ID: 1147383256

View in Genome Browser
Species Human (GRCh38)
Location 17:40068061-40068083
Sequence GCAGCCATGAGAACTAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 3, 3: 11, 4: 165}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147383256_1147383264 21 Left 1147383256 17:40068061-40068083 CCAACTCTAGTTCTCATGGCTGC 0: 1
1: 1
2: 3
3: 11
4: 165
Right 1147383264 17:40068105-40068127 GAGAACTGTTGTGTCTCTTGGGG 0: 1
1: 0
2: 1
3: 19
4: 173
1147383256_1147383259 -9 Left 1147383256 17:40068061-40068083 CCAACTCTAGTTCTCATGGCTGC 0: 1
1: 1
2: 3
3: 11
4: 165
Right 1147383259 17:40068075-40068097 CATGGCTGCAAAGGTGTCTAGGG 0: 1
1: 0
2: 2
3: 21
4: 232
1147383256_1147383263 20 Left 1147383256 17:40068061-40068083 CCAACTCTAGTTCTCATGGCTGC 0: 1
1: 1
2: 3
3: 11
4: 165
Right 1147383263 17:40068104-40068126 GGAGAACTGTTGTGTCTCTTGGG 0: 1
1: 0
2: 2
3: 31
4: 305
1147383256_1147383266 25 Left 1147383256 17:40068061-40068083 CCAACTCTAGTTCTCATGGCTGC 0: 1
1: 1
2: 3
3: 11
4: 165
Right 1147383266 17:40068109-40068131 ACTGTTGTGTCTCTTGGGGAGGG 0: 1
1: 1
2: 0
3: 25
4: 222
1147383256_1147383260 -8 Left 1147383256 17:40068061-40068083 CCAACTCTAGTTCTCATGGCTGC 0: 1
1: 1
2: 3
3: 11
4: 165
Right 1147383260 17:40068076-40068098 ATGGCTGCAAAGGTGTCTAGGGG 0: 1
1: 0
2: 0
3: 19
4: 157
1147383256_1147383265 24 Left 1147383256 17:40068061-40068083 CCAACTCTAGTTCTCATGGCTGC 0: 1
1: 1
2: 3
3: 11
4: 165
Right 1147383265 17:40068108-40068130 AACTGTTGTGTCTCTTGGGGAGG 0: 1
1: 1
2: 1
3: 15
4: 196
1147383256_1147383258 -10 Left 1147383256 17:40068061-40068083 CCAACTCTAGTTCTCATGGCTGC 0: 1
1: 1
2: 3
3: 11
4: 165
Right 1147383258 17:40068074-40068096 TCATGGCTGCAAAGGTGTCTAGG 0: 1
1: 0
2: 1
3: 25
4: 257
1147383256_1147383267 28 Left 1147383256 17:40068061-40068083 CCAACTCTAGTTCTCATGGCTGC 0: 1
1: 1
2: 3
3: 11
4: 165
Right 1147383267 17:40068112-40068134 GTTGTGTCTCTTGGGGAGGGAGG 0: 1
1: 0
2: 0
3: 24
4: 366
1147383256_1147383262 19 Left 1147383256 17:40068061-40068083 CCAACTCTAGTTCTCATGGCTGC 0: 1
1: 1
2: 3
3: 11
4: 165
Right 1147383262 17:40068103-40068125 TGGAGAACTGTTGTGTCTCTTGG 0: 1
1: 0
2: 2
3: 21
4: 194
1147383256_1147383261 -1 Left 1147383256 17:40068061-40068083 CCAACTCTAGTTCTCATGGCTGC 0: 1
1: 1
2: 3
3: 11
4: 165
Right 1147383261 17:40068083-40068105 CAAAGGTGTCTAGGGGACTTTGG 0: 1
1: 0
2: 0
3: 16
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147383256 Original CRISPR GCAGCCATGAGAACTAGAGT TGG (reversed) Intronic
901139594 1:7019851-7019873 GCTTCCATGAGAGCTGGAGTCGG - Intronic
904700190 1:32353335-32353357 GCAGCCTCCTGAACTAGAGTTGG - Intronic
904940968 1:34164755-34164777 GCAGGGATGAGAATGAGAGTAGG + Intronic
905159932 1:36023439-36023461 GCAGCCCTTAGAACCAGAATAGG + Intronic
908791985 1:67791886-67791908 GCAGCTATGAGAACTGGCCTTGG + Intronic
910464895 1:87488203-87488225 ACAGCCATGTGACCTTGAGTGGG + Intergenic
911072259 1:93841551-93841573 CCAGCCATGAGATCTGGAATTGG + Intronic
911603375 1:99871576-99871598 GCAGAAAACAGAACTAGAGTAGG + Intronic
