ID: 1147377040

View in Genome Browser
Species Human (GRCh38)
Location 17:40028696-40028718
Sequence GGATGCTCTGCCTAGGCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147377033_1147377040 0 Left 1147377033 17:40028673-40028695 CCTTCCTCCAAGATCTCCAGCCA 0: 1
1: 0
2: 4
3: 34
4: 371
Right 1147377040 17:40028696-40028718 GGATGCTCTGCCTAGGCCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 133
1147377035_1147377040 -4 Left 1147377035 17:40028677-40028699 CCTCCAAGATCTCCAGCCAGGAT 0: 1
1: 0
2: 1
3: 22
4: 194
Right 1147377040 17:40028696-40028718 GGATGCTCTGCCTAGGCCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 133
1147377032_1147377040 1 Left 1147377032 17:40028672-40028694 CCCTTCCTCCAAGATCTCCAGCC 0: 1
1: 0
2: 5
3: 35
4: 456
Right 1147377040 17:40028696-40028718 GGATGCTCTGCCTAGGCCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 133
1147377036_1147377040 -7 Left 1147377036 17:40028680-40028702 CCAAGATCTCCAGCCAGGATGCT 0: 1
1: 0
2: 0
3: 29
4: 269
Right 1147377040 17:40028696-40028718 GGATGCTCTGCCTAGGCCCGTGG 0: 1
1: 0
2: 0
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147377040 Original CRISPR GGATGCTCTGCCTAGGCCCG TGG Intronic
900969399 1:5981085-5981107 AGAAGCTTTGCCTAGGCCCCAGG - Intronic
901035395 1:6333301-6333323 GGATGCCCTGCCCAGCCCAGAGG + Intronic
901045337 1:6392884-6392906 GGATGCTCGGGCGAGGCCCGAGG + Intronic
902988417 1:20169892-20169914 GAATGCTCTGCCCTGGCCCAGGG - Intronic
904286151 1:29454316-29454338 GGATGTTCTGCCCAGGCTCCTGG + Intergenic
904327701 1:29738361-29738383 GAATGCCCTGCCTAGGACTGTGG - Intergenic
904591445 1:31617724-31617746 GGCTGCGCTGCCTCGGCTCGCGG - Exonic
904782993 1:32964552-32964574 GTCTTCTCTGCCTCGGCCCGCGG - Exonic
906033454 1:42737140-42737162 GGATGCTCTGCAAAGGGCCTGGG - Intronic
907407849 1:54264616-54264638 GGATGCTCTGCCAAGACCCAGGG - Intronic
912552751 1:110494714-110494736 GGAGGCTCGGCCAATGCCCGAGG + Intergenic
913389575 1:118295463-118295485 GGAGGCTATGCTTATGCCCGGGG - Intergenic
915898950 1:159832874-159832896 AGATGCAGTGCCCAGGCCCGTGG + Exonic
916384151 1:164248940-164248962 GGATGGTCTGCCTATGCCTGAGG + Intergenic
922507393 1:226134425-226134447 GGATCCTCTGCCTGAGACCGTGG - Intergenic
923184520 1:231558008-231558030 GGGTGCTCTGCCTCCGCCCTAGG - Intronic
923338029 1:232986615-232986637 GCCTGCTCTGCCTGGGCCCAAGG + Intronic
1063363850 10:5478107-5478129 GGAGGCCCTGCCCAGGCCCAGGG - Intergenic
1064787670 10:18917103-18917125 GGATGCTCTGCATAGGGAGGTGG - Intergenic
1067442017 10:46313952-46313974 GGCTTCTCTGCTTAGGCCCTGGG + Intronic
1069870604 10:71530477-71530499 TGTTGCTCTGCCAAGGACCGTGG + Intronic
1070648958 10:78221319-78221341 AGATGCTCAGCCCAGGCCCAAGG - Intergenic
1072609830 10:97010788-97010810 GGGTCCTCTGCCTAGGCCCTGGG + Intronic
1072622621 10:97090098-97090120 TGCTGCTCTGCCTAAGCCCGTGG - Intronic
