ID: 1147385556

View in Genome Browser
Species Human (GRCh38)
Location 17:40079356-40079378
Sequence CAGCTACCAATGCTGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147385556_1147385560 6 Left 1147385556 17:40079356-40079378 CCCTGCTTCAGCATTGGTAGCTG 0: 1
1: 0
2: 0
3: 15
4: 146
Right 1147385560 17:40079385-40079407 CAGACACCTGCCACCAAGCCTGG 0: 6
1: 337
2: 7316
3: 31105
4: 76989

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147385556 Original CRISPR CAGCTACCAATGCTGAAGCA GGG (reversed) Intronic
900851537 1:5146881-5146903 CAGGCACCAATGATTAAGCAGGG + Intergenic
901838196 1:11937600-11937622 CAGCTGCCCATGATGAAGCCCGG + Intronic
904114846 1:28154234-28154256 CAGCTTCCTATTCTGTAGCATGG - Intronic
907623462 1:56006043-56006065 CAGCTTCCAATGCTCTTGCAGGG - Intergenic
909409632 1:75335085-75335107 CAGCTCCAAATGCTTTAGCATGG + Intronic
912153605 1:106888429-106888451 AAGCTACCTATGCTGCTGCAAGG + Intergenic
912323027 1:108732369-108732391 CAGCTACCATGGATGAAGCGTGG + Intronic
913670430 1:121093180-121093202 CACCTACCATTGCTCAGGCATGG + Exonic
914022197 1:143880621-143880643 CACCTACCATTGCTCAGGCAAGG + Intergenic
914660682 1:149788550-149788572 CACCTACCATTGCTCAGGCATGG + Exonic
915845180 1:159255554-159255576 CAGCCATCAACACTGAAGCAAGG - Intergenic
916744141 1:167671335-167671357 CAGCTAACAATTCTAAATCAAGG + Intronic
917363226 1:174200141-174200163 AATGTACCAATGCTGTAGCAAGG + Intronic
921803763 1:219431435-219431457 CTGCTGACAATGTTGAAGCAGGG + Intergenic
1063077566 10:2732137-2732159 CACCAACCACTGCTGAGGCATGG + Intergenic
1063301986 10:4857711-4857733 AACCTACCAATACTGAATCATGG - Intergenic
1068197929 10:53743719-53743741 CATCTTACATTGCTGAAGCAAGG + Intergenic
1071173993 10:82901867-82901889 CAAGTACCATTGCTAAAGCATGG - Intronic
1072539820 10:96389928-96389950 CATCTAGCCAAGCTGAAGCAGGG - Intronic
1073293842 10:102426462-102426484 CAGCTGCCAAAGCTGAAACCTGG + Intronic
1073553609 10:104426473-104426495 CAGCTATCCAGGCTGAAGCTTGG + Intronic
1074161090 10:110837003-110837025 CAGGCACCAAGGCTGAATCAAGG - Exonic
1079091267 11:17481951-17481973 CAGCTGCCACTGCTGATGGAAGG + Intergenic
1079837600 11:25353236-25353258 CAGTTACAAATTTTGAAGCAAGG + Intergenic
1081090581 11:38861241-38861263 CACAGACCAATGCTAAAGCAAGG - Intergenic
1081806292 11:45892615-45892637 CAGCTCCCAAAGCAGTAGCATGG - Intronic
1082099493 11:48160598-48160620 CAGATACCAATGCTGCTTCATGG - Intronic
1084041259 11:66543956-66543978 CTGCTACCAATGCCAAAGCCAGG - Exonic
1088661393 11:112050585-112050607 AAGCTACCAAAACTGAACCAAGG - Intronic
1093305486 12:17512520-17512542 CAGCTACCATTGCTTCAGCGTGG - Intergenic
1097982378 12:65747498-65747520 CAGACAGCAATGCTGCAGCAGGG + Intergenic
