ID: 1147377719

View in Genome Browser
Species Human (GRCh38)
Location 17:40032807-40032829
Sequence CAGAGTCCACAGAAGGGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147377719_1147377726 6 Left 1147377719 17:40032807-40032829 CCGTCACCCTTCTGTGGACTCTG 0: 1
1: 0
2: 1
3: 33
4: 322
Right 1147377726 17:40032836-40032858 TGGCTGGGTCAGAGACTGCATGG 0: 1
1: 0
2: 4
3: 34
4: 343
1147377719_1147377725 -9 Left 1147377719 17:40032807-40032829 CCGTCACCCTTCTGTGGACTCTG 0: 1
1: 0
2: 1
3: 33
4: 322
Right 1147377725 17:40032821-40032843 TGGACTCTGAGGATTTGGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 221
1147377719_1147377724 -10 Left 1147377719 17:40032807-40032829 CCGTCACCCTTCTGTGGACTCTG 0: 1
1: 0
2: 1
3: 33
4: 322
Right 1147377724 17:40032820-40032842 GTGGACTCTGAGGATTTGGCTGG 0: 1
1: 0
2: 4
3: 18
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147377719 Original CRISPR CAGAGTCCACAGAAGGGTGA CGG (reversed) Intronic
900099799 1:956956-956978 CAGAGTCCCCAGAGGGCTGAAGG - Exonic
900356587 1:2268001-2268023 TAGCGTCCACAGAGGGGTGGCGG - Intronic
900435947 1:2631397-2631419 CAAAGTCCACAGCAGGGGGGCGG - Intronic
900481064 1:2899558-2899580 CAGAGTCCTGAGAAGGGAGCGGG - Intergenic
900959601 1:5910462-5910484 CAGAGGCCACAGGAGAGGGAGGG - Intronic
900965402 1:5953823-5953845 CAGAGTCCACAGGTGTGTGTAGG - Intronic
901901093 1:12363372-12363394 CAAAGTCCAGGGAAGTGTGAGGG + Intronic
901929108 1:12585649-12585671 CAGATTCCCCAGAAGGGTCAGGG - Intronic
902041390 1:13495082-13495104 CTGAGACCACAGAAGGGTCAGGG + Intronic
902927874 1:19709044-19709066 GAGAGGCCACAGAAGGGAGGGGG + Intronic
903273274 1:22205337-22205359 CCGTGACCACTGAAGGGTGATGG + Intergenic
903284592 1:22268759-22268781 CAGAGTCCACTGACGGGTTGTGG + Intergenic
904039235 1:27574899-27574921 CAGAGTCCAGAGAAGGGCCCCGG - Intronic
905401641 1:37707954-37707976 CAGACCCCACAGAAGGATGAGGG - Intronic
905456351 1:38090706-38090728 CAGTGAACACAGAAGGGTGAAGG + Intergenic
905937864 1:41839172-41839194 CAGGGTCCACAGAGGAGGGAAGG + Intronic
906208911 1:44001432-44001454 CAGAGACCACAGCGGGGAGATGG + Exonic
906419698 1:45654782-45654804 CAGAGTCCACAGAATCATGGCGG + Exonic
907466098 1:54638216-54638238 CAGAATCCACAGAAGCCAGAAGG + Exonic
908256909 1:62310415-62310437 CAGGGGCCAAAGAAAGGTGAGGG + Intronic
908531263 1:65036495-65036517 AAGAGACCAGAGAAGGGTGAGGG + Intergenic
908966415 1:69770034-69770056 CAGAATTCACAGAACAGTGATGG + Intronic
913238455 1:116805996-116806018 TAGAGCCCAAAGAAGGATGAAGG + Intergenic
914748173 1:150514496-150514518 CAGAGTGCGCACAAGGGTCAAGG + Intergenic
915342658 1:155184863-155184885 CAGAGCCCACTGCAGGGGGACGG - Exonic
916763197 1:167835280-167835302 CAGAGGACACAGAAGGGTAAAGG - Intronic
916921674 1:169475631-169475653 GAGAGTCAACAGAGGGTTGATGG - Intronic
919751103 1:201038802-201038824 AAGAGTCCAGTGAAGGGGGAAGG + Intergenic
919871621 1:201826230-201826252 CTCAGTCCCCAGAAGGCTGATGG + Exonic
919972580 1:202590674-202590696 AAGAGTCCACATAAGGGAGATGG + Exonic
920565241 1:206967836-206967858 GAGAGACCACAGTGGGGTGAAGG - Intronic
921124416 1:212164335-212164357 CAGGATCCAGAGTAGGGTGATGG + Intergenic
922648513 1:227317668-227317690 CAGAATGCATAGAAGGGGGAGGG + Exonic
