AAAGATAAGGCAACTGAGGCTGG - Intronic
1070020072 10:72576255-72576277 AATGATTAAGCTTATGAGGAAGG + Intronic
1071054038 10:81487947-81487969 AATGATAAAGCTTGTGAGGAAGG + Intergenic
1071397643 10:85239011-85239033 AAGGAAAAGGTTAATGAGTGCGG - Intergenic
1071710706 10:88046316-88046338 AAGGCTGAGGGTATTGAGGAAGG - Intergenic
1072245942 10:93543981-93544003 AAGGATGAGGCTGTAGAGGAAGG + Intergenic
1072566170 10:96618434-96618456 AAGGTTAAGGGAAATGAGAAGGG - Intronic
1072870089 10:99109532-99109554 AATGATAATGCTAACCAGGAAGG + Intronic
1074964996 10:118483006-118483028 AAGGATTTGGCTCATGAGGAAGG + Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076219424 10:128721312-128721334 AAGGTCAAGTCTAATGAGGTGGG - Intergenic
1077017806 11:404653-404675 GAGGAGAAGGCTAATGACGGAGG + Exonic
1077302765 11:1854863-1854885 AAGGATGAGGCCAAGGAGGAAGG - Intronic
1077535423 11:3121836-3121858 AAGGAAAGGCCTCATGAGGAAGG + Intronic
1077759265 11:5073436-5073458 AACGATAAGAATAATGAGAAAGG + Intergenic
1079271288 11:18988310-18988332 AAAAAGAAGGGTAATGAGGATGG + Intergenic
1079915999 11:26369408-26369430 AAGGATGAGGAGAATGAGTAGGG - Intronic
1079961893 11:26934514-26934536 AATGAGAAAGCTAATGAAGATGG - Intergenic
1080603219 11:33841337-33841359 AAGGAAAAGGGAAAGGAGGAGGG - Intergenic
1082294271 11:50418959-50418981 AAGGATAAGGATGATGATGGTGG + Intergenic
1083135211 11:60667370-60667392 AATGATTAAGCTTATGAGGAAGG + Intergenic
1083971509 11:66079411-66079433 CAGGAAAAGGTTAGTGAGGAGGG - Intronic
1085250042 11:75137138-75137160 AAAGATGAGGCTAAAGAGGTTGG + Intronic
1086734239 11:90285933-90285955 AATGATTAAGCTTATGAGGAAGG - Intergenic
1087365399 11:97212403-97212425 AAGGATCAGGATAATGATGTGGG - Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1088034989 11:105300484-105300506 AAGAATAAGGCTTTTGAGGAAGG + Intergenic
1089135038 11:116242212-116242234 AGAGACAAGGCTACTGAGGATGG + Intergenic
1089476934 11:118771611-118771633 AGGGAGAAGGCAAAGGAGGAAGG + Intronic
1089682849 11:120129096-120129118 AAGGAGAAGGCTGGAGAGGAAGG + Intronic
1090991672 11:131822749-131822771 TAGGATAGGGCAAATGAGAAAGG + Intronic
1091076268 11:132620511-132620533 AAGGCTAAGGGGAATCAGGAAGG + Intronic
1093379869 12:18479362-18479384 CAGCATAAGGCTAAAGAGCAAGG + Intronic
1096231594 12:49899939-49899961 GAGGATATGGGAAATGAGGAAGG + Intronic
1096772323 12:53943828-53943850 TAGGTGAAAGCTAATGAGGAGGG - Intronic
1098275236 12:68805976-68805998 AAGCACAAGGCCAATGAGAAGGG + Intergenic
1100445553 12:94656603-94656625 TAGGATAAGGCTTCTGAGGCTGG - Intergenic
1101543420 12:105685513-105685535 AAGGAAATGGCAAATCAGGAAGG - Intergenic
1104573298 12:129944334-129944356 ATGGAAAAGGCTAATCGGGAGGG - Intergenic
1104606124 12:130189696-130189718 AAAGAGAAGAGTAATGAGGAGGG - Intergenic
