ID: 1147376770

View in Genome Browser
Species Human (GRCh38)
Location 17:40027205-40027227
Sequence CAATGTGAACATAGGGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147376764_1147376770 8 Left 1147376764 17:40027174-40027196 CCAGACGGGGGCAATGCTGCCAC 0: 1
1: 0
2: 0
3: 11
4: 78
Right 1147376770 17:40027205-40027227 CAATGTGAACATAGGGCTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147376770 Original CRISPR CAATGTGAACATAGGGCTGA AGG Intronic
901541510 1:9920534-9920556 CAATGAGAAAATTGGGCTCATGG - Intergenic
905244222 1:36601694-36601716 GATTGAGAACATAGGGATGAGGG + Intergenic
906553283 1:46684838-46684860 CACTGTGAACATTTGGTTGATGG + Intronic
906874197 1:49518291-49518313 CCATGGGAAGATTGGGCTGAGGG - Intronic
908565434 1:65351017-65351039 CAGTGTGGACATAGGGATTAGGG - Intronic
912564539 1:110577122-110577144 CACTTTGAACAGAGGTCTGAAGG - Intergenic
914322655 1:146580221-146580243 AAATGTGAACATAGCTCTGGTGG + Intergenic
917440516 1:175064698-175064720 CAATGTGCACATACAGCTGCCGG - Intergenic
917861329 1:179147622-179147644 CAATGAGAACATAGGGTTTTTGG - Intronic
918122900 1:181555581-181555603 CAATGAGAAAATGGGGCTGCAGG - Intronic
920491482 1:206419075-206419097 CAATGGGAACATAGAGATGGAGG - Intronic
920588670 1:207195207-207195229 CAATGTGAAAATGGCGCTGGAGG + Intergenic
921029300 1:211323655-211323677 CAATGTAAAGATGGTGCTGATGG - Intergenic
921293042 1:213676594-213676616 CAATGTGAACAGCTGACTGAGGG - Intergenic
921768238 1:218999885-218999907 CATTGTGAAGATAGGACAGAGGG + Intergenic
921812923 1:219534952-219534974 AAATGTGAACATATGGCTCAAGG - Intergenic
922310810 1:224388438-224388460 CAATGTGAACATCAGGCTTTTGG + Exonic
923758802 1:236820092-236820114 CAATGTCCACATAGCGCAGAGGG - Intronic
1062979347 10:1708886-1708908 GTATGTGAGCAGAGGGCTGAGGG + Intronic
1065500318 10:26374969-26374991 CAATGTGAACATGGCTATGAAGG + Intergenic
1066247223 10:33595276-33595298 CAATGTGGACATAGAGTGGAAGG + Intergenic
1068700673 10:60016308-60016330 AACTGTAAACATAGGGCTTATGG + Intergenic
1069138807 10:64798741-64798763 CATTGTTAATATAGGGCTCATGG - Intergenic
1076192674 10:128493897-128493919 CAGTGTGAGCACAGGCCTGAAGG + Intergenic
1078838559 11:15055938-15055960 CAATGTGAGTATATGGGTGAGGG + Intronic
1079341333 11:19613997-19614019 CAACCTGATAATAGGGCTGAAGG + Intronic
1081039237 11:38190379-38190401 CTGTGTGAACTTAGGACTGAGGG + Intergenic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1086618506 11:88854680-88854702 CAATGTTCACATCTGGCTGATGG + Intronic
1088450231 11:109973661-109973683 CAATGGGAACAGATGGCTCAGGG + Intergenic
1089305465 11:117523722-117523744 CATTGTGAGCATAGGGCAGTAGG - Intronic
1089881862 11:121781616-121781638 CAATGAGAACATATGGGTGCAGG - Intergenic
1090037163 11:123259158-123259180 AAATGTGGAAATAGGGCTGTGGG - Intergenic
1096678823 12:53241633-53241655 CAGTGTGAACAAAGGACTGGAGG + Intergenic
1096954882 12:55516221-55516243 CAATGTTCACTTAAGGCTGAAGG - Intergenic
1098540900 12:71656106-71656128 CCAGGTGAACTAAGGGCTGAGGG + Intronic
1099048687 12:77756438-77756460 TATTGTGAACATAGGAATGAAGG + Intergenic
1101123136 12:101604161-101604183 CATTGTTAACATGGGGCTGGGGG - Intronic
1105816175 13:24038351-24038373 CAATGTAAACATAGAACAGAGGG - Intronic