912164095 1:107021743-107021765 GCAACCATGTGATTTAGAGTAGG - Intergenic
913079146 1:115365711-115365733 TCAGCAATGAGAATCAGAGTGGG - Intergenic
915322044 1:155061543-155061565 GCAGGGATGAGAACTGCAGTTGG - Intronic
917844157 1:179006416-179006438 ACAGGCATGAGAAATAAAGTGGG + Intergenic
920501403 1:206487705-206487727 TAAGCCATGAGAACGAGAGACGG + Intronic
1063151578 10:3341706-3341728 GCAACCATGGGACCTTGAGTTGG - Intergenic
1067778093 10:49177304-49177326 GCTGCCCTGGGAACTAGAGAGGG - Intronic
1069359695 10:67627349-67627371 GAACCCAGGACAACTAGAGTAGG + Intronic
1070788912 10:79178250-79178272 GCGGCCATGAGCACTCGAATGGG - Intronic
1071341983 10:84657902-84657924 GCAACCAAGAGGACTTGAGTAGG - Intergenic
1075238026 10:120749446-120749468 GCAGCCCTCAGAACTACAGCAGG - Intergenic
1075378805 10:122001344-122001366 GCAGGCAAGAGAACTTGTGTAGG + Intronic
1075949240 10:126462852-126462874 ACAGCCATGAAAACTCCAGTTGG - Intronic
1078587910 11:12610078-12610100 GCAGCCAGTGGAACTAGAGAGGG + Intergenic
1079889943 11:26039370-26039392 ACAGCCTTGAAAACTAGAGATGG + Intergenic
1080055997 11:27907317-27907339 GCAGGAAAGAGCACTAGAGTAGG - Intergenic
1081582989 11:44365213-44365235 GCAGCCATCAGAACCAGGCTGGG - Intergenic
1082661704 11:55920174-55920196 GCAGAGAGGAGACCTAGAGTGGG - Intergenic
1083103714 11:60336912-60336934 GTAGAAATGAGAACCAGAGTGGG + Intronic
1083368998 11:62163571-62163593 GCAGGCATGAGAAGGAAAGTGGG + Intergenic
1083397504 11:62401744-62401766 GGCTCCATGAGAACAAGAGTTGG + Intergenic
1084790585 11:71473172-71473194 GCAGCCACAAGAGCTGGAGTTGG - Intronic
1086425425 11:86678022-86678044 GCAGCCATGAAAATAAGAGCTGG - Intergenic
1086813120 11:91335483-91335505 GCAGCCATGAGTGCAAGAGCTGG + Intergenic
1090355953 11:126140472-126140494 GAAGGCATGAGAGCTAGAGGGGG + Intergenic
1090948419 11:131451724-131451746 GGAGCCACGAGAACTAGTGCTGG + Intronic
1092051062 12:5470574-5470596 GCAGCCATGGGAAGAAGAGGTGG - Intronic
1095440610 12:42235917-42235939 GGAACCCTGAGAAATAGAGTAGG - Intronic
1097515077 12:60594522-60594544 GTAGCCATGGGAACTAGAGTGGG - Intergenic
1100973857 12:100100361-100100383 GCAGCCCTGAGAACCAGAAAAGG - Intronic
1101273671 12:103175881-103175903 GCAGCCAGGATAACTACAGCTGG + Intergenic
1104056424 12:125234368-125234390 TCAGCCCTGTGAACTAGAGAAGG + Intronic
1104459962 12:128947188-128947210 TCAGCCAGGAGAACTATACTGGG - Intronic
1106410999 13:29511498-29511520 GCAGGGATGATAAGTAGAGTGGG + Exonic
1106943887 13:34803839-34803861 GCATCCATCAAAACTAGAGTTGG + Intergenic
1106960851 13:34995532-34995554 GCAGCCCTCAGAACTAGAACAGG + Intronic
1112007580 13:95267341-95267363 GCAGACAAGAGAACTTGTGTAGG - Intronic
1117719386 14:58614328-58614350 ACAGCCATGAGAGCTATAGAAGG - Intergenic
1119388846 14:74276555-74276577 GCTGCCAGGACAGCTAGAGTGGG + Intergenic
1121421903 14:93821879-93821901 GCAGGCAAGAGAACTTGTGTAGG - Intergenic
1121450329 14:94002979-94003001 GCAGGCAAGAGAACTTGTGTAGG + Intergenic
1123856889 15:24421754-24421776 GCAGCCTTGGGACCTAGAGTGGG + Intergenic
1123861448 15:24471651-24471673 GCAGCCTGGAGACCTAGAGTGGG + Intergenic