923080197 1:230646043-230646065 CAGGGTCCTGAGAAGGGAGAGGG - Intronic
923699814 1:236289263-236289285 CAGACTCCTCAGACTGGTGAAGG + Intergenic
923861786 1:237898930-237898952 CACAGACCACAGCAGGGGGAAGG - Intergenic
1062857895 10:788543-788565 CCGAGTCCACACCAGGATGATGG - Intergenic
1063975924 10:11415505-11415527 TAAAGTCCACAGAAGTGTGGGGG - Intergenic
1064874022 10:19972431-19972453 CAGAGTCTACTTGAGGGTGAAGG + Intronic
1066458619 10:35594205-35594227 CATATGCCACAGAAGTGTGACGG - Intergenic
1067465091 10:46491750-46491772 TTGTGGCCACAGAAGGGTGAGGG + Intergenic
1067622097 10:47892851-47892873 TTGTGGCCACAGAAGGGTGAGGG - Intergenic
1067989377 10:51193346-51193368 CAGAGTCAAGAGTAGGGTCAGGG + Intronic
1069737799 10:70669011-70669033 CAGTGTCCACAGAGGGCTGCTGG + Intergenic
1071337264 10:84611214-84611236 CAGACTCCATGGAAGGGTCATGG + Intergenic
1071514404 10:86287610-86287632 CAGAGTCCACAGGAGAGGGCTGG + Intronic
1072434245 10:95400974-95400996 CAGATTGCACAGAGGGTTGAAGG + Intronic
1073390996 10:103176223-103176245 GAGAATCCACAGGAGGGAGAGGG - Intronic
1073962248 10:108945823-108945845 CACAGTTCACAGAAGGGTTTGGG + Intergenic
1074537291 10:114337588-114337610 CAGAGTCCACGGAGAGGGGAAGG + Intronic
1075118381 10:119646314-119646336 CAGAGTGCACACCAGGCTGAGGG + Intergenic
1075278010 10:121112818-121112840 CAGAGTCCAGAGGAGGGAGCAGG + Intergenic
1075369343 10:121921772-121921794 CACAGTTCACAGAAGGGGGTGGG - Intronic
1075377430 10:121990101-121990123 AAAAATCCACAGAAGGTTGAAGG - Intronic
1075732866 10:124646693-124646715 CAGAGTTCACATAAGGGGGTTGG - Intronic
1076479281 10:130774139-130774161 CAGAGTTCAGGCAAGGGTGAAGG + Intergenic
1076570957 10:131432538-131432560 GAGAGTGCACAGAGGGGAGAGGG + Intergenic
1076644515 10:131943468-131943490 CAGGGTGCACAGCAGGGTGCTGG - Intronic
1076820548 10:132936713-132936735 GTGAGGCCACAGAAGGGAGAGGG - Intronic
1077498353 11:2897480-2897502 CAGTGCCCACAGCAGGCTGAAGG + Intronic
1080646695 11:34192992-34193014 CTCATTCCCCAGAAGGGTGATGG + Intronic
1081886962 11:46506188-46506210 TAGAGTGGACAGAAGGGAGAAGG + Intronic
1081977674 11:47246031-47246053 CAGAGGCCAGAGGAGGGTGAGGG - Intronic
1083366175 11:62142682-62142704 CAGAGTCCACAGAAGGCAGATGG - Intronic
1084271770 11:68032980-68033002 CTCAGTCCACAGCAGGGTGCGGG - Exonic
1084726395 11:70945246-70945268 CAGAGTCCACAGCAGTGCAAAGG + Intronic
1085246555 11:75106672-75106694 CAGAGCCCACTTGAGGGTGAAGG + Intronic
1085337283 11:75705889-75705911 TGGAGCCCAGAGAAGGGTGAGGG + Intergenic
1086797070 11:91119087-91119109 CAGAGTCTGTGGAAGGGTGAGGG + Intergenic
1087663728 11:101017936-101017958 TAGAGTTCAGAGAAGGGAGAAGG - Intergenic
1088535128 11:110852235-110852257 GAGAGAGCACAGAAGGATGAAGG + Intergenic
1088791568 11:113231592-113231614 CAGAGCCCAAGGCAGGGTGAAGG - Intronic
1089036089 11:115393412-115393434 CAGATTTCACAGAAGACTGAAGG + Intronic
1089187732 11:116631952-116631974 CAGAGTACAATGAAGTGTGAGGG - Intergenic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1090844475 11:130519351-130519373 AAGAGTGCAGAGAAGGCTGAAGG + Intergenic
1090947143 11:131440721-131440743 CAGGTTCCACAGATGAGTGACGG + Intronic
1091660313 12:2378345-2378367 CAGAGGCCATAGAGGGGTGCTGG - Intronic