1107093456 13:36509540-36509562 CCATTTGAACAGAGGACTGAAGG + Intergenic
1107665400 13:42683920-42683942 CAGTGTGATCATGGAGCTGAAGG + Intergenic
1108302525 13:49092610-49092632 CAATGTGAACAAAGGTATGAAGG - Intronic
1108677990 13:52754384-52754406 CAAAGTGAAAGTAGGGATGAGGG - Intergenic
1110629815 13:77696014-77696036 CAATGAGAACAAAGAGCTGCTGG - Intergenic
1110744180 13:79033289-79033311 CAATGTGAACAAAGTGCTTGCGG - Intergenic
1110843196 13:80166086-80166108 CAAAGTGAGCAGATGGCTGAAGG - Intergenic
1113259791 13:108549007-108549029 CAATCTGAACACAGTGCTGTGGG - Intergenic
1115291727 14:31779624-31779646 GATTGTGAAAAGAGGGCTGAGGG + Intronic
1116243178 14:42373469-42373491 TAATGTGAACTGAAGGCTGATGG - Intergenic
1116464061 14:45212071-45212093 CAATGTGAGCAAAGCCCTGAGGG - Intronic
1119171692 14:72540679-72540701 CACTGTGCACATGAGGCTGATGG - Intronic
1119914090 14:78380522-78380544 CAATGTGAAGACAGAGCAGAGGG + Intronic
1120633329 14:86919251-86919273 CAATGTGAATATAGCTCTGATGG - Intronic
1120701400 14:87703261-87703283 CACTGTGGACAGAGGACTGAAGG - Intergenic
1122687719 14:103518013-103518035 CGAGGTGAACACAGGGCTGAGGG - Intergenic
1122983680 14:105202687-105202709 CAAGGTGAACAGACGGCTGGAGG - Intergenic
1126653452 15:50950814-50950836 CAATGAGAACATAGGACACACGG - Intronic
1126987181 15:54325604-54325626 CAATGAGAACATATGGATGCAGG - Intronic
1130065092 15:80596386-80596408 CAATAAGAAAATAGGGGTGATGG + Exonic
1131034224 15:89210654-89210676 CAATGAGACAAGAGGGCTGAGGG - Intronic
1131789075 15:95944901-95944923 AAATGTCAAAATAGGGGTGAGGG + Intergenic
1137254512 16:46763979-46764001 CAAGGTGAAAATAGTGCTTAAGG + Intronic
1138113511 16:54342564-54342586 GAATGTGACCAGATGGCTGAGGG - Intergenic
1140010969 16:71130954-71130976 AAATGTGAACATAGCTCTGGTGG - Intronic
1140125551 16:72115099-72115121 CACTGTGAACAAAGGTTTGAAGG - Intronic
1144226980 17:13158721-13158743 AAATGTGAAAATGAGGCTGAAGG - Intergenic
1144916885 17:18731111-18731133 TAGTGTTTACATAGGGCTGAAGG + Exonic
1147376770 17:40027205-40027227 CAATGTGAACATAGGGCTGAAGG + Intronic
1151700950 17:75742353-75742375 CATTGTGGACACAGTGCTGATGG + Exonic
1151833202 17:76567977-76567999 CGATGTGAACTCAGGCCTGAGGG - Intronic
1155142788 18:23058151-23058173 AAATGTGTACATATGGATGAAGG + Intergenic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
925285768 2:2714796-2714818 CAATCTGAACATTAGCCTGAAGG + Intergenic
927279154 2:21288478-21288500 CAGAGTGAACAAAGGGCTGTAGG + Intergenic
927889852 2:26741503-26741525 GAGTGTGAGCACAGGGCTGATGG + Intergenic
928128409 2:28631640-28631662 CAATTAGAACATGGGGCTGCAGG - Intronic
929792530 2:45034210-45034232 CAAGGTGAAGAGAGGGCTGCAGG + Intergenic
930744962 2:54872867-54872889 CAATGACAACAAAGGGCTAAGGG - Intronic
933120398 2:78529190-78529212 CAATGGGAACCTAGGACTGCTGG + Intergenic
933199514 2:79433136-79433158 CTATGAGAACATCAGGCTGAGGG - Intronic
935462783 2:103358240-103358262 CAATGTCAACAAAGATCTGAAGG - Intergenic
938938701 2:136149700-136149722 CAGTGTGAACAACTGGCTGAGGG + Intergenic
940326423 2:152430384-152430406 CAAAATGAACATTGTGCTGAAGG + Intronic
940382375 2:153030590-153030612 CAATGTGAAAATATCACTGAGGG - Intergenic
940892366 2:159047331-159047353 CAATTTTAAAATGGGGCTGAGGG - Intronic