1126904746 15:53352432-53352454 GAAGTCCTGAGAACTAGGGTGGG + Intergenic
1127474713 15:59322584-59322606 GAAGCCATGAGAGCCAGAGATGG + Intronic
1129330403 15:74824164-74824186 GCAGCCATGGGAGCTGGGGTGGG + Intronic
1130511253 15:84591242-84591264 GCAGTCATGAGAAGGAAAGTTGG - Intergenic
1131748592 15:95479495-95479517 GCAGCCAGGAGGCCTAGCGTTGG + Intergenic
1132998044 16:2834025-2834047 GCAGCCGTTAGAGGTAGAGTTGG + Intronic
1133735426 16:8611364-8611386 GCAGCCAGGATAATTAGAGATGG + Intergenic
1134633407 16:15773701-15773723 GCAGCCATGAGAAATAAACAAGG - Intronic
1140020555 16:71234232-71234254 GCAGACAAGAGACCTACAGTTGG - Intergenic
1140136183 16:72207540-72207562 GCAGCATTGAGAATTAGAGGAGG + Intergenic
1140210042 16:72962487-72962509 GCAGCCATGAGGACACGGGTCGG + Intronic
1143360943 17:6370651-6370673 GGATCCATGAGAATTATAGTGGG + Intergenic
1144140817 17:12346121-12346143 GATGCAATGAGAACTTGAGTGGG + Intergenic
1144553354 17:16260548-16260570 GCAGACAGGAGACCTGGAGTGGG - Intronic
1146434937 17:32835615-32835637 GCATCCATGTGAACAAGAGTAGG - Intronic
1146605800 17:34256620-34256642 GCTGCCATGGGAGCTAGAGGAGG - Intronic
1147383256 17:40068061-40068083 GCAGCCATGAGAACTAGAGTTGG - Intronic
1148602174 17:48902643-48902665 TCAGCCATGAGAACCAGAGGAGG + Intergenic
1148682551 17:49483044-49483066 GCAGTAATGAGAACCAGAGAAGG + Intergenic
1160461243 18:79040390-79040412 GCAGCCATGTGATCTTGAGCAGG - Intergenic
1160891716 19:1382282-1382304 GCAGCTATGAGAACTAGAGAAGG + Intergenic
1161742889 19:6034816-6034838 GCAGCCCTCAGAACTAGAAAAGG - Intronic
1163397057 19:17069880-17069902 GCAGCCATCAGGACTGGAGGTGG - Intronic
1166336893 19:42113783-42113805 GCAGGCATGAGAAGTGGACTGGG + Intronic
1166653857 19:44595858-44595880 GCAGCCAGGAGGACTTGAGTGGG + Intergenic
1167105738 19:47429191-47429213 TCAGCCATGAGAACCAGCTTTGG - Exonic
1168300588 19:55402633-55402655 GCAGTGATGAGAATTAGGGTGGG - Intronic
924993952 2:340364-340386 GGGGCCATGAGAACTAGGATGGG + Intergenic
925069863 2:957769-957791 GCAGCCACCAGAGCTAGAGGAGG + Intronic
925083316 2:1087233-1087255 ACAGCCATGAGGACAAGAGCAGG - Intronic
928942036 2:36735882-36735904 GCAACCTTGAGAACCAGAGGTGG + Intronic
929321712 2:40551555-40551577 GCAGACATGAGAAGAATAGTAGG + Intronic
932160310 2:69453833-69453855 GCAGCCCCCAGAACCAGAGTAGG - Intergenic
933765565 2:85706342-85706364 GCAGGCATGAGAACTAAGCTTGG - Intergenic
935998036 2:108795481-108795503 GCATCCACGAGAAGTAGAGAAGG + Intronic
936550316 2:113432768-113432790 GCAGCCCCCAGAACCAGAGTAGG + Intergenic
943064137 2:183069396-183069418 GCAGAGATGAGACCCAGAGTGGG - Intergenic
943154383 2:184154624-184154646 ACAGCCATGAGCCCTAAAGTGGG - Intergenic
943345601 2:186734228-186734250 GCAGAGAGGAGACCTAGAGTGGG + Intronic
943379172 2:187121295-187121317 ACAGCCTTGAGAAACAGAGTGGG + Intergenic
943932201 2:193868412-193868434 GCAGTGAGGAGACCTAGAGTGGG - Intergenic
1169294862 20:4386437-4386459 GCAGAGAAGAGAAATAGAGTAGG + Intergenic
1170143823 20:13151523-13151545 TCATCCTTGAGAACTGGAGTTGG + Intronic
