ID: 1147385285

View in Genome Browser
Species Human (GRCh38)
Location 17:40077496-40077518
Sequence AGGGATATACCCTGGGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147385285_1147385295 17 Left 1147385285 17:40077496-40077518 CCTTCCTCCCAGGGTATATCCCT 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1147385295 17:40077536-40077558 CGAGCAGTGTGTCGTGTGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 137
1147385285_1147385294 16 Left 1147385285 17:40077496-40077518 CCTTCCTCCCAGGGTATATCCCT 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1147385294 17:40077535-40077557 ACGAGCAGTGTGTCGTGTGTGGG 0: 1
1: 0
2: 0
3: 5
4: 56
1147385285_1147385293 15 Left 1147385285 17:40077496-40077518 CCTTCCTCCCAGGGTATATCCCT 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1147385293 17:40077534-40077556 GACGAGCAGTGTGTCGTGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 81
1147385285_1147385296 23 Left 1147385285 17:40077496-40077518 CCTTCCTCCCAGGGTATATCCCT 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1147385296 17:40077542-40077564 GTGTGTCGTGTGTGGGGACAAGG 0: 1
1: 0
2: 1
3: 27
4: 391
1147385285_1147385297 30 Left 1147385285 17:40077496-40077518 CCTTCCTCCCAGGGTATATCCCT 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1147385297 17:40077549-40077571 GTGTGTGGGGACAAGGCAACTGG 0: 1
1: 0
2: 4
3: 11
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147385285 Original CRISPR AGGGATATACCCTGGGAGGA AGG (reversed) Exonic
900134993 1:1112830-1112852 AAGGAAGTACCCTTGGAGGAGGG - Intronic
901103373 1:6736572-6736594 AGCAATATACCCTGGGGGGCCGG - Intergenic
901422978 1:9163276-9163298 AAGGCTGTACCCTGGGAGGTTGG - Intergenic
901529249 1:9843244-9843266 AGGGTTCTACCCTGGGATGCAGG + Intergenic
901618899 1:10565391-10565413 AGGGCTATACCCTAGGAACATGG - Intronic
902784792 1:18725870-18725892 AAGGATCTGCCCTGGGATGAGGG + Intronic
903693840 1:25193188-25193210 AGGGCTTCACCCTGGAAGGAGGG + Intergenic
903699380 1:25235245-25235267 AAGGACATTCCCTGTGAGGAAGG - Intergenic
904465618 1:30705524-30705546 AGGGATTTCCCCATGGAGGAAGG + Intergenic
906854420 1:49288770-49288792 AGGGCTATGCCCTTGGAGTAAGG + Intronic
908443203 1:64176217-64176239 AGGGATATACGTTGGTATGAAGG + Intronic
909564963 1:77044068-77044090 AGGGATATACTCTGACATGATGG + Intronic
909819298 1:80040522-80040544 AGTGTTATACCATGGGAGTAAGG - Intergenic
910500051 1:87880151-87880173 AGGGAGAGAACCAGGGAGGAAGG - Intergenic
911470322 1:98310170-98310192 AGGGAAGCACCATGGGAGGAGGG - Intergenic
912245206 1:107954752-107954774 AGGAAAATACCATGGGAGGGGGG + Intronic
913161460 1:116149734-116149756 AGGGAGAGAGCATGGGAGGAGGG - Intergenic
913170862 1:116230980-116231002 ATGAAGACACCCTGGGAGGAGGG + Intergenic
913176252 1:116275777-116275799 GGGGAAACACCCTGGGAAGAAGG - Intergenic
915167714 1:153957973-153957995 TGGGGTATGGCCTGGGAGGAGGG - Intronic
915256721 1:154637158-154637180 AGGGCTATATCCTAGGAGTAAGG + Intergenic
915553958 1:156651045-156651067 AGAGATATTCCCTAGGGGGAGGG - Intronic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920365847 1:205448074-205448096 AGGGAGATTCCCTCTGAGGAAGG - Intronic