1098475052 12:70891051-70891073 CAGCTACCAAAGCCACAGCATGG + Intronic
1100164580 12:91901671-91901693 CAGGTCCCAATCCTGACGCATGG - Intergenic
1100599276 12:96099047-96099069 CAGGAACAAATGCTGAAGAAGGG - Intergenic
1101410399 12:104463017-104463039 CAGATACCTCTGCTGAAGGATGG - Intronic
1102815608 12:115863217-115863239 CAGCCATCAATGCTCAAGCAGGG - Intergenic
1106723034 13:32455452-32455474 CAGCTGCCACTGCTGCTGCAGGG + Intronic
1113896756 13:113769404-113769426 CAACCACCAATGCTGAGGCCTGG + Intronic
1116760340 14:49005372-49005394 CAGATACAGATGCTGAAGCTGGG + Intergenic
1116937558 14:50757856-50757878 CTGCTCCCCTTGCTGAAGCAGGG + Exonic
1121108775 14:91297803-91297825 CAGATACCAAAGCTGTAGCATGG - Intronic
1121406417 14:93721795-93721817 GAGCTATTAATGATGAAGCAGGG + Intronic
1122582470 14:102779213-102779235 CAGCTGTCAATGCAGAAGCCAGG + Intronic
1124907543 15:33885409-33885431 CATCTACAAAGGCTGAATCATGG - Intronic
1127735600 15:61835776-61835798 CTGCTGGCAATCCTGAAGCAGGG - Intergenic
1131294935 15:91139526-91139548 CCGCTATCAATGCTGTAGTAAGG + Intronic
1133369223 16:5235348-5235370 CAGTTACGAAGGCTGAAGCCCGG + Intergenic
1134257307 16:12622861-12622883 CAGCTACTCAGGCTGAGGCAGGG - Intergenic
1135844766 16:25909003-25909025 CAGCCAGCAATGATGGAGCAAGG - Intronic
1137268913 16:46889986-46890008 CAGATTCCAAGGCAGAAGCAGGG - Intronic
1141835091 16:86533033-86533055 CAGCCAAAAATGCAGAAGCAAGG + Intronic
1146410455 17:32579179-32579201 CAGCTACTCAGGCTGAGGCAGGG - Intronic
1146555902 17:33823763-33823785 AAACTTCCAATGCTGAAGCCTGG - Intronic
1147385556 17:40079356-40079378 CAGCTACCAATGCTGAAGCAGGG - Intronic
1147520199 17:41163785-41163807 CACCAGCCAGTGCTGAAGCAGGG - Intergenic
1148902952 17:50892408-50892430 CAGCTACCGAAGCTGAAGCCTGG + Intergenic
1160521698 18:79511702-79511724 CAGCTCCCCATGCTGCAGCCAGG - Intronic
1163264026 19:16207528-16207550 CAGGCACAAATGCTGAAGGAAGG - Intronic
1167526511 19:49987606-49987628 GTGCTACCAGTGCTGAGGCAGGG + Intronic
1168386814 19:55970511-55970533 CAGATACAAATGCTGAGCCATGG - Intronic
925264080 2:2552394-2552416 CAGCCACCAAGGCTGAACCCTGG - Intergenic
926422552 2:12714641-12714663 CAGCTGCCACTGCTGGAACATGG + Intergenic
929454608 2:42057051-42057073 CAGCTACCACTGTTGAAACAGGG - Intronic
929779946 2:44951217-44951239 CAGCTTCCCAGGCTTAAGCAGGG + Intergenic
930316202 2:49799858-49799880 AAGCTAGCAAGGCTGGAGCAGGG - Intergenic
934972953 2:98777885-98777907 CAGCTCCCAGTGCTGATGCAGGG - Intergenic
935286078 2:101564711-101564733 CAGTTACCCATGCTGCAGCCAGG - Intergenic
936279533 2:111125187-111125209 CAGCTGTCAATGTTGAAACAGGG - Intronic
937715010 2:125022325-125022347 CAGATGTCAATGCTGAAACACGG + Intergenic