1093211851 12:16317448-16317470 CAGAGTGCACTGAAGGATCAAGG - Intergenic
1095396903 12:41771962-41771984 CAGAATCCCAAGAAGGGTCAAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1100477475 12:94947940-94947962 CAGAATCCACAGGGAGGTGACGG + Intronic
1102825694 12:115946202-115946224 CAGTGTCCACTGAAGCCTGAAGG + Intergenic
1104294062 12:127495750-127495772 CAGAGTCCACTGAAGGCAGGTGG - Intergenic
1104980331 12:132570625-132570647 CAGAGACCACAGCAGGTGGAGGG - Intronic
1104982278 12:132578813-132578835 CCCTGTCCACATAAGGGTGATGG + Intronic
1105005765 12:132719661-132719683 CTGAGTCCACACAGTGGTGAGGG + Intronic
1107276935 13:38688529-38688551 CAGAGTCTTCAGAAGGGGGCTGG - Exonic
1111935277 13:94550875-94550897 CAGAGTTCAGAGAAGGGTTTGGG + Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1113940773 13:114017623-114017645 CAGAGGCCGCAGAGGGGAGAGGG - Intronic
1118477186 14:66128508-66128530 CTGGGTCCACAGATGGGTGGGGG - Intergenic
1118562653 14:67103146-67103168 CAGAGTCCATACTGGGGTGAAGG - Intronic
1119321171 14:73731379-73731401 AAGAGGGCACAGATGGGTGAAGG - Intronic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1122012914 14:98767587-98767609 CAGAGGCCCCAGAAAGGTGGGGG + Intergenic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1124604368 15:31160018-31160040 CATTGTGCACAGAAGGGTGGGGG - Intronic
1126063842 15:44810048-44810070 CTGAGTCCACACACAGGTGAAGG + Intergenic
1126200445 15:45979454-45979476 AAGAGTCCACTGAAGGTGGAGGG - Intergenic
1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG + Intronic
1128662000 15:69508327-69508349 TAGAGGACACAGTAGGGTGATGG + Intergenic
1128862138 15:71082959-71082981 CAGATGCCACGGAAGGGTCAGGG + Intergenic
1129411665 15:75353891-75353913 CAGAGACCCCAGGAGGCTGATGG + Intronic
1129779439 15:78260418-78260440 CAGAGAGCACAGATGGATGAAGG - Intergenic
1130549167 15:84878828-84878850 CACAGCACACACAAGGGTGAAGG + Intergenic
1130677013 15:85961950-85961972 CTGAGTCCACGGCAGGGTGTGGG - Intergenic
1130958562 15:88644666-88644688 GAGAGTCACCAGAAAGGTGAGGG + Intronic
1131391312 15:92051173-92051195 CAGGGTCCACAGTGAGGTGAAGG + Intronic
1132855943 16:2044562-2044584 GAGAGACCTCAGAAGGCTGAGGG - Intronic
1136229293 16:28877425-28877447 CAGACCCCACAGAAAGGTGTCGG - Intergenic
1136777001 16:32877333-32877355 CCCAGTCCCCAGAAGGGTGCCGG + Intergenic
1136893615 16:33984180-33984202 CCCAGTCCCCAGAAGGGTGCTGG - Intergenic
1137372873 16:47924996-47925018 CATAGTAGACAGAAGGCTGAAGG - Intergenic
1137668377 16:50265330-50265352 CAGAGGCCACAGGAGGGAGTGGG - Intronic
1137707707 16:50547501-50547523 CAGTGTCCCCAGAAGGGGGCAGG + Intergenic
1138614963 16:58157986-58158008 CAGACTCCACAGTGGGGGGACGG - Exonic
1139467904 16:67164063-67164085 CAGAGTCCGCAGAGGGGTGGAGG - Exonic
1139522130 16:67489609-67489631 CAAAGGCCACAGCAGGGGGAAGG - Intergenic
1139570165 16:67806651-67806673 CAGTGTCCAAAGAGGGGTGCCGG - Exonic
1141532966 16:84659517-84659539 CTGAGTCCCCAAAAGGGGGATGG - Intronic
1141645828 16:85367049-85367071 CAGAGGCCACGGCAGGGTGGTGG - Intergenic
1203079418 16_KI270728v1_random:1139442-1139464 CCCAGTCCCCAGAAGGGTGCCGG + Intergenic
1143576950 17:7799285-7799307 AGGAGGCCACAGCAGGGTGAGGG - Intronic