921489915 1:215762808-215762830 AGGGAAGTAACCTAGGAGGATGG + Intronic
922708359 1:227805820-227805842 ATGGATGTACCCTAGGAGTAAGG - Intergenic
923251792 1:232184949-232184971 AGGGATATAAACTGGGAAGTGGG + Intergenic
1064007368 10:11709272-11709294 AGGGATATCCCCTGCTAGGTGGG + Intergenic
1064072420 10:12242228-12242250 ACAGAGATGCCCTGGGAGGAGGG - Intronic
1067107698 10:43376759-43376781 CAGGATATTTCCTGGGAGGAGGG - Intergenic
1070848808 10:79546040-79546062 AGGGATATCACCTGGGAGGAAGG - Intergenic
1073057709 10:100713017-100713039 AGGGACACATTCTGGGAGGAAGG + Intergenic
1073142852 10:101260707-101260729 AGAGAAAGAGCCTGGGAGGATGG - Intergenic
1073528272 10:104206737-104206759 AGATGTAGACCCTGGGAGGAGGG - Intronic
1078108145 11:8371551-8371573 AGGGAGAAAGCATGGGAGGAAGG + Intergenic
1078164009 11:8867084-8867106 AGGAATATCCCCTAGCAGGAGGG - Intronic
1089193812 11:116679119-116679141 AGGGACAACCCCTGGGAGCAGGG + Intergenic
1089601957 11:119621891-119621913 AGGGCTAGACGCTGGGAAGATGG + Intergenic
1091804616 12:3346849-3346871 CTGGGTATACCCTGGAAGGAAGG - Intergenic
1091937740 12:4446460-4446482 AGGGATAAATCCAGGGAGAATGG - Intergenic
1093267447 12:17020312-17020334 AGGGAGAGACACAGGGAGGAAGG - Intergenic
1094069919 12:26401871-26401893 TGGGATACACCTTGAGAGGAGGG + Intronic
1094192091 12:27708290-27708312 AAGGAAATACACTGGGAAGAGGG - Intergenic
1094222929 12:28013715-28013737 AGGGAGATCCACTGGGAGAATGG - Intergenic
1099408662 12:82295419-82295441 AGGGAAAAACCCTGAGAGGCTGG - Intronic
1100062325 12:90595504-90595526 AGGGATATATTATGGGAGGGAGG + Intergenic
1100150363 12:91729263-91729285 GTGGATAGACCATGGGAGGAAGG + Intergenic
1101464048 12:104929480-104929502 AGGGTTCTACCCTGGGATTATGG - Intronic
1103832324 12:123789686-123789708 AGGGACATGGCCTTGGAGGAGGG + Intronic
1106777145 13:33019526-33019548 AAGGAGATCCCCTGGGATGATGG + Intronic
1111173117 13:84555865-84555887 AGGCATATATCGTGGGAGAAGGG + Intergenic
1114014710 14:18416919-18416941 AGGGATACACTCTGAAAGGAGGG + Intergenic
1114714409 14:24809098-24809120 GGAGATATTTCCTGGGAGGAGGG - Intergenic
1120308517 14:82801291-82801313 AGGGATATGCCCTGGGATGTTGG - Intergenic
1122154881 14:99744264-99744286 AGGGACCTGCCCTGGGAGCAGGG - Intronic
1124173702 15:27402536-27402558 AGAAATATATCCTGGGAGTAAGG + Intronic
1126851551 15:52799985-52800007 AGGGATTTTTCCTGGGTGGAAGG - Intergenic
1127203629 15:56687799-56687821 AGGGCTATACTCTGAGAGTAAGG + Intronic
1127665750 15:61145465-61145487 AGGAAAATACCCTGGGAGGTAGG - Intronic
1129635458 15:77311969-77311991 AGGGATGAACACTGGGAGTAGGG + Intronic
1129845755 15:78767072-78767094 AGGGGCTTACCCTGGGAGGCAGG + Intronic
1131842474 15:96452149-96452171 AGGGTTATATACTAGGAGGATGG - Intergenic
1133944030 16:10333737-10333759 AAGGAGACACCCTGGGAGGAAGG + Intronic
1136555822 16:31007337-31007359 GCGGAGACACCCTGGGAGGAAGG - Intronic
1136577546 16:31133383-31133405 AGGGAGCTGCCCAGGGAGGAAGG + Exonic
1136636569 16:31528076-31528098 GGGGAAATACCCAGTGAGGAGGG + Intronic