1104714397 12:131006692-131006714 GAGGATGAGGGAAATGAGGAGGG + Intronic
1106553097 13:30788301-30788323 AAGGACAAGGATGATGAGTAGGG + Intergenic
1106605579 13:31225615-31225637 GAGGACAAGGCTAAAGGGGAGGG - Intronic
1106689050 13:32094326-32094348 AAGGATAATGCTTCAGAGGATGG - Intronic
1106775881 13:33009122-33009144 AAGGTTAAGGAAAATGAGAATGG - Intergenic
1106849404 13:33773658-33773680 AAGCATGAGGCTACTGAGGAAGG - Intergenic
1107544561 13:41423862-41423884 AAGGAAAACGGTAAAGAGGATGG - Intergenic
1107906840 13:45069182-45069204 AAGGAGAAGGCTTTGGAGGACGG - Intergenic
1109220461 13:59636190-59636212 AAGGAAAAGGGTACTGAAGATGG + Intergenic
1109317876 13:60772790-60772812 AAGGATATGTCTAATCAAGAAGG - Intergenic
1111497764 13:89075795-89075817 AAGCAAAAGGCAAAAGAGGAAGG + Intergenic
1114220639 14:20693388-20693410 AAGTGTGAGGTTAATGAGGAAGG + Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1116323622 14:43501601-43501623 AAGGATAAGGTTAATGAAATTGG - Intergenic
1116761692 14:49022758-49022780 AAGGACAAGGCAACTGAGGAAGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117484616 14:56181716-56181738 CAGGCTAAGTCAAATGAGGATGG + Intronic
1118837237 14:69485602-69485624 AAGGCTCAGGCTAAGGAGGGAGG + Intronic
1120412357 14:84173841-84173863 AGGGATGAGGCTAATGATGAAGG - Intergenic
1121476400 14:94210749-94210771 AAGAATAAGGCAAATGAGAAGGG + Intronic
1123111534 14:105870170-105870192 AAGGATAATGCTTAAGAGGATGG - Intergenic
1124891100 15:33733793-33733815 AGGGATAATGATAATGGGGAAGG + Intronic
1126079581 15:44946384-44946406 CAGCAGAAGGCTAAGGAGGAAGG + Intergenic
1126245929 15:46505695-46505717 AAGGAAAAACCTAATGTGGATGG - Intergenic
1126813546 15:52432733-52432755 AAGAATTAGGCCAATTAGGAGGG - Intronic
1127662673 15:61114910-61114932 AAGCATAACTCTAATGATGAGGG - Intronic
1128733294 15:70035075-70035097 AAGGATGAGGGGGATGAGGAAGG - Intergenic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1133136850 16:3717967-3717989 AAAGCTAAAGCGAATGAGGAAGG + Intergenic
1133595131 16:7283616-7283638 AAGGATACAGCTTCTGAGGACGG - Intronic
1133992680 16:10721345-10721367 AGGGATGAGGCTAACGATGAAGG + Intergenic
1135660433 16:24291924-24291946 AAGGAAAGGGTTAAGGAGGATGG + Intronic
1135671501 16:24379561-24379583 AAGGATAAAGATACTGAGGCTGG - Intergenic
1136157193 16:28391061-28391083 AGGGATATGGGTGATGAGGAGGG - Intronic
1136205893 16:28724220-28724242 AGGGATATGGGTGATGAGGAGGG + Intronic
1137897929 16:52234210-52234232 AAAGATAAGGCTAATGACCACGG - Intergenic
1141646994 16:85372865-85372887 GATGAGAAGGCTAAGGAGGAGGG + Intergenic
1144401933 17:14913012-14913034 AAAGAGAAGGCTAGTGAGGGAGG + Intergenic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1146520870 17:33524593-33524615 ATGCATATGGCTAACGAGGATGG + Intronic