1170517215 20:17143160-17143182 AAAGCCATGATAACTAGAGAAGG - Intergenic
1178608625 21:34060464-34060486 GCAGCCATGAATACTGGAGTTGG - Intergenic
1183483921 22:38079217-38079239 GAAGCCTTGAGAAATAGAGAAGG - Intronic
1183580969 22:38726513-38726535 GCAGCCATGAGGACTAGAGTGGG - Intronic
951526961 3:23662655-23662677 GGAGCCATGAGAACTGGAATCGG + Intergenic
954150296 3:48654024-48654046 GCGGACATGAGAACAAGGGTTGG + Intronic
954422923 3:50428055-50428077 GCAGCCATGAGAGCCACAGCAGG - Intronic
956495397 3:69820443-69820465 GTAGCAATGAAAACAAGAGTAGG + Intronic
956906999 3:73776803-73776825 GAAGCCATGACAGCTAGAGCTGG + Intergenic
957015003 3:75053107-75053129 GCAGCCATGAGAACAAGCCTGGG + Intergenic
957963836 3:87295836-87295858 GGAGCCATGGGAAATACAGTAGG - Intergenic
958880047 3:99659313-99659335 GCAGCCGTGAGAAGTTAAGTGGG - Intronic
960919049 3:122728025-122728047 TCAGCCATGAGAGCCCGAGTTGG + Intronic
964457762 3:156886520-156886542 GCAGCCAGCAGAATTGGAGTGGG - Intronic
964651626 3:159017700-159017722 TCAGCCATGAGATTTTGAGTAGG + Intronic
965015692 3:163153911-163153933 GCAGCCAGCAGAACTAGGGAGGG - Intergenic
967016830 3:185489828-185489850 GAAGCCTTGATAACGAGAGTGGG - Exonic
971252107 4:24981656-24981678 GCAGACAAGAGAACTTGTGTTGG - Intergenic
972792623 4:42387552-42387574 GCACCCATGAAAGCCAGAGTGGG + Intergenic
975374796 4:73631462-73631484 GCAGCCATGAGCACGGGAGCTGG + Intergenic
976277044 4:83288605-83288627 GCAGGCAAGAGAACTTGTGTAGG - Intergenic
976748444 4:88429652-88429674 TCAGCCATGAGAGGAAGAGTTGG + Intronic
978326261 4:107560633-107560655 GCAGCCATCTGAGCCAGAGTAGG - Intergenic
979169996 4:117589867-117589889 GCAGCCATCTGAGCCAGAGTAGG + Intergenic
980338123 4:131501740-131501762 GCAACCATTAGAACCAGACTCGG + Intergenic
981207714 4:142063325-142063347 CAAGCCATGAGAATTAGAGAGGG + Intronic
981923962 4:150117441-150117463 GCAGCCATGAGCACAGGAGCTGG - Intronic
982112618 4:152070725-152070747 GCAGACTAGAAAACTAGAGTAGG - Intergenic
982352136 4:154427509-154427531 GCAGCCCTCAGAACCAGAATAGG - Intronic
982604865 4:157502138-157502160 GAATCCATGAAAAGTAGAGTAGG - Intergenic
985050144 4:185982096-185982118 GCAGCCTTCAGAGCCAGAGTAGG - Intergenic
985525416 5:399002-399024 GCAGCCATGAGGCCGAGAGGTGG - Intronic
986160087 5:5219675-5219697 CCAGCCTTGAGGACTGGAGTTGG + Intronic
989462137 5:41712996-41713018 GGAGACAGGACAACTAGAGTAGG + Intergenic
992048110 5:72917700-72917722 ACATCCATGAGAAGTAGAGTAGG + Intergenic
994208290 5:97060172-97060194 GCAGCCAGCAGAACTAGGGAGGG - Intergenic
994577896 5:101604342-101604364 GCAACCATGTGATCCAGAGTTGG + Intergenic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
998758542 5:145406988-145407010 GCAGCCAGCAGAATTAGGGTGGG + Intergenic
1000874943 5:166625473-166625495 GCAGGCATGAGAACTTAGGTGGG + Intergenic
1003024480 6:2542031-2542053 GGAGTCATGAGGACTATAGTGGG + Intergenic
1005404877 6:25475907-25475929 GCCCACATGAGAACTAGAGGTGG + Intronic
1005691877 6:28314383-28314405 GCAGGCATGAGAGCTAAAGGTGG + Intergenic
1007254608 6:40520183-40520205 GCAACCATGAGAACTGTAGCAGG + Intronic