1138194871 16:55044637-55044659 AGGGATATACCCTAGATGGAGGG - Intergenic
1138440140 16:57029458-57029480 AGGCATAAGCCCTGGGAGCAGGG + Intronic
1139265174 16:65631684-65631706 AACGATATGCACTGGGAGGATGG - Intergenic
1140274119 16:73493670-73493692 AGGGAAAGACCTTGGAAGGAAGG - Intergenic
1141436742 16:84003969-84003991 AGGGACCTGCCCTGGGAGCAGGG - Intergenic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141723068 16:85767616-85767638 AGGGAGGTACCCGGGGAGGATGG - Intergenic
1143620237 17:8076334-8076356 AGGGACATGCCCTGTGAGGAAGG + Exonic
1145230493 17:21170161-21170183 AGGGATAAACAGTGGGAGGCAGG - Intronic
1146357075 17:32142982-32143004 AGGGACATGGCTTGGGAGGACGG - Intronic
1147178355 17:38670506-38670528 AGGGCCATACCATGGGAGAATGG + Intergenic
1147385285 17:40077496-40077518 AGGGATATACCCTGGGAGGAAGG - Exonic
1148147630 17:45376066-45376088 GGGGATAGACCCTGGGATAAAGG - Intergenic
1148758549 17:49987375-49987397 AGGGAAGAACCCAGGGAGGAGGG + Intergenic
1148822480 17:50367619-50367641 AGGGCTGGGCCCTGGGAGGAGGG - Intergenic
1150727911 17:67666533-67666555 AGTAATATGCCCTGGCAGGAAGG - Intronic
1151733181 17:75922962-75922984 AGGGACATACCCAAGAAGGAGGG - Intronic
1152291133 17:79440837-79440859 AGGGACAAACCCTGGGTGAAGGG - Intronic
1154522950 18:15249766-15249788 AGGGATACACTCTGAAAGGAGGG - Intergenic
1158672712 18:59491329-59491351 ATGGATCCACCCTGTGAGGAAGG - Intronic
1159272972 18:66176718-66176740 AGGGATAAACCATGGGATGATGG - Intergenic
1159943354 18:74425826-74425848 AGGGGTATTCCCGGGGAGGAGGG - Intergenic
1162865514 19:13543202-13543224 AGGAACATTCCCTGGGAAGATGG - Intronic
1163382852 19:16980113-16980135 AAGGAAGTCCCCTGGGAGGAGGG + Intronic
1163386258 19:17002022-17002044 AGGGAGATACTCTAGGGGGAGGG + Intronic
1164602046 19:29568677-29568699 AGGGGCATAGCCTGGAAGGAAGG + Intergenic
1165521119 19:36314765-36314787 AAGGACAGTCCCTGGGAGGAAGG + Intergenic
1165622949 19:37263823-37263845 AAGGACAGTCCCTGGGAGGAAGG - Intergenic
1166224769 19:41388101-41388123 AGGGCTATACCCAGGGAAGTAGG - Intronic
1166863140 19:45821161-45821183 AAGGGTAAAACCTGGGAGGAAGG + Intronic
1167092172 19:47352142-47352164 AGGGAAGGATCCTGGGAGGAGGG - Intronic
1167233770 19:48301720-48301742 AGGGATAGACCCTGGATGGATGG + Intronic
1167233780 19:48301762-48301784 AGGGATAGACCCTGCATGGATGG + Intronic
1167233834 19:48302057-48302079 AGGAATAGACCCTGGATGGATGG + Intronic
1167466659 19:49653812-49653834 AGGGACATAGACTGGGAGGGTGG + Intronic
925550205 2:5065535-5065557 AGTGATCTACACAGGGAGGAGGG - Intergenic
925905301 2:8536457-8536479 AGGGGTCTGCCCAGGGAGGAAGG - Intergenic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
929587674 2:43126632-43126654 AGGGACCTGCTCTGGGAGGAAGG - Intergenic
931294932 2:60913511-60913533 AGAGCTATACCCTAGGAGTAAGG - Intronic
931930143 2:67122704-67122726 AGAGAGATACCATGGCAGGATGG + Intergenic
933165732 2:79072563-79072585 AGGGAAGGACCCTGGGAGGAGGG + Intergenic
935268429 2:101413872-101413894 AGGGCTCTGCACTGGGAGGATGG + Intronic
936432094 2:112473578-112473600 AGGGAAAGGCCCTGGAAGGAAGG - Intergenic