1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG + Intronic
1147424458 17:40339376-40339398 AGGGATAAGGCTGAGCAGGATGG + Intronic
1147881567 17:43657561-43657583 AAGGAGATGGCAAAGGAGGAAGG + Intronic
1148678128 17:49456928-49456950 AAGGAGAAGGATGAAGAGGAAGG - Intronic
1149369076 17:55975217-55975239 AAGGAAAAGTGTAGTGAGGAAGG + Intergenic
1149951946 17:60997471-60997493 AAGGAAATGGGTAGTGAGGATGG + Intronic
1150478229 17:65489874-65489896 AATCATCAGGCTAATGAGGCTGG + Intergenic
1151470003 17:74312066-74312088 AAGGAGAAGGGTAAGGCGGAGGG + Exonic
1154132258 18:11747604-11747626 AAGGATAGGGGTACTGGGGATGG + Intronic
1155799011 18:30076420-30076442 AACTATAAGGCTAAAGAGAAAGG - Intergenic
1155870273 18:31018963-31018985 AAGGATAAAGCTGAAGAGGCAGG + Intronic
1156003023 18:32406841-32406863 AAGTATAAGACTGAAGAGGAAGG + Intronic
1157523973 18:48364572-48364594 AGGAAAAAAGCTAATGAGGAAGG + Intronic
1157880121 18:51313514-51313536 AGGGACAAGGCTAGTGAAGAAGG - Intergenic
1158043642 18:53128689-53128711 AAGGATAAGGCTAGGGAGGAAGG + Intronic
1158146962 18:54325155-54325177 CAGGATAAGGGAAATGAGGGAGG - Intronic
1158193296 18:54855545-54855567 AAGGGTAAGACTACTGAAGAGGG - Intronic
1158816286 18:61100976-61100998 CAGAATAAGGCATATGAGGAAGG + Intergenic
1158929390 18:62308021-62308043 AAAGCTATGGATAATGAGGATGG - Intergenic
1159034742 18:63265922-63265944 AAGGGTGAGGCTAAGAAGGAAGG + Intronic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1159318607 18:66814879-66814901 GAGGGTAAGGAAAATGAGGAAGG + Intergenic
1159331464 18:66999734-66999756 AAGGAAAAGGTTAATGCAGAAGG - Intergenic
1159813240 18:73042302-73042324 AAGGATAAGGCCAAAGAGAATGG - Intergenic
1161415799 19:4145666-4145688 AGGGAAAAGGCCAAGGAGGAGGG + Intergenic
1163494662 19:17639319-17639341 AAGGAAAAGGTTACTGAGAAAGG + Intronic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1168485293 19:56756513-56756535 AATGAGAAGGCTAATGGGAATGG + Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
929391025 2:41468847-41468869 AAGGTTAAGGATAAGGAAGAAGG - Intergenic
930395392 2:50817027-50817049 AAGAAAAAGGGTCATGAGGAAGG + Intronic
930691773 2:54372308-54372330 GAAGATGAGGCTAAGGAGGAAGG - Intronic
934941227 2:98503825-98503847 AAAGATCAGGCTAATAGGGAAGG - Intronic
935489523 2:103699017-103699039 AAGGATAAGAAAAATGGGGAAGG - Intergenic
935758488 2:106297018-106297040 AGGCATCAAGCTAATGAGGATGG - Intergenic
936140052 2:109931777-109931799 AAGAATAAGGCTAAGCAGTATGG + Intergenic
936176741 2:110229722-110229744 AAGAATAAGGCTAAGCAGTATGG + Intergenic
936204644 2:110439709-110439731 AAGAATAAGGCTAAGCAGTATGG - Intronic
936719802 2:115237548-115237570 AAGATTAAGCTTAATGAGGAAGG + Intronic
938237443 2:129717591-129717613 AAGGATAGGGATAATGGGGTGGG + Intergenic
939361598 2:141179630-141179652 AAGGAAAAGGCAAATGTTGAAGG - Intronic