942541604 2:177020936-177020958 CAGTGTGAGCATGGGGGTGAGGG - Intergenic
942712611 2:178853714-178853736 CAATGTGAACATTAAGTTGAGGG - Intronic
943574743 2:189617792-189617814 CTAATTGAACATAGAGCTGATGG - Intergenic
944279646 2:197880986-197881008 CAATGTGAATTTAGAGCTGTAGG + Intronic
945561064 2:211341063-211341085 CAATGTGAGCCTATGGCTGGGGG + Intergenic
946394471 2:219436195-219436217 CAGTGTGAAGAAAAGGCTGAGGG + Intronic
946965362 2:225031441-225031463 CAATGTGGGCACAGGGCCGAAGG + Intronic
947372761 2:229465415-229465437 CAATGGGACCAGGGGGCTGAGGG + Intronic
1169303947 20:4471890-4471912 CAAGGTGAACATATGACTGGAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1174457784 20:50661902-50661924 GGATTTGAACATGGGGCTGATGG + Intronic
1175629310 20:60519913-60519935 CAGTGTCTACATAGGGCTGATGG - Intergenic
1178927572 21:36788373-36788395 CCATCGGAACTTAGGGCTGACGG + Intronic
1183888793 22:40907912-40907934 CAATGTGAAGAAGAGGCTGAGGG + Intronic
1184247034 22:43240977-43240999 CAATGAAAACTCAGGGCTGAGGG + Intronic
951161033 3:19422754-19422776 CTTTGTGAACATAGGGATTATGG - Intronic
951707640 3:25559151-25559173 CAATGTGCGCAAAGGCCTGAGGG - Intronic
952039762 3:29248073-29248095 GAATATCAGCATAGGGCTGATGG + Intergenic
954516723 3:51184778-51184800 CAATGTGGAAAGGGGGCTGAGGG + Intronic
955923287 3:63980846-63980868 TGATGTGAACCTAAGGCTGAAGG - Intronic
956163930 3:66382282-66382304 CAATGTGCCCATTGGCCTGAGGG + Exonic
956665821 3:71641218-71641240 CAATGTGAACAATGTGCAGAGGG - Intergenic
961870901 3:129987446-129987468 CAATGTGAACCCAGGCCTGCAGG + Intergenic
962134229 3:132716876-132716898 CAATGTGAATATTGGACTGGCGG - Exonic
964808532 3:160638011-160638033 CAAAGAGAAAATAGGGCGGAAGG + Intergenic
965504809 3:169502822-169502844 CAATCTGAAAATATTGCTGATGG - Intronic
967247379 3:187501642-187501664 AAATGTCAAAATAGAGCTGATGG + Intergenic
969462554 4:7336413-7336435 CAATGCGAACAGATGGATGAAGG + Intronic
970160912 4:13188286-13188308 CAATGTGAAAATACAGCAGAGGG + Intergenic
970568388 4:17354597-17354619 CAATAGGAACATTGGGATGAAGG - Intergenic
971372041 4:26027684-26027706 TGATGTGAACATTGGGCTGAAGG + Intergenic
975345605 4:73289516-73289538 CAATGAGAACATATGGATGTAGG - Intergenic
975704392 4:77097652-77097674 CCATGTGAACATATGGCAAAAGG + Intergenic
978710795 4:111778457-111778479 CCATGTGAACATATTGGTGATGG + Intergenic
978777500 4:112517450-112517472 CAATGAGAAAAAAGAGCTGAAGG + Intergenic
978851016 4:113336629-113336651 CAAAGTGACTATAGGGCTGAAGG - Exonic
979322170 4:119337282-119337304 TAATGTGAACCTTTGGCTGATGG + Intergenic
983429709 4:167633079-167633101 CAATGAGAACACAGGGATGCAGG + Intergenic
983500399 4:168493297-168493319 CAATGTGGCTATAGGACTGATGG + Intronic
986110887 5:4715722-4715744 CAATGAGAACATATGGGTGCAGG + Intergenic
987101193 5:14592601-14592623 CAGTGTGGACATATTGCTGAGGG + Intronic
987938012 5:24494515-24494537 AAATGTAAAAATAGGGCTAATGG + Intronic
989096813 5:37789457-37789479 AAATGTGGCCATAGGGCTCATGG - Intergenic
993080986 5:83300773-83300795 CAATGAGAACATATGGCACAAGG - Intronic
993806183 5:92412815-92412837 CAAAGAGAACATTGGGTTGAAGG - Intergenic
995857562 5:116609372-116609394 CAATGTGAACTTATAGCGGAGGG + Intergenic
997127500 5:131242902-131242924 CATTGTGAACAAAGGGCACAGGG + Intergenic