1144075333 17:11714545-11714567 AAGAGACTATAGAAGGGTGAGGG - Intronic
1144560238 17:16315336-16315358 CAGATGCCACAGAAGGTTCAAGG - Intronic
1147377719 17:40032807-40032829 CAGAGTCCACAGAAGGGTGACGG - Intronic
1147858667 17:43502891-43502913 CAGAGGCCAAAGGAGGGTCATGG - Intronic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1149081308 17:52660958-52660980 AAGATTCCACAGAAGTGAGAGGG - Intergenic
1149662234 17:58340110-58340132 CAGAGTCTACAGAGGAGTGAAGG - Intergenic
1149849978 17:60028483-60028505 CTCTGTCCACAGAAGGGGGAGGG - Intergenic
1149860189 17:60118041-60118063 CTCTGTCCACAGAAGGGGGAGGG + Intergenic
1150269529 17:63854467-63854489 CTGAGTCAATAGAAGGGTGCTGG - Intergenic
1150484958 17:65537189-65537211 CAGAGTGCACGGCCGGGTGAGGG - Intronic
1151362498 17:73596950-73596972 CAGAGTCCCCAGAATGGAAATGG - Intronic
1151575475 17:74950825-74950847 CAGAGGCCAGAGCTGGGTGAAGG + Exonic
1151692017 17:75692405-75692427 CAGAGTTCACAGAAAGTTGCTGG - Intronic
1151894341 17:76969880-76969902 CGGAGTCCAGGGAAGGGGGAGGG - Intergenic
1152271089 17:79325253-79325275 GAGATTCCACAGGTGGGTGAGGG + Intronic
1152367467 17:79864881-79864903 CAGAGGCCACAGCAGGAGGAGGG - Intergenic
1154282723 18:13020468-13020490 AAGTGTCCACAGAAGGATGAGGG - Intronic
1155632715 18:27913061-27913083 CATAGCCCACAGAAGGCTGGTGG - Intergenic
1155740744 18:29284902-29284924 CTGTGTCCTCACAAGGGTGAAGG - Intergenic
1156164549 18:34402675-34402697 CAGACTTCACAAAAGGGTGATGG + Intergenic
1157295504 18:46439207-46439229 CAGACTCCCCTGAAGGCTGATGG + Intronic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1160570803 18:79816398-79816420 CAGAGGGCAGAGAAGGGGGAGGG - Intergenic
1161420669 19:4174637-4174659 CAGACCCCCCAAAAGGGTGAAGG - Exonic
1161483622 19:4523413-4523435 CTGATTCCAAAGAAGGGTCAAGG + Exonic
1162657205 19:12140142-12140164 CGGAGTCCCCAGACGGGGGAGGG - Intronic
1163401135 19:17093542-17093564 CAGACACCACAGCAGGGAGATGG - Intronic
1164159724 19:22618270-22618292 CAAACTGCCCAGAAGGGTGAGGG - Intergenic
1165019077 19:32908390-32908412 CAGAGTCGATAGATGGGTCAAGG + Intronic
1166663500 19:44662754-44662776 CAGACCACACAGAAGGGTGTGGG + Exonic
1166786479 19:45370303-45370325 TCGAGCCCAGAGAAGGGTGACGG + Intronic
1168339970 19:55617111-55617133 CAGATTCCAAAGGAGGGGGAGGG - Exonic
925210190 2:2038846-2038868 CTGAGTTCAGAGAAGGGTGAGGG - Intronic
928211297 2:29325911-29325933 CAGAGTCAACATTAGTGTGATGG + Intronic
928214868 2:29352777-29352799 CAGAGTCCAGAAAGGGTTGAGGG + Intronic
929502854 2:42504971-42504993 CAAGGTCCACAGAGTGGTGATGG - Intronic
929559633 2:42947921-42947943 CACAGTCCAAAGCATGGTGATGG - Intergenic
929999383 2:46850644-46850666 CAGGGTCCCCAGAAAAGTGAGGG + Intronic
931217925 2:60263688-60263710 CAAAGTGGAGAGAAGGGTGAGGG - Intergenic
932056006 2:68445069-68445091 CAGATTCCCCAGAATTGTGAAGG + Intergenic
934514684 2:94979179-94979201 CGGAGTCTACAGGAGGGTGGAGG + Intergenic
937229516 2:120389417-120389439 CAGAGGCCAGGGAGGGGTGAGGG - Intergenic
937921964 2:127137289-127137311 CCGAGCCCACAGAGGGGTGCTGG + Intergenic
938303085 2:130229768-130229790 CAGAGTCCCCAGAGGGCTGAAGG + Intergenic
938453586 2:131444458-131444480 CAGAGTCCCCAGAGGGCTGAAGG - Intergenic