940497278 2:154448078-154448100 GAGGATAAGGCTAATAAGCCAGG - Intronic
940511345 2:154619652-154619674 AAGGCTGAGGCACATGAGGAGGG - Intergenic
940562101 2:155311749-155311771 AGTGATGAGGCTAATGATGAAGG - Intergenic
940730924 2:157390428-157390450 AGGAATACAGCTAATGAGGAAGG - Intergenic
941006505 2:160252525-160252547 AAGGAGAACTCTAAAGAGGAAGG + Intronic
941234845 2:162958756-162958778 AAGGATAAATTTAAAGAGGAAGG - Intergenic
942033323 2:171986070-171986092 AAGTATAAGGGTAAGGAGAAAGG - Intronic
944027242 2:195185544-195185566 AAAAATAAGAGTAATGAGGACGG - Intergenic
944247924 2:197551352-197551374 AAGGTTAAGGGAAATGAGAAGGG - Exonic
946524236 2:220500853-220500875 ATGGTTAAGCCTAGTGAGGAAGG + Intergenic
948031085 2:234818141-234818163 AAGGATAAGGGTGATGACAAAGG + Intergenic
948493407 2:238329028-238329050 AAGGAGAAGGCCAAGGAGAATGG + Exonic
1170145308 20:13167155-13167177 TAGAATAAGGTTAATTAGGAGGG + Exonic
1170564900 20:17593749-17593771 TAAGATAAGGCTAAAGAGGTAGG + Intronic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1172020683 20:31911614-31911636 AGGGATTAGGCTGATGAGCACGG + Intronic
1173052237 20:39574651-39574673 TAGGAGAAGGCTATTGAGAAGGG - Intergenic
1173175869 20:40764339-40764361 AAAGAAAAGCCTAATTAGGAAGG - Intergenic
1174437853 20:50523981-50524003 AAGGTTAAGACCAAAGAGGAAGG - Intronic
1177057602 21:16327229-16327251 AAGGATTTGGATAATGATGATGG - Intergenic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181429371 22:22868849-22868871 AAGAATAAGGATAATGATTAGGG + Intronic
1182960592 22:34470883-34470905 AAGGATAAGAATAAGAAGGAGGG - Intergenic
1183284605 22:36953955-36953977 AGGGATATGGCCGATGAGGAGGG + Intergenic
1184976224 22:48064302-48064324 AAGGCTAAGGCAAGTGTGGATGG + Intergenic
949689825 3:6623102-6623124 AAAGATGAGGCAAATGAAGAAGG + Intergenic
949997647 3:9631137-9631159 AAGGAGTTGGCTAATGAAGATGG + Intergenic
950110935 3:10418316-10418338 AAAGAAAAGGCTATTGAGGTAGG + Intronic
951660091 3:25053796-25053818 AAGGTTAGGGTTTATGAGGAAGG + Intergenic
951796044 3:26539567-26539589 AGGGATAAAGCTAATAAGAAAGG + Intergenic
952377458 3:32779688-32779710 AAGAAAAAGGCTAAGTAGGAAGG - Intergenic
954136957 3:48586307-48586329 AAGGAGTAGGCTGATGGGGAAGG - Intronic
955073532 3:55591761-55591783 AAGGACAAGAATAATGGGGATGG - Intronic
955314648 3:57926333-57926355 AAGGAAGAGGATAAGGAGGAAGG - Intronic
955333975 3:58069960-58069982 AAGTATTAGGAAAATGAGGATGG + Intronic
956392732 3:68790936-68790958 AAGGATAAGGCAAACGTGGATGG + Intronic
957144727 3:76409439-76409461 AAGGAAAAGGCTGATTATGAGGG - Intronic
957615394 3:82519705-82519727 AAAGAATAGGCTAATTAGGATGG + Intergenic
958457441 3:94349185-94349207 AATGATCAGGTTAAAGAGGATGG - Intergenic
958484534 3:94687187-94687209 AAGAATAAGGCTAGGGAGGGAGG - Intergenic