1000025543 5:157355839-157355861 CCATGGGAACATAGTGCTCATGG - Intronic
1000129034 5:158276943-158276965 CAGTGTGAACCAAGGCCTGAAGG + Intergenic
1001681470 5:173560668-173560690 AATAGTGAACATAGGGCAGAAGG - Intergenic
1004286225 6:14323079-14323101 CAATGTGAACACAGAGCAGTGGG + Intergenic
1005625273 6:27656583-27656605 CAATGGGTACCAAGGGCTGAAGG + Intergenic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1008344691 6:50412159-50412181 CAATGTGAATAGAAGCCTGAAGG + Intergenic
1011807005 6:91083316-91083338 CAATGAGAAAATAGTGATGAAGG - Intergenic
1015523169 6:134151569-134151591 CAATGTACAGATAGGGCTGTGGG + Intergenic
1024282182 7:47728254-47728276 CAATTTCATCAAAGGGCTGATGG + Intronic
1026235677 7:68524945-68524967 CAATGAGAACATATGGATGCAGG - Intergenic
1026377866 7:69770392-69770414 TCATGTGAACTCAGGGCTGAGGG - Intronic
1028008531 7:85610834-85610856 CAATGTGAACACATGGATTAAGG + Intergenic
1029129320 7:98318109-98318131 CAATGTGAACTGAGGGGTGAGGG - Intronic
1030973478 7:116090914-116090936 CAATGAGAACATAGGGCACAGGG + Intronic
1032471457 7:132182078-132182100 CAATGTGAGTGTAGGGCTGATGG - Exonic
1033083480 7:138320659-138320681 CAATGAGAACATATGGATGCAGG + Intergenic
1036708314 8:11061027-11061049 CAACGTCTACCTAGGGCTGAGGG + Intronic
1037501918 8:19494848-19494870 TACTGTGAACATAGGGTGGAGGG - Intronic
1038219151 8:25591313-25591335 CAATGTAATCATAGCCCTGAAGG - Intergenic
1038737701 8:30187132-30187154 TAATGAGAACATAGGGCTAGAGG - Intergenic
1038938017 8:32274040-32274062 CAATTTGAACACATGGCTGGTGG + Intronic
1043815002 8:84791546-84791568 CATTGTCAACATATGGCTAATGG - Intronic
1049012899 8:139899459-139899481 CAACGTGAAGATAAGGATGAAGG - Intronic
1049044554 8:140139150-140139172 CAATGGGCACAGAAGGCTGAGGG + Intronic
1050369635 9:4907767-4907789 CAACCTGAACATAGTTCTGAAGG + Intergenic
1050450431 9:5774879-5774901 CAATGTGGGCAGAGGTCTGAGGG + Exonic
1052243814 9:26308950-26308972 CAATGTGAGCTCAGGGCTTAGGG - Intergenic
1052455911 9:28698120-28698142 CAATGTGCACATATTCCTGAAGG + Intergenic
1056722694 9:89085319-89085341 AAAAGTGAACAGAAGGCTGAGGG - Intronic
1056898311 9:90572592-90572614 CAATTTGAACATTGGGTGGATGG + Intergenic
1057406843 9:94779740-94779762 CAATATGAATATGGTGCTGACGG + Intronic
1057841698 9:98490675-98490697 AAATATGAATATAGGGCAGAAGG + Intronic
1058359365 9:104125140-104125162 TAAAGTCAACATAGAGCTGAAGG + Intronic
1058566558 9:106291664-106291686 CAATGTGGCCACAGGGTTGATGG + Intergenic
1059894881 9:118851784-118851806 CAATGTGAACACAATGATGAAGG + Intergenic
1062348705 9:136128145-136128167 GAATTTCAAAATAGGGCTGATGG + Intergenic
1187673133 X:21688567-21688589 GAATGTGTACATAGGCCAGATGG - Intergenic
1188177185 X:27005515-27005537 CACAGTAAACATAGGGATGAAGG + Intergenic
1188279757 X:28251064-28251086 CAATGTGAAAGTAGGTCTCAAGG - Intergenic
1191214007 X:57916927-57916949 CAAGGTGAACATCTGGCTGGTGG - Intergenic
1192551950 X:72061584-72061606 CTATGTAAACAAAGGGCTGGAGG - Intergenic
1195342631 X:103919940-103919962 CAATGTGATGATAGTGCTGAGGG + Intronic
1195364160 X:104111637-104111659 CAATGTGATAATAGTGCTGAGGG - Intronic
1196023937 X:111020489-111020511 CAATGTGAATGTAGGCCTGAGGG + Intronic
1200819034 Y:7563274-7563296 CAATTATAACATAGGGCTTATGG + Intergenic