938607653 2:132912420-132912442 CATAGTCCACAGAGGGTTGAAGG - Intronic
940077883 2:149763905-149763927 TAGAGACCACAGTAGGGTAAAGG - Intergenic
940139458 2:150477498-150477520 CATAGTCCACAAAGGGGGGAGGG - Intronic
943101041 2:183486900-183486922 CAGGGTCCAGAGAAGGCAGAGGG + Intergenic
944956493 2:204817454-204817476 CAGAGTACACAGAAGGGTATTGG - Intronic
944973496 2:205021046-205021068 CAGAGTTCAGAGAAAGGTGATGG + Intronic
946018075 2:216620175-216620197 CAGTGGCCTCAGGAGGGTGAGGG + Intergenic
946226607 2:218267217-218267239 TAGAGTGGACAGAAGGGGGAAGG - Intronic
948033524 2:234839301-234839323 CAGAGTCCTGAGAAGAGTCATGG + Intergenic
948084846 2:235238853-235238875 CAGTCTCCACTGCAGGGTGATGG + Intergenic
948208141 2:236173522-236173544 CAGAGGGCACGGAGGGGTGAGGG + Intergenic
1169931626 20:10839300-10839322 CAGAAATCACAGTAGGGTGATGG - Intergenic
1170778390 20:19401232-19401254 ACGAGTCCACAGAAGTGGGATGG + Intronic
1170936937 20:20818573-20818595 CAAAGGACCCAGAAGGGTGAAGG + Intergenic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172214329 20:33224316-33224338 CAGAGGCCCCACAAGGGTGAGGG - Intronic
1172622301 20:36327469-36327491 CAGAGCCCACAGCTTGGTGAAGG + Intronic
1172871841 20:38141149-38141171 ATGGGTCCACAGAAGGGTGGGGG - Intronic
1173016610 20:39231599-39231621 CTGAGTCCACAGAAGGGAAAAGG - Intergenic
1173054702 20:39599754-39599776 CAATTTCCACAGAAGGATGAAGG + Intergenic
1173124799 20:40326837-40326859 CTGATTCCACTGTAGGGTGAAGG - Intergenic
1173848476 20:46202764-46202786 CTGAGTCCAAAGGAGGTTGAAGG + Intronic
1174057111 20:47805750-47805772 CAGGGTCCAGAGAACGGAGAGGG + Intergenic
1174667649 20:52274914-52274936 CTGTGTTCACAGACGGGTGACGG + Intergenic
1175490979 20:59381147-59381169 CAGGGAGCAGAGAAGGGTGAAGG - Intergenic
1175858369 20:62134903-62134925 CAGGGACCACAGAAGGGCCAAGG - Exonic
1176296673 21:5076770-5076792 CAGAGACCACAGAAAGCTGAGGG + Intergenic
1176426764 21:6553086-6553108 CAGCTTCCAGAGAAGGCTGAGGG - Intergenic
1179258467 21:39737974-39737996 GAGAGTACGCAGAAGGGTGATGG + Intergenic
1179702255 21:43161408-43161430 CAGCTTCCAGAGAAGGCTGAGGG - Intronic
1179860376 21:44185351-44185373 CAGAGACCACAGAAAGCTGAGGG - Intergenic
1180589273 22:16922306-16922328 AAGAGTCAAGGGAAGGGTGAAGG + Intergenic
1180931171 22:19592957-19592979 CAGAGTCTACAGAAATGAGATGG + Intergenic
1181472993 22:23152283-23152305 CACAGTCCCCAGAGGGGAGACGG - Intronic
1182415205 22:30216992-30217014 CAGAAGCCACACAAGGCTGATGG + Intergenic
1183339669 22:37273260-37273282 CAGAGCCCACAGAAGTGTTTCGG + Intergenic
1183457560 22:37930888-37930910 CAGAGTCCCCAGCGGGGAGAGGG + Intronic
1183515635 22:38264280-38264302 CAGAGCCCTGAGAAGGGTCAAGG - Intronic
1184095290 22:42313050-42313072 CAGGGTCCACAGTATGGTGATGG - Intronic
1185426907 22:50776924-50776946 CAAACTCCATGGAAGGGTGAGGG + Intronic
949934714 3:9107793-9107815 AAGAGCTCACAGTAGGGTGAGGG - Intronic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950408149 3:12817233-12817255 CATAGTCCACACACGGGGGACGG - Exonic
950486573 3:13277527-13277549 TAGAGTCCACAGAAAGACGAGGG - Intergenic
950878807 3:16304691-16304713 TAGAGATCACAGGAGGGTGAAGG + Exonic
951883176 3:27499229-27499251 CATACTCCAGAGAGGGGTGAGGG + Intergenic