959291788 3:104484630-104484652 AAGAATAAGACTAATGGGGGTGG + Intergenic
959483251 3:106898887-106898909 AAGGATGAGGCTAATGATAAAGG - Intergenic
959943473 3:112103845-112103867 AGAGATAAGGCTAAAAAGGAAGG + Intronic
960794066 3:121465935-121465957 AACGATTAAGCTTATGAGGAAGG + Intronic
960884111 3:122376810-122376832 AAGGGCAAGGGTAAGGAGGAAGG + Intronic
961703085 3:128762259-128762281 ATGAAAAAGGCTAAGGAGGAGGG + Intronic
962801655 3:138895807-138895829 AAGTATAAGGCTAACCAAGAGGG - Intergenic
962815698 3:138996147-138996169 AAGAATAAAGCTGAAGAGGAAGG - Intergenic
963392653 3:144687490-144687512 AATAATAAGGATAATGATGATGG - Intergenic
963510725 3:146244815-146244837 AAGATTAAGCTTAATGAGGAAGG + Intronic
965462015 3:168977659-168977681 AAGGGAAAGTCAAATGAGGAAGG + Intergenic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966354412 3:179064416-179064438 AAGGATAAGACCAATGAGTAAGG - Intronic
967097656 3:186190493-186190515 AAGGATAAGGATAATGATAATGG - Intronic
967105912 3:186254910-186254932 AAGGATGAGGCTAGGGAGAAAGG - Intronic
967595877 3:191326629-191326651 AAGCATAAGGCTTCTCAGGATGG - Intronic
968978217 4:3832963-3832985 AAGGAAATGGCTCAGGAGGAGGG + Intergenic
970260132 4:14215864-14215886 GATGATAAGGAAAATGAGGAAGG + Intergenic
970478163 4:16445729-16445751 AAGGATAGGCCATATGAGGATGG - Intergenic
970492394 4:16587612-16587634 AAGCATAAGGCTAATGGGAAGGG + Intronic
971047056 4:22816544-22816566 AAGGATAATGCTTAAGGGGATGG + Intergenic
971172084 4:24243730-24243752 AAGGGCCAGGCTAAGGAGGAAGG - Intergenic
971229943 4:24793531-24793553 GAGGATAAGGCCAATGCAGAAGG - Intronic
971916141 4:32872208-32872230 AAAGATAAGACTCAGGAGGAGGG - Intergenic
974596820 4:64024319-64024341 GAGGAGGAGGCTAGTGAGGAGGG + Intergenic
976315482 4:83654818-83654840 GAGGATTAGGCTCATGAGGCTGG - Intergenic
977367736 4:96093093-96093115 AAGGATAATGATGATGAGGCTGG - Intergenic
977895493 4:102360522-102360544 GAGGAAAGGGCTAAAGAGGAAGG - Intronic
978018702 4:103781806-103781828 AAGGTTAAGTCTAATGAGAAAGG - Intergenic
980439415 4:132820136-132820158 AAGGATTTGGTTAATAAGGAAGG + Intergenic
980707017 4:136511464-136511486 AAGGATTAAGCTAGTGAGGAAGG - Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
983159396 4:164392858-164392880 AAGGAAAATGCCAAAGAGGATGG - Intergenic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
987442158 5:17968967-17968989 GAGAAGAAGACTAATGAGGAGGG - Intergenic
989808190 5:45638385-45638407 AAGGATTGGGCTAATTAAGAAGG + Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990723549 5:58726904-58726926 AAGCACAGGGCTAAAGAGGACGG + Intronic
991023501 5:62005876-62005898 AAGGATAGAGCCAATGAAGAGGG + Intergenic
992763086 5:79969013-79969035 AAGGCTAAGCCCAATGAGGTAGG - Intergenic