939623605 2:144449650-144449672 CAGCCACCAATTCTGAGTCAAGG - Intronic
941691058 2:168501218-168501240 CACCTACCCCTGCTGAATCATGG - Intronic
942809862 2:179985611-179985633 CAGCTACCAGTGATTAACCACGG + Intronic
945197999 2:207255428-207255450 GAGCTAGCAGTGATGAAGCAAGG + Intergenic
945971886 2:216238855-216238877 TAGCTACCTAGGCTTAAGCAGGG - Intergenic
946310957 2:218882408-218882430 CAGCTACCTCTGCTGAAGATGGG - Exonic
947420447 2:229937625-229937647 AAGCCAACACTGCTGAAGCAGGG - Intronic
948900019 2:240951544-240951566 CAGCTACGAATGTGGATGCATGG - Intronic
1169183206 20:3589542-3589564 CAGCAACAAATCCTGAAGGAAGG - Intronic
1169860343 20:10144695-10144717 CAGCTGCCATTACTGCAGCAAGG - Intergenic
1171106503 20:22438518-22438540 CAGCAACCCAGGCAGAAGCAAGG + Intergenic
1171312733 20:24158479-24158501 GAGCTTCCACCGCTGAAGCAAGG + Intergenic
1172991158 20:39038013-39038035 CAGGTACCCATGCTCAAGGATGG - Intronic
1175366217 20:58458014-58458036 GAGCTACGAAGGCTGAAGAAAGG - Intergenic
1176692807 21:9937392-9937414 CAGCTATGAATTCTAAAGCATGG - Intergenic
1180589967 22:16929167-16929189 CAGCTGACAATACTGAGGCAGGG - Intergenic
1181294145 22:21821640-21821662 GAGCTACAGAAGCTGAAGCACGG + Intronic
1183509446 22:38226492-38226514 CAGTGACCACTGCTGAGGCAGGG - Intronic
951443198 3:22746629-22746651 CTGCTAGGAATGCCGAAGCAGGG + Intergenic
953609980 3:44439483-44439505 CAGCTACTAATGCTGGGGCAGGG - Intergenic
955598052 3:60613311-60613333 GAGCCACCACTGCTGAGGCAGGG + Intronic
956532006 3:70231222-70231244 CAGCTAGCCATGCTCAAGGAAGG + Intergenic
960646242 3:119887583-119887605 AAACTATCAAAGCTGAAGCATGG + Intronic
963231424 3:142911817-142911839 CAGCTACCATTCCTGAAGATGGG - Intergenic
963461232 3:145617209-145617231 CACCTACCAATGAGGAAGGATGG + Intergenic
964807064 3:160621942-160621964 TAGCTACTAGTGCTGGAGCAAGG - Intergenic
968428105 4:536221-536243 CGCCTATCACTGCTGAAGCAAGG - Intronic
969922205 4:10551130-10551152 CAGTTACCCATGCTCAACCAAGG - Intronic
970488458 4:16547604-16547626 CAGCTGCCAATGCTGCAGACTGG + Intronic
972963905 4:44486490-44486512 CACCTACAACTGCTGAAGGAGGG - Intergenic
974560003 4:63505709-63505731 CAGCTCCCAATGCAGAAGGTGGG + Intergenic
974614468 4:64264484-64264506 GAACTACCAATGCTGTAGCTTGG - Intergenic
974794926 4:66736399-66736421 CAGCTGCCAATTCTGAAACAGGG - Intergenic
976318091 4:83681002-83681024 CAATTACAAATGCTGTAGCAAGG + Intergenic
977166635 4:93707412-93707434 AACCTACCAAGGTTGAAGCAGGG - Intronic
977343681 4:95791824-95791846 CACCCACCAATGCTGAGGCTTGG + Intergenic
978877619 4:113660763-113660785 CAGCTACTGCTGCTGAAGTATGG - Intronic
980365402 4:131797605-131797627 CAGCTATGAATTCTAAAGCATGG - Intergenic
985492268 5:186856-186878 CAGCTCCCAGTGCTGAGGCATGG - Exonic