952207561 3:31195453-31195475 CAAAGTCAATAGAAGGTTGATGG + Intergenic
954539046 3:51381731-51381753 CAGAGGCCACAGCAGCATGAAGG + Exonic
954625020 3:52017724-52017746 CAGAGCCCACAGCAGAGGGAAGG - Intergenic
955369179 3:58336283-58336305 CTGAGTCACCAGAAGGATGAAGG + Intronic
955831283 3:63006941-63006963 CATAGTGCACAGGATGGTGATGG + Intergenic
956907645 3:73783110-73783132 CCTAGTCCACAGAAAGGAGATGG - Intergenic
957219727 3:77366414-77366436 CAGAGTCCTCATATGGCTGATGG - Intronic
959560313 3:107772239-107772261 CAGAAGCCACAGAGGAGTGAGGG + Intronic
960545502 3:118910085-118910107 CAGAGTCAACAGAAGTGGGTAGG - Intronic
961682934 3:128611041-128611063 CAGGGTCCACAGCTGGGTGTGGG - Intergenic
962445164 3:135457315-135457337 TAGAGTTCCCAGAAGGGCGAGGG - Intergenic
963893447 3:150660635-150660657 CAGAGGCCAAAGAAGAGTAAGGG - Intronic
965028299 3:163330225-163330247 CAGATGCCACAGGAGGTTGAGGG - Intergenic
966529277 3:180956438-180956460 CAAGGACCCCAGAAGGGTGATGG + Intronic
967654598 3:192031827-192031849 CAGAGTCCACAGATGCATGGAGG - Intergenic
969229033 4:5816902-5816924 CAGAGTTCTCAGGAGGTTGAAGG - Intronic
970954323 4:21792972-21792994 CAGAGTCAACAGATGAGAGAAGG + Intronic
971124859 4:23742432-23742454 CAGACTCCCCTGAAGGATGAAGG + Intergenic
971317249 4:25577774-25577796 CAGAGTTCACAGAATTGTAAGGG - Intergenic
972998577 4:44915892-44915914 AAGAAACAACAGAAGGGTGATGG - Intergenic
973069194 4:45835927-45835949 CAGACTCCACAGCTGGGGGAAGG - Intergenic
976087388 4:81420181-81420203 GAGAGTTCACAGCACGGTGAAGG - Intergenic
976222262 4:82766191-82766213 TGGAGTCCACAGAATGGTGGTGG - Intronic
976231920 4:82853082-82853104 AAGAGGCCACAGAAGGGTACTGG + Intronic
978099890 4:104825671-104825693 CAGAGTCTACTTGAGGGTGAGGG - Intergenic
980790016 4:137608319-137608341 CAGAGCCCATGGCAGGGTGAGGG - Intergenic
981491915 4:145348679-145348701 CAGAGCCCACAGAAGGAGAATGG - Intergenic
981811682 4:148782567-148782589 CAAAGTCCCCAGGAAGGTGAGGG - Intergenic
982613741 4:157613319-157613341 CAAATTCCACTGAAGGGTGAGGG - Intergenic
983970329 4:173863819-173863841 CAGAATCCACAGAGGTGAGATGG - Intergenic
985010154 4:185573857-185573879 CAGCGTGCACAGAGTGGTGAGGG + Intergenic
985548573 5:522005-522027 CAGAGTGCACAGTGGGTTGAGGG + Intronic
985614983 5:914867-914889 CAGAGTCCACAGAAAGGAAATGG + Intronic
987112488 5:14700852-14700874 CAGAGTGCTCAAAAAGGTGATGG - Intergenic
988009388 5:25463207-25463229 CAGAGATCACATAAGGGTGTAGG + Intergenic
988513584 5:31886498-31886520 CACAGTTCTCAGAAGGGTGGAGG - Intronic
993864513 5:93176257-93176279 CAGAGTAGACAGAAGGGTTGGGG - Intergenic
995311219 5:110714082-110714104 AAGAGTCCATGGCAGGGTGAGGG - Intronic
995722451 5:115151066-115151088 CAGACTCCACAGGTGGGAGAAGG + Intronic
999649564 5:153752007-153752029 CAGAGCCCACAGAAATGGGAAGG - Intronic
1001221240 5:169902774-169902796 CAGAGCCCACAGAGTAGTGAGGG + Intronic
1001241011 5:170069829-170069851 CAGAGTCCACAGGAAGAAGAGGG - Intronic
1001740880 5:174051869-174051891 CTGAGCCCTCAGAAGGGTGGAGG + Intronic
1004169848 6:13287457-13287479 CTGAGTCCAAAGAAAGCTGAAGG + Exonic
1005166963 6:22935755-22935777 CAGAGTCCACATCAGGGAAATGG - Intergenic
1006186475 6:32184256-32184278 CGGAGGCCACAGCAGGGAGAGGG - Exonic