936511852 2:113154861-113154883 AGGGATATACCCTAGAATTAGGG - Intergenic
938522238 2:132082612-132082634 AGGGATACACTCTGAAAGGAGGG - Intergenic
939014434 2:136885889-136885911 AGGGATATGCAGTGGGAGCAGGG + Intronic
941082479 2:161078002-161078024 AGGGTGCTGCCCTGGGAGGAGGG + Intergenic
941109661 2:161405193-161405215 AGGGAAAAACCATGGGAGAATGG - Intronic
942042365 2:172079223-172079245 AGTGATCTACCCATGGAGGAGGG + Exonic
946037777 2:216757490-216757512 GGGCTTTTACCCTGGGAGGATGG - Intergenic
946397825 2:219452081-219452103 AGGGAAATGCCATGGGAGGATGG - Intronic
947732450 2:232438959-232438981 AGGCACAGACCCAGGGAGGAGGG + Intergenic
1170771676 20:19338282-19338304 AGAGACAAACCCTGGGAGGCAGG - Intronic
1171040007 20:21754259-21754281 AGGGATGAACCCTAGGAGTAAGG - Intergenic
1173353407 20:42265192-42265214 TGGGAAATACCATGGCAGGATGG - Intronic
1175271345 20:57736234-57736256 AAAAATATTCCCTGGGAGGAGGG - Intergenic
1175271464 20:57736940-57736962 AAAAATATTCCCTGGGAGGAGGG - Intergenic
1176774442 21:13118449-13118471 AGGGATACACTCTGAAAGGAGGG + Intergenic
1179927224 21:44541742-44541764 AGGGCTACTCCCTAGGAGGAAGG + Intronic
1180439210 22:15347726-15347748 AGGGATACACTCTGAAAGGAGGG + Intergenic
1180522064 22:16218163-16218185 AGGGATACACTCTGAAAGGAGGG + Intergenic
1183321820 22:37169651-37169673 GGGGGCAAACCCTGGGAGGAGGG - Intronic
1184974570 22:48051942-48051964 AGGGACGTCCCCTGGGAGGAGGG + Intergenic
952651915 3:35737389-35737411 AGGGAAGTACCCTGAGATGAAGG + Intronic
954069147 3:48130321-48130343 AGGGATTTACCCTAGGAGAAGGG - Intergenic
954458532 3:50612766-50612788 AGGGAGATAATCTGGGAGTAGGG + Intronic
954788004 3:53109108-53109130 AGGGCTAAAACCTGGGAGGTAGG - Intronic
954940292 3:54365921-54365943 AGGGATGTACCATGGAAAGATGG + Intronic
957306223 3:78461692-78461714 AGGGATATCCCCTCTGAGGCTGG - Intergenic
959020864 3:101186232-101186254 AGGCATATTCACTGGTAGGAAGG + Intergenic
966185358 3:177222010-177222032 TAGGAACTACCCTGGGAGGAGGG - Intergenic
967387695 3:188927454-188927476 ATGGATTTTCCCTGAGAGGATGG + Intergenic
967839257 3:193991620-193991642 AGGGATATAGGCTGTGGGGAAGG - Intergenic
970392347 4:15626468-15626490 GGAGATATACTCTGGGAAGAAGG + Intronic
971619434 4:28836302-28836324 AGTGATCAACCCTGGGAGAAAGG + Intergenic
974371847 4:61027669-61027691 AGGGATATACCCTAGTACTAAGG - Intergenic
975139309 4:70903182-70903204 AGGGAAGTCCTCTGGGAGGAAGG - Intronic
976294202 4:83453635-83453657 AAGTATATAGCCTGTGAGGAAGG + Exonic
977302142 4:95280133-95280155 AGGGATATACCTTGCGAGCAGGG - Intronic
977709286 4:100106452-100106474 AGGGACAAACACTGGGATGAGGG + Intergenic
978679131 4:111356916-111356938 AGGGATACACCCTCTGACGAGGG + Intergenic
982988855 4:162244953-162244975 AGGGAAATACACTTGGAAGAGGG - Intergenic
985665148 5:1178292-1178314 AGGGACATGCCCTGGGAGGCAGG - Intergenic
988224708 5:28398277-28398299 AGAGATTTAACTTGGGAGGAGGG + Intergenic
989184040 5:38605664-38605686 AGGGAATTTCCCTGTGAGGAAGG - Intronic
990092220 5:52065925-52065947 AGGGAAATAATCTGGGAGGATGG - Intronic
992998636 5:82357509-82357531 AGGGAAATAGTCTGGGAGGAGGG + Intronic
