ID: 1147381613

View in Genome Browser
Species Human (GRCh38)
Location 17:40059708-40059730
Sequence CTTACACATCTCTAGCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147381613_1147381616 -9 Left 1147381613 17:40059708-40059730 CCAAACTGCTAGAGATGTGTAAG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1147381616 17:40059722-40059744 ATGTGTAAGGCTTTTGAGCAGGG 0: 1
1: 0
2: 2
3: 17
4: 179
1147381613_1147381619 9 Left 1147381613 17:40059708-40059730 CCAAACTGCTAGAGATGTGTAAG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1147381619 17:40059740-40059762 CAGGGGTAGAGGATGCTGTGTGG 0: 1
1: 0
2: 4
3: 35
4: 380
1147381613_1147381618 -2 Left 1147381613 17:40059708-40059730 CCAAACTGCTAGAGATGTGTAAG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1147381618 17:40059729-40059751 AGGCTTTTGAGCAGGGGTAGAGG 0: 1
1: 0
2: 1
3: 21
4: 240
1147381613_1147381615 -10 Left 1147381613 17:40059708-40059730 CCAAACTGCTAGAGATGTGTAAG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1147381615 17:40059721-40059743 GATGTGTAAGGCTTTTGAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 144
1147381613_1147381617 -8 Left 1147381613 17:40059708-40059730 CCAAACTGCTAGAGATGTGTAAG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1147381617 17:40059723-40059745 TGTGTAAGGCTTTTGAGCAGGGG 0: 1
1: 0
2: 3
3: 34
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147381613 Original CRISPR CTTACACATCTCTAGCAGTT TGG (reversed) Intronic
904422075 1:30400644-30400666 CTTTGACTGCTCTAGCAGTTGGG - Intergenic
906530114 1:46519048-46519070 CTTACACAACTCTATGAGGTAGG + Intergenic
906811478 1:48831386-48831408 CTTACATCTCTGTAGCACTTGGG - Intronic
907242017 1:53086121-53086143 CTTACACACCTCCAGCAGCAGGG - Intergenic
907877177 1:58502533-58502555 CTTTGACATCTCTAGCAGTATGG - Intronic
909026400 1:70486965-70486987 CTTACCCATCTCTTGCAGTCTGG + Intergenic
911844588 1:102734937-102734959 TTTAGAGATCACTAGCAGTTAGG + Intergenic
916943186 1:169697880-169697902 CTTACTCATCTATTGCTGTTAGG - Intronic
918361320 1:183761375-183761397 CTTGCACATCTCTGGCTCTTGGG + Intronic
923405426 1:233654660-233654682 CCTCCACTTCTCTAACAGTTAGG - Intronic
1065124289 10:22559215-22559237 ATTACACATCTGTAGCAGCTTGG + Intronic
1065717053 10:28581397-28581419 CTTTCACCTCTTTATCAGTTAGG + Intronic
1068329295 10:55540064-55540086 TTTATACATGTTTAGCAGTTTGG - Intronic
1071478468 10:86044658-86044680 GTTGCACATCTCTAAGAGTTGGG - Intronic
1071696298 10:87876489-87876511 CTTATATATCTCAACCAGTTAGG - Intronic
1071717163 10:88108487-88108509 GGTACACATATCTAGGAGTTAGG + Intergenic
1072870261 10:99111874-99111896 ATTACAGATCTCTAGCATTGGGG - Intronic
1073628983 10:105128948-105128970 GTAACCCATCTCTTGCAGTTTGG - Intronic
1074176056 10:111004424-111004446 ACTACACAGTTCTAGCAGTTTGG - Intronic
1075898807 10:126021357-126021379 ATTACATTTCTTTAGCAGTTGGG + Intronic
1076464490 10:130669190-130669212 CTTCCACAAATCTAGCATTTGGG + Intergenic
1080163303 11:29205352-29205374 CTGACACACCTCTATGAGTTAGG + Intergenic
1098088213 12:66871495-66871517 CTTACACATCCCTATAAGGTAGG - Intergenic
1106049752 13:26179146-26179168 CTTACAGAACTCTGGCAGCTGGG - Intronic
1107320694 13:39184593-39184615 CTTTAACAACTCTAGCAGCTGGG - Intergenic
1111802275 13:92995602-92995624 CTATCACATCTCAAGCAGTAGGG - Intergenic
1112721819 13:102254299-102254321 TTTACCCATCTCTAACATTTTGG - Intronic