1007521604 6:42454456-42454478 GCTGCCAGGAGACCTAGGGTAGG - Intergenic
1011341986 6:86326222-86326244 GCAGCCTCCAGAATTAGAGTAGG - Intergenic
1011595394 6:89011239-89011261 GCAGCAATGAGAAATATAGATGG - Intergenic
1012147443 6:95703320-95703342 GCAGCCCTCAGAACCAGACTAGG - Intergenic
1014432161 6:121383871-121383893 TTAGACTTGAGAACTAGAGTTGG + Intergenic
1014699495 6:124666108-124666130 GTACACAGGAGAACTAGAGTTGG - Intronic
1022093598 7:27124104-27124126 GCAGCCATGAATATTAGACTTGG - Intronic
1023673699 7:42606936-42606958 GCATTCATGAGAGCTAGAGAAGG - Intergenic
1023771175 7:43558068-43558090 CCACCCATGAGAACTGGAGATGG + Intronic
1032059290 7:128710609-128710631 GAAGCCATAAGAAGTAGAGCTGG - Intronic
1034308215 7:150063849-150063871 GCAGACATCAGAGTTAGAGTTGG + Intergenic
1034798638 7:154036822-154036844 GCAGACATCAGAGTTAGAGTTGG - Intronic
1036676476 8:10838140-10838162 GCAGCCTTCAGAACTAGAACCGG - Intronic
1036801002 8:11791972-11791994 GCAGCCCTTTGAACCAGAGTAGG + Intergenic
1040796288 8:51292842-51292864 TCAACCAAGAGAACTAGTGTTGG - Intergenic
1042103393 8:65298015-65298037 GCAGCCATGAGAACTAAAGCAGG - Intergenic
1042281598 8:67062119-67062141 GCAGCCATGACACCTAGAACCGG + Exonic
1044787361 8:95808797-95808819 GTAGGGATGAGAACTGGAGTTGG - Intergenic
1046482067 8:114835179-114835201 AAAGAAATGAGAACTAGAGTGGG + Intergenic
1046560120 8:115825629-115825651 GCAGCCATGAGGACAGCAGTTGG - Intergenic
1049902623 9:184052-184074 GCAGCCCCCAGAACCAGAGTAGG - Intergenic
1050005230 9:1122534-1122556 GCAGAAATGAGAAGTAGAGTGGG + Intergenic
1051642127 9:19233009-19233031 GCAGCCTCCAGAACCAGAGTAGG - Intronic
1052342109 9:27374140-27374162 GCAGCCCTGAGAACCAGAACAGG - Intronic
1052759441 9:32574849-32574871 GCAGCCCTCAGAACCAGAGGAGG - Intergenic
1053745647 9:41194338-41194360 GCAGCCCCCAGAACCAGAGTAGG - Intronic
1054481624 9:65670876-65670898 GCAGCCCCCAGAACCAGAGTAGG + Intronic
1054682695 9:68236933-68236955 GCAGCCCCCAGAACCAGAGTAGG + Intronic
1056021446 9:82442002-82442024 GCTGGCATGAGATCTAGGGTGGG + Intergenic
1056771128 9:89479074-89479096 GCAGCCATGGGAGCTCCAGTGGG - Intronic
1061477763 9:130880443-130880465 GCAGCCATCAGTACTGGTGTTGG - Intronic
1202781780 9_KI270718v1_random:5119-5141 GCAGCCCCCAGAACCAGAGTAGG - Intergenic
1186219313 X:7332610-7332632 GCAGGCATGAGAATTAGACCAGG - Intronic
1188638058 X:32460586-32460608 GAAGCCAGGAGAAAAAGAGTGGG - Intronic
1188808537 X:34622266-34622288 GTAGTCAAGAGAACAAGAGTGGG - Intergenic
1194093563 X:89606738-89606760 GCAGGCAAGAGAACTTGTGTAGG - Intergenic
1195720536 X:107863472-107863494 ACAGAAATGAGAACTAGAGGAGG - Intronic
1195767986 X:108317021-108317043 GCTGCCATGTGAACTGTAGTGGG + Intronic
1197869860 X:131054532-131054554 GCACCCAAAAGAAGTAGAGTGGG + Intergenic
1200446192 Y:3262840-3262862 GCAGGCAGGAGAACTTGTGTAGG - Intergenic
1200933595 Y:8719251-8719273 GCAACCCTGAGAAATACAGTGGG + Intergenic
1201430386 Y:13896726-13896748 GCTGCCATGGGAACTAGAAAGGG - Intergenic
1201631753 Y:16077658-16077680 TCAGCCAGGAGATCTAGTGTTGG + Intergenic