992918027 5:81479628-81479650 AAAAATAACACTAATGAGGAGGG + Intronic
993292069 5:86086265-86086287 AAGGATAAGCATAAAGAAGAAGG + Intergenic
994730014 5:103480981-103481003 AAAGATTAGGCTAAAGAGGTAGG - Intergenic
995855353 5:116585922-116585944 GATGATAAGGTTAATAAGGATGG - Intergenic
996344169 5:122471798-122471820 AAGGATGAGGGTGAGGAGGAGGG - Intergenic
996397817 5:123031357-123031379 AACGGTGAGGCTAAGGAGGAAGG + Intronic
996956256 5:129186799-129186821 AAGATTAATGCTAATGAGGGAGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
998394727 5:141811468-141811490 AATGAAAAGGGGAATGAGGAAGG - Intergenic
999644139 5:153701274-153701296 AAGGAGGAGGCTACTGAGGCAGG - Intronic
1000748446 5:165065347-165065369 TAGCATAAGGCTCATGAAGAAGG + Intergenic
1001115809 5:168938594-168938616 AAGGATAAGGCAGAAGGGGAAGG - Intronic
1004294458 6:14397563-14397585 GAGGAGAAGGCAATTGAGGAAGG - Intergenic
1004922801 6:20392727-20392749 ATGATTAAGCCTAATGAGGAAGG - Intergenic
1005068557 6:21842927-21842949 AAGGCTCAGGGTTATGAGGATGG + Intergenic
1005377582 6:25199726-25199748 AAGGAGAAGGCACATGAGCAAGG - Intergenic
1009984194 6:70763566-70763588 AAGGATTAAGCTAGTGAGGAAGG + Intronic
1010047982 6:71469801-71469823 GAAGAGAAGGCAAATGAGGAGGG - Intergenic
1011761782 6:90575299-90575321 AAGGTAAGGGCTAATGATGAAGG + Intronic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1013348579 6:109286149-109286171 AAGGATAGGGGTCATTAGGAAGG + Intergenic
1013594527 6:111648670-111648692 AAGGATAAGACTGAAGGGGAAGG + Intergenic
1014305065 6:119729994-119730016 AAAAGGAAGGCTAATGAGGAAGG - Intergenic
1014323405 6:119961109-119961131 AAGCATAAGGATGATGATGATGG - Intergenic
1014366471 6:120549177-120549199 AAAGTTAAGGCAAATGAGCAGGG - Intergenic
1014814593 6:125921464-125921486 AAGGATGAGGCTTGTGAGGAAGG + Intronic
1015317048 6:131828618-131828640 ATGGATGAGGCTAATGAGTGTGG + Intronic
1015333395 6:132007047-132007069 AAGGAGTGGACTAATGAGGACGG - Intergenic
1017146890 6:151242348-151242370 AAGGATAAGGTTATGGAAGACGG - Intronic
1017417173 6:154233626-154233648 ATTGATTACGCTAATGAGGATGG + Intronic
1019782595 7:2952621-2952643 AAGGCCAAGGCTCATGAGGTTGG - Intronic
1020983631 7:15104477-15104499 AAGAATTAGGCAATTGAGGAGGG - Intergenic
1021364595 7:19761048-19761070 AGGGATTAGGCTTATGAAGATGG - Intronic
1022290835 7:29000987-29001009 AAGGAGAAGGCTAATTTGGAAGG + Intronic
1022319630 7:29276669-29276691 AATTATAATGCTAATGATGACGG - Intronic
1024840853 7:53585655-53585677 AAATATAAGGCTAATGGAGAAGG - Intergenic
1030719133 7:112848625-112848647 AAGGAGAAGACTATTGAGGTGGG + Intronic
1032632270 7:133666527-133666549 AAGGGTTATGCTAATGGGGATGG + Intronic
1033591362 7:142811450-142811472 GAGGAAAAGGCTGATGTGGATGG - Intergenic
1033889229 7:145988327-145988349 AAGGATATGGATAATGGGGGAGG - Intergenic