1120727557 14:87962067-87962089 CTCACACATCCCTAACAGGTGGG - Intronic
1121454958 14:94032263-94032285 CTTACAAATGTCTCGCAGGTGGG - Intronic
1121527613 14:94630254-94630276 TTTACACAGATCTACCAGTTGGG + Intergenic
1121954203 14:98199175-98199197 CTTACAGCTCTCAAGCAGGTAGG + Intergenic
1124009351 15:25824356-25824378 CTTCCACATCCCTAGAAGCTGGG - Intronic
1125304608 15:38296153-38296175 CTTCTACTTGTCTAGCAGTTGGG + Intronic
1125698914 15:41662289-41662311 CTGACAGGTCTCTAGCAGTTGGG - Intronic
1125965722 15:43874178-43874200 CCTCCACCTCTGTAGCAGTTGGG + Exonic
1127002674 15:54528281-54528303 CTTACACATGTTTTGCAGTTTGG + Intronic
1129356542 15:74995800-74995822 CTCCCACCTCTCCAGCAGTTCGG - Intronic
1134003726 16:10803456-10803478 GTTACTCATCTCTAGCAGGGAGG + Intronic
1137477279 16:48819919-48819941 CTTACACACCTCTCACAGTGTGG + Intergenic
1138049135 16:53758089-53758111 CTTACACCTATCTGGCAGGTGGG - Intronic
1140863500 16:79039836-79039858 CTGACTCATCTCTACCAGTCAGG + Intronic
1142775922 17:2138985-2139007 GCTACACATCTCCAGCAGTTTGG - Intronic
1143934987 17:10474338-10474360 GTTACACATCTCAACCAATTGGG - Intergenic
1144195085 17:12885468-12885490 CTCACACATTGCTAGGAGTTGGG - Intronic
1146762507 17:35490755-35490777 CTTTCACAACTATAACAGTTTGG - Intronic
1147381613 17:40059708-40059730 CTTACACATCTCTAGCAGTTTGG - Intronic
1151195449 17:72427954-72427976 CTCTCACAACTCTAGCAGTCAGG - Intergenic
1151335743 17:73438670-73438692 CTTGCTCTTCTCTTGCAGTTGGG - Intronic
1154177683 18:12095493-12095515 CATACATATCTCTAACATTTGGG - Exonic
1157995140 18:52545852-52545874 CTTACACATCCCTACCCATTTGG + Intronic
1160278330 18:77461194-77461216 ATTACTCATCTCTAGCCTTTTGG + Intergenic
1160819501 19:1051431-1051453 CTTCCCCATCTCTACCAGGTGGG + Exonic
1163761473 19:19139073-19139095 CTTATTCATCTCTATCAGCTAGG + Intergenic
927608082 2:24506596-24506618 CTTAGACATCTTTAGTGGTTAGG + Intronic
931838595 2:66126223-66126245 CATACACCTCTCTTGTAGTTGGG - Intergenic
932458990 2:71870222-71870244 CTTACACATTTCTAATACTTTGG + Intergenic
933357933 2:81237492-81237514 CATACACATTTGTAGCATTTTGG + Intergenic
933699249 2:85242936-85242958 ATTACACACCTCTGGCAGTGGGG + Intronic
936667785 2:114617324-114617346 CTTATACATGTCTAAAAGTTGGG - Intronic
936912932 2:117611475-117611497 CTAGAACTTCTCTAGCAGTTAGG + Intergenic
936922984 2:117708117-117708139 CTGACACATATGTAGCAATTAGG + Intergenic
937861358 2:126714003-126714025 ATTACACATCTCAAGTAATTAGG + Intergenic
941310057 2:163916505-163916527 CCAAAACATCTCTAACAGTTAGG + Intergenic
942016796 2:171825784-171825806 CTTCCACTTCTATAGCACTTAGG - Intronic
942125989 2:172826073-172826095 CTTCCACTCCTCTAGCCGTTGGG + Intronic
947677485 2:231996037-231996059 CTTGAACCTCTCTAGCTGTTTGG - Intronic
948535972 2:238647075-238647097 CTTACACATCTCCACCAGTCAGG + Intergenic
1173385649 20:42584986-42585008 CTTACACATCCCTAGCAGGATGG - Intronic
1183884580 22:40867779-40867801 CTTATCCATCTCCAACAGTTTGG - Intronic
950274179 3:11644262-11644284 CTTATGCATCACTAGCACTTTGG - Intronic
952159655 3:30681022-30681044 CTTCCACATCCCTAGCATTTAGG + Intronic
952746067 3:36781616-36781638 AATACTCACCTCTAGCAGTTTGG - Intergenic
958988874 3:100817825-100817847 CTTGCACTTCTATAGAAGTTGGG + Intronic
959897319 3:111619061-111619083 CTTTCCTTTCTCTAGCAGTTAGG + Intronic
960204208 3:114875466-114875488 CATACACATCTCCCTCAGTTTGG + Intronic
961730150 3:128959385-128959407 CTTACACATGACTGGTAGTTTGG - Intronic