993795046 5:92256602-92256624 TGGGTAATACCCTTGGAGGAAGG - Intergenic
998230570 5:140359085-140359107 TGGGATCTGCCCTGTGAGGATGG - Intergenic
999890581 5:155974798-155974820 AGGGATATCCCCGTGGAGAATGG + Intronic
1001960956 5:175880210-175880232 AGGTGGATACCCTGGGATGAAGG - Exonic
1005867362 6:29946144-29946166 AGGAAAAAGCCCTGGGAGGAAGG - Intergenic
1006016535 6:31085734-31085756 AGGCATAACCCCTGGGACGATGG - Intergenic
1006024871 6:31140252-31140274 AGGGATAAACAGTGGGAGCAAGG - Intergenic
1006106209 6:31718532-31718554 AGGGAGGTTCCCTGGGAGGCTGG - Intergenic
1006738669 6:36292547-36292569 AGGGAAGTGCCCTGGCAGGAGGG - Intronic
1007690777 6:43699801-43699823 AAGGATCTCCCCTGGAAGGAAGG + Intergenic
1008949432 6:57139292-57139314 AGGGGTACAACTTGGGAGGAGGG + Intronic
1010917656 6:81640932-81640954 CATGATATACCATGGGAGGAAGG + Intronic
1013617679 6:111859969-111859991 AGGAAAATACCCTGTGAAGATGG + Intronic
1017928767 6:158934157-158934179 AGGGCTATGCCTTGGGAGTAAGG + Intergenic
1019066829 6:169309364-169309386 AATGATAGACACTGGGAGGAGGG + Intergenic
1023585529 7:41725850-41725872 AGGAGCACACCCTGGGAGGAAGG - Intergenic
1023651489 7:42373882-42373904 AAGGCCATACCCTAGGAGGAAGG + Intergenic
1024460790 7:49657402-49657424 AGGAATATTCCCTTCGAGGAGGG + Intergenic
1027969979 7:85066987-85067009 AGGGAAATACTCTAAGAGGATGG - Intronic
1030660962 7:112219151-112219173 AGAGATATCCCCTGTTAGGATGG - Intronic
1030934746 7:115571538-115571560 AGGGTTATACATTAGGAGGAAGG - Intergenic
1032254550 7:130286650-130286672 AGGGATACCCCCAGGGAGAAGGG + Intronic
1034886574 7:154803184-154803206 AGGCAGATGCCCTGGGAGGTGGG - Intronic
1035834494 8:2734013-2734035 AGGGAAATACCTAGGCAGGAAGG - Intergenic
1036181030 8:6585535-6585557 AGAGGTAAACCTTGGGAGGAGGG - Intronic
1037908733 8:22730685-22730707 AGGAAAGTGCCCTGGGAGGAGGG + Intronic
1038044789 8:23757161-23757183 AGAGAGAGACCCTGGGAGTAAGG - Intergenic
1038843368 8:31206419-31206441 ACAGATATCCCCTGGCAGGAAGG - Intergenic
1039353726 8:36792442-36792464 AGGGATAGACCCTGCGAGAAAGG + Intronic
1040815803 8:51507707-51507729 CCAGATATTCCCTGGGAGGATGG - Intronic
1041318162 8:56585318-56585340 AGAGAGAGCCCCTGGGAGGAAGG + Intergenic
1042619378 8:70688218-70688240 AGAGGTAGACCCTGGGAGAAAGG + Intronic
1044559818 8:93601912-93601934 AAGGCTATGCCATGGGAGGAGGG + Intergenic
1049300390 8:141866616-141866638 GGGGATCGTCCCTGGGAGGAGGG + Intergenic
1052973313 9:34393371-34393393 AAGGATATACTCTGGGGAGAAGG - Intronic
1059338388 9:113583477-113583499 AGGGAGATGGCCTTGGAGGAAGG + Exonic
1060624368 9:125096740-125096762 TGTGATAAACCCTGGGAGAATGG - Intronic
1061484616 9:130914056-130914078 ATGGTCATAGCCTGGGAGGAAGG - Intronic
1189701642 X:43719486-43719508 AGGAATAAACCCTGGCAGGTGGG + Intronic
1189963069 X:46343776-46343798 AGGAGAAGACCCTGGGAGGAAGG - Intergenic
1190825118 X:54010817-54010839 AGGGATAGTGCCTGGGAGGCTGG - Intronic
1193535229 X:82707062-82707084 AGGGATATTCACTGTGAGGTGGG + Intergenic
1196916105 X:120536541-120536563 AGGGGTATAACCTGGGAAGATGG + Intronic
1199944175 X:152652473-152652495 ATGGATATGCACTGGGGGGAGGG - Intronic