1006651417 6:35554874-35554896 CAGAGTCAGCAGCAGGGAGAAGG + Intergenic
1006697478 6:35943474-35943496 CAGAATACAGAGAAGGGAGAAGG + Intergenic
1006743750 6:36326869-36326891 CAGAGCCCAGAGCAGGGGGAGGG + Intronic
1007285001 6:40741258-40741280 CAGAGTTCAGAGAAGGCTGGAGG - Intergenic
1007855714 6:44854295-44854317 AAGAGTCCATAGAAGGATGATGG - Intronic
1008535484 6:52503708-52503730 CAGTGGCCACAGAAGGGAGGGGG + Intronic
1012604821 6:101144853-101144875 CAGGGTGCAGAGTAGGGTGAAGG + Intergenic
1012960193 6:105614342-105614364 CAGAATCCACAAATGGTTGATGG + Intergenic
1012960452 6:105616368-105616390 CAGAATCCACAAATGGTTGATGG + Intergenic
1014544635 6:122719417-122719439 AAGATTACACAAAAGGGTGAAGG + Intronic
1014609791 6:123527516-123527538 CTGATTCCACATTAGGGTGATGG - Intronic
1016879804 6:148899901-148899923 TAGATGGCACAGAAGGGTGATGG - Intronic
1018626336 6:165782403-165782425 CAGAGTCCACAGCAGGGCCAAGG + Intronic
1019097735 6:169598723-169598745 CAGAGGCCAGGGAAGCGTGAGGG + Intronic
1019312737 7:370611-370633 CAAAGTCCACAGGAGGCAGATGG - Intergenic
1020188006 7:5973709-5973731 CTGATTTCACAGAAGGGTGGAGG - Intronic
1020294912 7:6751060-6751082 CTGATTTCACAGAAGGGTGGAGG + Intergenic
1020822271 7:12985182-12985204 CCAGGACCACAGAAGGGTGAGGG - Intergenic
1021434636 7:20600308-20600330 CAGAAACCACAGGAGGGTGGGGG + Intergenic
1022982967 7:35622025-35622047 CAGAGGCCAGGAAAGGGTGAGGG + Intergenic
1023461068 7:40397836-40397858 CAGAGTGGACAGAAGGGATATGG - Intronic
1024088195 7:45914635-45914657 CAGAGCCCTCAGAAGGGTGCAGG - Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024689268 7:51781456-51781478 GAGATTCCAGAGAAGGGTGAAGG + Intergenic
1026316985 7:69235638-69235660 CCGAGTCCACAGCAGCGTTATGG - Intergenic
1027231105 7:76273001-76273023 CGGAGTGGACAGATGGGTGAAGG - Intronic
1028150207 7:87363556-87363578 CAGAGTACACAGGAGGGAGCTGG + Intronic
1028489796 7:91398615-91398637 CAGAGTGCCCTGAAGGGAGATGG - Intergenic
1028515087 7:91669538-91669560 CAAAGTACACAGAAGGATCAGGG - Intergenic
1028891348 7:95991720-95991742 AAGAGTCCAAAGAGGGGTGCAGG - Intronic
1028995278 7:97093255-97093277 AAGTGTCTTCAGAAGGGTGAGGG + Intergenic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1029490650 7:100868263-100868285 GAGAGTCCAGAGAAGGGGGCAGG - Intronic
1029642885 7:101832250-101832272 CAGGGACCACTGAGGGGTGATGG + Intronic
1032418789 7:131761041-131761063 CACAGTCAACAGAAAGTTGAAGG + Intergenic
1033237880 7:139652772-139652794 CAGAGTTGAGAGAAGGGAGAGGG + Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1033939902 7:146639865-146639887 CAGAGTCCGAAGAAGAGGGAAGG + Intronic
1034634050 7:152553500-152553522 CAGACTCCACAGCTGGGTGCAGG + Intergenic
1035030784 7:155857320-155857342 GATAATCCACAGCAGGGTGAGGG + Intergenic
1035670645 8:1414559-1414581 CAGAGTCCACACCAGAGTGGAGG + Intergenic
1036571098 8:9980353-9980375 AAGAGTCCACGGATGGGTCAGGG + Intergenic
1037742758 8:21620511-21620533 CAGAGCACACAGTAGGGTAAGGG + Intergenic
1037827906 8:22170220-22170242 CAGAGGCCACAGAACTGTGCTGG - Intronic
1038018136 8:23531874-23531896 CAGAGTCCACTAATGGGTCATGG - Intronic
1039041673 8:33414417-33414439 CATAGGGCAGAGAAGGGTGAGGG - Intronic