1075717874 10:124567261-124567283 GTTTGCTCTGCCCAGGCCTGTGG - Intronic
1076743832 10:132502677-132502699 AGCTGCTCTGCCCAGCCCCGGGG + Intergenic
1077798853 11:5518398-5518420 CAATGCTCTGCCTAGCCCTGGGG + Intronic
1078546888 11:12253277-12253299 GGCAGCTCTGCCTGGGCCCTGGG - Intronic
1079393069 11:20039060-20039082 GGATTCTCTGCCTGGCCCTGAGG - Intronic
1083339494 11:61949964-61949986 GGAGCCTCTGACTAGGCCCTGGG - Intronic
1090794048 11:130119049-130119071 GGATCCTCTGCCTTGGGCCTCGG - Intronic
1091147553 11:133292889-133292911 GGATGCTCTGCTTTGGACCGTGG + Intronic
1092206994 12:6620811-6620833 GGCTGCTCTGCCTGGGCGTGTGG - Exonic
1097448069 12:59698775-59698797 GGATGCTCTTTATAGGCCAGAGG + Intronic
1102446119 12:113004111-113004133 GGTTTCTCTGCTTAGGCCAGAGG + Intronic
1104884750 12:132100257-132100279 GGAGGCTCTGACTAGGGCTGTGG + Intronic
1110318287 13:74134566-74134588 GGAAGCGCTGCCGAGGCCCGGGG - Intergenic
1113744725 13:112735972-112735994 GGAGGCTCTGCATAGGCTCTGGG - Intronic
1113882940 13:113637949-113637971 GGCTGCCCTGCCTTGGCCCCTGG - Intronic
1113923734 13:113929022-113929044 GGATGCTCTGCCAAGTCAGGAGG + Intergenic
1114567489 14:23643418-23643440 GGAGGCTATGCCTGGGCCCCTGG - Intronic
1121535903 14:94690528-94690550 GGCTTCTCAGCCTAGGCTCGGGG + Intergenic
1122283913 14:100639729-100639751 GGATGCACTGCCCAGGCTGGTGG + Intergenic
1124001859 15:25766757-25766779 GGATGTTTTGCTGAGGCCCGAGG - Intronic
1127319167 15:57826091-57826113 GGATGCTCTTCCCAGCCCCTTGG + Intergenic
1129759951 15:78123597-78123619 TGATGCTCTGCCTCAGCCCCAGG + Intronic
1135424150 16:22324067-22324089 GGATGCCCTGCCCAGCTCCGAGG - Intronic
1135484479 16:22852023-22852045 TGAAGCTCAGCCTAGGCCAGTGG + Intronic
1137315777 16:47320771-47320793 GTATGCTCTGCCTAGGACATAGG + Intronic
1137825776 16:51493667-51493689 GGATGCTCTGCCATCCCCCGTGG - Intergenic
1141557361 16:84845036-84845058 AGATGCTATTCCTAGGCCAGGGG - Intronic
1142337992 16:89502620-89502642 GAATGCACTGCCCAGGGCCGTGG + Intronic
1142903135 17:3025927-3025949 AGAGGCTCTGCCTGGGGCCGTGG + Intronic
1143025968 17:3942163-3942185 AGAGGCTGTTCCTAGGCCCGGGG - Intronic
1143111817 17:4557056-4557078 AGAGCCTCTGCCTAGGCCCTGGG - Intronic
1144951569 17:18997195-18997217 GGAGGCTCAGCCTAGCCCAGTGG + Intronic
1147377040 17:40028696-40028718 GGATGCTCTGCCTAGGCCCGTGG + Intronic
1147547949 17:41417712-41417734 GGCTGCTCTGCCCTGGCCCCAGG - Intergenic
1149474361 17:56947076-56947098 GGATGCACTGCCCATGCACGTGG + Intronic
1151230891 17:72684313-72684335 GGAGGCTTTGCCCAGGCTCGTGG + Intronic
1151330125 17:73401738-73401760 GGGTGCAGTGCCTGGGCCCGTGG - Exonic
1151456876 17:74231796-74231818 GGATGCTCTGGCCTGGCCAGAGG + Intronic
1157477337 18:48031743-48031765 GGAGGCTTTGCCTAGACCGGTGG - Intronic
1157716645 18:49892370-49892392 GGCTGCCCTGCCTTGGCCTGTGG - Intronic
1160534797 18:79586082-79586104 GGTTGCTGTGCCAAGCCCCGGGG + Intergenic