965175867 3:165331345-165331367 TTAACCCATCTCTAGCAGTGTGG - Intergenic
966255818 3:177915814-177915836 CTTACACATCTCTATGTTTTTGG + Intergenic
971177721 4:24295980-24296002 CATACACATATATAGTAGTTGGG - Intergenic
971901140 4:32659243-32659265 ATTACATATCACTAGTAGTTTGG - Intergenic
971917951 4:32898376-32898398 CTTACACCTTCCTAGCATTTTGG - Intergenic
976776374 4:88710731-88710753 GTTGCCCATCTCTAGCAGCTGGG - Intergenic
978343937 4:107746220-107746242 ATTACACATGTATAGCAGCTTGG - Intergenic
980496761 4:133595124-133595146 CTTACACATATGTATCACTTAGG - Intergenic
981454529 4:144938048-144938070 CAGACACATCTCTATCAGTGAGG + Intergenic
981543870 4:145874057-145874079 CTTAATGATCTCTAGAAGTTGGG - Intronic
981649301 4:147037981-147038003 CTTACCCATTATTAGCAGTTGGG - Intergenic
982371982 4:154643616-154643638 CTTTAAAATCTCTAACAGTTAGG + Intronic
983071803 4:163276456-163276478 CTTACATGTATTTAGCAGTTTGG - Intergenic
986760499 5:10875752-10875774 ATGACACATCTTGAGCAGTTTGG - Intergenic
986992137 5:13566533-13566555 CTTACACAATTTTTGCAGTTGGG - Intergenic
989461284 5:41701528-41701550 CTTACATATTTGTAGGAGTTGGG - Intergenic
991268358 5:64749360-64749382 CTTCCACATCCCTAACATTTTGG + Intronic
993776120 5:91999043-91999065 CTTACACATCTCTAACATAGTGG - Intergenic
998783840 5:145687668-145687690 CTTATGCATCACTAGCATTTAGG + Intronic
1004933689 6:20486740-20486762 CTTTCACAACTATAACAGTTTGG - Exonic
1006558381 6:34888685-34888707 CTGACACTTTTCTATCAGTTTGG + Intergenic
1011682871 6:89800026-89800048 CTTTCTCCTCTCTGGCAGTTGGG - Intronic
1012517691 6:100081714-100081736 CTTACACAAATCTAAGAGTTAGG + Intergenic
1014046218 6:116890982-116891004 GTTACACATCTGTATTAGTTAGG + Intronic
1021830586 7:24603901-24603923 CTTTGCCATGTCTAGCAGTTTGG - Intronic
1028384523 7:90239766-90239788 CTTAAAAATCACTTGCAGTTTGG + Intergenic
1034777285 7:153839969-153839991 ATCACACATCTCCAGCATTTGGG - Intergenic
1035107203 7:156451340-156451362 CTTATGCATCTCTGTCAGTTAGG + Intergenic
1036019057 8:4821776-4821798 GTTACAACTCTCTAGCAATTGGG + Intronic
1038598621 8:28914215-28914237 CTTACCCATCTCAAGTGGTTAGG - Intronic
1038753556 8:30318996-30319018 CTTACACACTTCTAGCAGTGTGG - Intergenic
1041664116 8:60425692-60425714 CTTAGACATCTGTAACACTTTGG + Intergenic
1045854602 8:106749449-106749471 CTTACACAACTCTATAATTTGGG - Intronic
1047358919 8:124149863-124149885 CTTACCCAGCTTTAGAAGTTTGG - Intergenic
1048475680 8:134740301-134740323 CTTACCCATGTCTAGCACTTAGG - Intergenic
1050638313 9:7637745-7637767 ATTCCACATGTCTGGCAGTTCGG - Intergenic
1051469333 9:17419022-17419044 CTTCCAAAACTTTAGCAGTTTGG - Intronic
1052671539 9:31563605-31563627 ATTACACATATGTAGCACTTAGG - Intergenic
1053617100 9:39779643-39779665 GATACACATATTTAGCAGTTCGG + Intergenic
1054267068 9:62927794-62927816 GATACACATATTTAGCAGTTCGG - Intergenic
1054550558 9:66597245-66597267 GATACACATATTTAGCAGTTCGG - Intergenic
1058048010 9:100378081-100378103 ATTATATATCTCTAGCAGTTAGG + Intergenic
1059988806 9:119845057-119845079 CTTACACGTCTCATGCAGTCTGG - Intergenic
1061336627 9:129942324-129942346 TTTACACATCTGTAGCTGTGTGG - Intronic
1192570860 X:72203241-72203263 CCTACACATCTCTTCCATTTGGG + Intronic
1194513264 X:94821060-94821082 CTTACACTTCTTTAGCTGTAAGG + Intergenic
1194953154 X:100150863-100150885 CTTACTCAAATCAAGCAGTTCGG - Intergenic
1199385154 X:147214800-147214822 CTGACTCTTCTCTAGTAGTTTGG - Intergenic