1034240332 7:149605876-149605898 CAGGGAAAGGCTAAGGAGGAAGG - Intergenic
1040869290 8:52083688-52083710 AAGGAGCTGGCTAATGAGGGAGG + Intergenic
1042331494 8:67585251-67585273 AGGGATGAGGCTAATGATGAAGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043430212 8:80187176-80187198 AAGGATAAGGCAGAAGAGGGAGG - Intronic
1044259600 8:90102172-90102194 ATGGGTAAGCCTAGTGAGGAAGG - Intergenic
1047330041 8:123878613-123878635 CAGGATAAGGCTCATGGGTAAGG - Intronic
1047370778 8:124254078-124254100 AGGGATAAGGCTGAAGAGGTAGG + Intergenic
1050086819 9:1974575-1974597 TGGGATAAGTCTAATGAGAAAGG + Intergenic
1051414621 9:16826020-16826042 AATGTTAAGGCTGATGACGAGGG + Intronic
1051466389 9:17382859-17382881 AAAGATAAGGCTAATGAGGTAGG - Intronic
1051564506 9:18482067-18482089 AGGTATAATTCTAATGAGGATGG - Intronic
1052515964 9:29480156-29480178 AAGGAAAAGGAAAATAAGGAGGG - Intergenic
1053024285 9:34717516-34717538 AAGGATGAGGCTGCTGAAGAGGG + Intergenic
1053031927 9:34787747-34787769 AAGGATAAGGCACATGACTAAGG - Intergenic
1055928685 9:81537580-81537602 AAGGATAAAGCTAATAATGGTGG - Intergenic
1056104280 9:83331648-83331670 AAGGATATTGATAATGAGGGAGG + Intronic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1058087661 9:100766436-100766458 AAGAATACAGCTAATCAGGAAGG - Intergenic
1058116680 9:101092525-101092547 TAGGATAAGGCTCAAGAGGTAGG - Intronic
1058275561 9:103037553-103037575 AAAGTCAAGGCTACTGAGGAAGG + Intergenic
1058379981 9:104367072-104367094 AGGGATAAGGAAAAAGAGGAGGG - Intergenic
1059130537 9:111743603-111743625 AAGCACAAGAGTAATGAGGATGG + Intronic
1059148089 9:111920309-111920331 AAGACTAAGGTTAATGAAGAAGG - Intronic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1187386719 X:18855634-18855656 AAGAATAAAGGTAATGGGGATGG - Intergenic
1187864928 X:23715334-23715356 AAGAATGAGGCTGCTGAGGAAGG - Intronic
1188158331 X:26769591-26769613 AGAAATAAGGCAAATGAGGAAGG + Intergenic
1188640322 X:32493292-32493314 AAGCATAATGCTACTCAGGATGG + Intronic
1188822346 X:34790620-34790642 AATGATAGGGATCATGAGGATGG + Intergenic
1191219645 X:57974529-57974551 AAGGTTTTGGCTAATGAAGACGG + Intergenic
1191740516 X:64432503-64432525 AGGGATGAGGCTGATGGGGAAGG - Intergenic
1192019295 X:67368000-67368022 AAGAATAAAGCTAATAAGGAAGG + Intergenic
1192340735 X:70261346-70261368 AAGGAAAAGGGTAATAAAGAGGG + Intergenic
1194344518 X:92746915-92746937 AAGAATATAGCTAATGAGGGAGG - Intergenic
1195082332 X:101383461-101383483 AGAGATAAGGATAATGAGAAAGG - Intronic
1197071308 X:122301092-122301114 AAGGATATGGATAATGTGGGAGG - Intergenic
1197867867 X:131037652-131037674 AAGGAAAAGGGGAATGAGAAAGG - Intergenic
1200375820 X:155778942-155778964 AAGGAAAGGGTTAATGAGGGAGG + Exonic
1200652862 Y:5863555-5863577 AAGAATATAGCTAATGAGGGAGG - Intergenic