1160955271 19:1688377-1688399 GGAAGCTCTGCCTGGGATCGGGG + Intergenic
1161231421 19:3176841-3176863 GGATGCTCAGCCTTGCCCTGGGG - Intronic
1163440783 19:17321699-17321721 AGATGGGCCGCCTAGGCCCGAGG - Exonic
925221257 2:2143373-2143395 GGAGGCTGTGCCTGGGGCCGAGG + Intronic
925412559 2:3648341-3648363 GGCTGCTCTGCCCAGGCTGGGGG + Intergenic
925972573 2:9116718-9116740 GGATGCTCTGCCTGGCCCGCGGG + Intergenic
927657098 2:24958408-24958430 GGAAGCTCTGCCTAGCACCCTGG - Intronic
930105199 2:47633751-47633773 GGCTGCTCTGTCTAGTCCTGAGG - Intergenic
934555163 2:95283200-95283222 GGCTCCTCTGCCCAGGCCCCTGG - Intronic
940903435 2:159147395-159147417 AGCTGCCCTGCCTGGGCCCGGGG + Intronic
941119119 2:161507872-161507894 GGAGGCGCGGCCTGGGCCCGCGG - Intronic
943077481 2:183213145-183213167 GGATGCTCTGCCTAAAACCCAGG - Intergenic
943182337 2:184560451-184560473 GGATGCTCTGGGTGAGCCCGGGG + Intergenic
948570017 2:238912161-238912183 GCATGCTCTGCTGAGGCCCGTGG + Intergenic
1174460204 20:50677147-50677169 GGATGATTTGCCAAGGCCCTGGG + Intronic
1175366567 20:58460352-58460374 TGAGGCTCTGCCTAGGGACGAGG - Exonic
1176058909 20:63163459-63163481 GGATGCCCTGCCAGGGCCAGGGG + Intergenic
1178027936 21:28489397-28489419 GGATGCTGTGCGTAAGCCTGGGG - Intergenic
1179146716 21:38774699-38774721 GGATGCTCTGGCTGGGGCCTGGG - Intergenic
1181671505 22:24427598-24427620 GGAAGCTCTGCCTGGGCCTCAGG + Intronic
1182884275 22:33759953-33759975 GGATGCTCAGCCCAGTGCCGAGG - Intronic
1183359053 22:37373980-37374002 GGACGGTCTGGCTCGGCCCGAGG - Exonic
1183662811 22:39231439-39231461 GGAAGCTCTTCCTAGGCAGGTGG - Intronic
1183715181 22:39529257-39529279 AGATGCTCTGCCCAGGCCTGCGG + Exonic
1184853238 22:47132690-47132712 GGTTGCTGTGCCTTGTCCCGGGG + Intronic
950440337 3:13006747-13006769 GGAAGCACTGCCTGGGCCCAGGG + Intronic
960877721 3:122313907-122313929 GGATGCTGTGCCTAGGCAGGTGG - Intergenic
961555198 3:127692422-127692444 GGACCCTCTCCCTATGCCCGAGG + Intronic
967959260 3:194907351-194907373 GGATTTTCTGAGTAGGCCCGGGG + Intergenic
968042105 3:195597406-195597428 GGATGCATTGCCAAGGCCAGAGG - Intergenic
968447873 4:661483-661505 GGATTCTCTTCCTAGGGCTGTGG - Intronic
969484607 4:7465145-7465167 GGATGCTCTGCTGGGGCCAGGGG + Intronic
969500249 4:7548333-7548355 GGATGCTCTGGCCAAGCCTGAGG + Intronic
969553175 4:7886011-7886033 GGATGATCTGCGGAGGCCTGTGG - Intronic
969631925 4:8343896-8343918 GGATGCTATGGCTATGTCCGGGG - Intergenic
976091232 4:81460293-81460315 GGGTGCTCTGCAGAGGCCAGAGG + Intronic
980779989 4:137481973-137481995 GGATGCTCTGCTTTGGCACCTGG + Intergenic
983721924 4:170865816-170865838 GGAGGTTCTGCCTAAGCCTGAGG - Intergenic
985050754 4:185988669-185988691 GGTTCCTCTGCCCAGGCCTGTGG - Intergenic
985558443 5:569522-569544 GGCTGCACTGCGCAGGCCCGAGG - Intergenic
996230522 5:121058296-121058318 GGATTCTCTGGCTTGGCCCAAGG + Intergenic