1040139561 8:43894457-43894479 CCGAAACCACAGGAGGGTGAGGG - Intergenic
1040640551 8:49329522-49329544 AAGAGGCCATGGAAGGGTGAGGG - Intergenic
1040755580 8:50770501-50770523 CAGAACCCACTGAAGGGTGTGGG + Intronic
1042097296 8:65230943-65230965 GAGAGTTCACAGCAGGTTGATGG - Intergenic
1043172957 8:76988219-76988241 CAGAGACCACAGGACTGTGATGG - Intronic
1044916180 8:97114752-97114774 CAGATTTCACTGAAGGATGAAGG - Intronic
1044927747 8:97223865-97223887 CAGAGTCCCCTGGAGGGTCAGGG - Intergenic
1046273564 8:111927230-111927252 GAGAGACCACAGAAGGATTATGG + Intergenic
1046531029 8:115445075-115445097 GAGGGTTCAGAGAAGGGTGATGG - Intronic
1048586173 8:135776157-135776179 CAGAGGCCAGAGGAGGGGGAGGG + Intergenic
1049257465 8:141621551-141621573 CTGAGGCCACCGAGGGGTGAGGG - Intergenic
1049329261 8:142041372-142041394 CAGAGTCCACAGAGCTGGGAGGG - Intergenic
1049772354 8:144389341-144389363 CAGAGGTCACAGGAGGGTCAAGG - Intronic
1050232633 9:3543864-3543886 CTGAGTCCTGAGTAGGGTGAGGG - Intergenic
1050686082 9:8170791-8170813 CAGAGGTCACAGAGTGGTGAAGG - Intergenic
1050763859 9:9108484-9108506 CAAAGTCCACCCAAGGTTGAGGG + Intronic
1051348537 9:16175455-16175477 CAGAGCCAAGAGAAGGGTAAGGG - Intergenic
1053383243 9:37666489-37666511 TAAAGTGCACAGAAGGGAGATGG - Intronic
1057859089 9:98625349-98625371 CAGTTTCCACAGAAGGGCAATGG - Intronic
1058224972 9:102348924-102348946 CAGAGTCCACAACATGTTGATGG + Intergenic
1059545412 9:115171033-115171055 CTGAGTTGACAGAAGAGTGAGGG + Intronic
1059795866 9:117696044-117696066 CATAGTCCAAAGAATGGTGCAGG - Intergenic
1060192682 9:121603091-121603113 CAGAGGCCACAGTAGGAGGATGG - Intronic
1060496536 9:124123384-124123406 CAGAGGCCAGAGAAGGCAGATGG + Intergenic
1060591221 9:124818126-124818148 CAGAGCTCACAGAGGGGAGATGG - Intergenic
1061187599 9:129063742-129063764 CAGAGTCTACAGAACGGAGTAGG - Intronic
1061297760 9:129686237-129686259 CAGAGTCAAGACAAGGGTGAGGG + Intronic
1061664618 9:132153267-132153289 CAGAGTGCTCAGAGGGGTGTAGG - Intergenic
1062200917 9:135302163-135302185 CTGAGCCCCCAGGAGGGTGAGGG - Intergenic
1062282975 9:135760151-135760173 CAGAGTGCAGGGAAGGGTCAAGG + Intronic
1062380396 9:136284179-136284201 CAGAGTCCACATGTGGGGGAAGG - Intronic
1062472945 9:136714135-136714157 CAGGATCCACAGCAGGGTCAGGG + Intronic
1062631192 9:137463915-137463937 CAGAGACCTCAGAAGGCTGGAGG - Intronic
1187144693 X:16626767-16626789 CAGAGGTCACAGAAGGGGAAGGG - Intronic
1188049390 X:25466043-25466065 CAGTCTCCACTGAAGGGGGAAGG + Intergenic
1188655627 X:32691757-32691779 CAGTGTCCACTGATGGATGAGGG + Intronic
1189592864 X:42534131-42534153 CAGAGTTCACAGTAGGATCAGGG + Intergenic
1190812283 X:53896397-53896419 CAGTGGCCACAGAATGCTGATGG + Intergenic
1192030304 X:67504190-67504212 CACAGTCCACAAAAGTGTGTGGG + Intergenic
1195574938 X:106439023-106439045 CAGATTCCACAGATTGGGGAGGG - Intergenic
1197072610 X:122317998-122318020 CAGAGATCACAGAAGGCTGGTGG - Intergenic
1199806104 X:151301964-151301986 CAGAGTTCCCAAAAGAGTGATGG + Intergenic
1199902517 X:152190390-152190412 CAGAGACCTAAAAAGGGTGATGG + Intronic
1200102858 X:153696710-153696732 CCCAGTCCCCAGAAGGGTGCCGG - Intergenic
1201266033 Y:12207615-12207637 CAGTGTCCACTGATGGATGATGG - Intergenic