1000334025 5:160228691-160228713 AGGTGCGCTGCCTAGGCCCATGG + Intronic
1001587875 5:172845431-172845453 GGATGCTCTGGCCAGTCCCCAGG + Intronic
1002613535 5:180436474-180436496 GGATGCCCTGCCCAGAGCCGAGG - Intergenic
1003491607 6:6627181-6627203 GTATGCCCTGCCTTGGCCAGTGG - Intronic
1003561722 6:7186122-7186144 GGATGCTCTGTCTAGGCTCTGGG - Intronic
1007622631 6:43224235-43224257 GGTGGCTCTCCCTAGGCCCCAGG + Exonic
1019070338 6:169340439-169340461 GGATACTCTGCCTGGGCTGGAGG - Intergenic
1023662883 7:42488708-42488730 GGCTGCTCTGCCAAGTCCCAAGG - Intergenic
1024283650 7:47738991-47739013 GGATGACCTGCAAAGGCCCGAGG - Intronic
1026681642 7:72471598-72471620 TGAGGCTCTGCCCAGTCCCGTGG - Intergenic
1026911510 7:74094145-74094167 GGATGCCCAGCCTGGGGCCGCGG + Intronic
1027134821 7:75616713-75616735 GGCTGCCCTGCCTAGTCCAGGGG - Intronic
1028516870 7:91687599-91687621 GCATGCTTTGCCCAGGCCCTGGG + Intergenic
1029448363 7:100627203-100627225 GGAGGCACTGCCCAGGCCAGGGG - Intronic
1035568120 8:655151-655173 GGCTGCTCTTCCTAGTCCCTTGG - Intronic
1036635715 8:10548459-10548481 GGATGCAATGCCTGGGCCCAGGG - Intronic
1037988499 8:23304372-23304394 GCCTGCACTGCCCAGGCCCGGGG + Intronic
1039454602 8:37698400-37698422 GGCGGCGCTGCCCAGGCCCGAGG - Exonic
1043137723 8:76549240-76549262 GGATGGGCTCCCTAGGCCCTGGG + Intergenic
1043529857 8:81137325-81137347 TGATGCTCTCCCTTGCCCCGGGG - Intergenic
1048595517 8:135861892-135861914 GGATGCTCTGTATAGGGCCTGGG + Intergenic
1049240533 8:141535501-141535523 GGCTGCTCTCCATAGCCCCGTGG + Intergenic
1049278235 8:141730619-141730641 GGATTCTCTCCCTGGGCCCTGGG - Intergenic
1055032364 9:71783452-71783474 GCATGCTCTTCCTTGCCCCGGGG + Intronic
1055084411 9:72299486-72299508 GGGTGCTCTGCCTAGTGCCTAGG - Intergenic
1056332167 9:85529847-85529869 GGATGCCCTCCCTGGGCCCAGGG + Intergenic
1057486404 9:95487962-95487984 GGCTGCTCTGCCAAGGCTCGAGG - Intronic
1059466766 9:114473798-114473820 GGATGCTCTGCAAGGGCCCCAGG + Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1060819230 9:126651884-126651906 GGATCCTCCACCTAGGCCCCTGG - Intronic
1061128032 9:128689164-128689186 GGATGCTCCGCCTCCGGCCGGGG - Intronic
1062162225 9:135087010-135087032 GGGTGGTCTGCCGTGGCCCGCGG - Intronic
1203760852 EBV:12552-12574 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1203761781 EBV:15624-15646 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1203762710 EBV:18696-18718 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1203763639 EBV:21768-21790 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1203764568 EBV:24840-24862 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1203765497 EBV:27912-27934 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1203766426 EBV:30984-31006 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic
1203767355 EBV:34056-34078 AGAGGGTCGGCCTAGGCCCGGGG + Intergenic