986778050 5:11037339-11037361 CAGCCATCAATACTGACGCATGG - Intronic
990335796 5:54771392-54771414 CAGCTCCCAATCCTGAAGCTCGG + Intergenic
991266376 5:64723981-64724003 CACCTTCCAATGATGAAGCAAGG - Exonic
993010014 5:82470368-82470390 CTGCTACCAGTGCTGACTCATGG + Intergenic
997334771 5:133099238-133099260 CTACTACAAAGGCTGAAGCAGGG - Intronic
999515048 5:152293189-152293211 CAGCTGTCAACGTTGAAGCAAGG + Intergenic
1000302874 5:159971967-159971989 CATCTACCCATGCTCCAGCAAGG + Exonic
1002934710 6:1661798-1661820 CAGCAGGGAATGCTGAAGCAAGG - Intronic
1002976970 6:2089466-2089488 CAGCTACAAAAGTTGAAGAAGGG + Intronic
1005415243 6:25593375-25593397 GAGCCACCAATGCAGCAGCATGG - Intronic
1007960246 6:45952257-45952279 CAACTATAAATACTGAAGCAGGG - Intronic
1007992228 6:46269151-46269173 CAACTAGGAATGCTGAAGGAAGG - Intronic
1008901137 6:56617332-56617354 CAGTTCCCAGTGCTGAAGAATGG - Intronic
1010142505 6:72627478-72627500 CAGTTTCCAATGCTGCAGAAAGG + Intronic
1010660492 6:78565183-78565205 CAGCTACCAACAATGAACCATGG - Intergenic
1014648801 6:124009539-124009561 CAGCTCTCAATGCTGAGGGAGGG - Intronic
1015454044 6:133404949-133404971 CAGCTACGAATGAGTAAGCAGGG - Intronic
1016684398 6:146864897-146864919 CAGCTACACATGCTGTAGTAGGG - Intergenic
1017159430 6:151351096-151351118 CAGCTACCATTATTGAAGAAAGG + Exonic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1019063413 6:169274968-169274990 CAGCTTCCTGTGCTGATGCATGG - Intergenic
1021260181 7:18446329-18446351 CAGTGACCAATGCTGATGCATGG - Intronic
1023361848 7:39425190-39425212 CAATTACAAATGATGAAGCAGGG - Intronic
1024002022 7:45196253-45196275 CAGCTCCAAATGGTGAAGCAGGG + Intergenic
1025096424 7:56099071-56099093 CAGCTACTCAGGCTGAGGCAAGG - Intergenic
1025791227 7:64688637-64688659 CAGCTCCAAATTCTGAATCAGGG + Intronic
1026370308 7:69691778-69691800 CAGCGGCCCATGCTGCAGCAGGG - Intronic
1026889984 7:73976175-73976197 CAGCAACCATAGCTGAAGGAGGG - Intergenic
1027404026 7:77839821-77839843 CAGTTACCATTGCTAAAGGATGG - Intronic
1031066414 7:117110527-117110549 CAGCTAGCAATGGAGGAGCAGGG + Intronic
1034217676 7:149420878-149420900 CTGCATCCAATGCTGAAGCCAGG + Intergenic
1037014846 8:13890874-13890896 CTGCTACCAATGGTGTACCAAGG - Intergenic
1041753925 8:61292063-61292085 CTGCTGCCACTGCTGATGCATGG + Intronic
1044599612 8:93990845-93990867 CAGCTACCAATGATAAAGATGGG - Intergenic
1052042615 9:23756675-23756697 CAGAGACCAATGCTGAAGAGGGG + Intronic
1052722979 9:32194607-32194629 CAGCTACCACTCCTAGAGCATGG + Intergenic
1053158499 9:35796778-35796800 CACCTTCCAATGGGGAAGCAGGG + Intronic
1053629754 9:39923465-39923487 CAGCTATGAATTCTAAAGCATGG - Intergenic
1053776010 9:41540082-41540104 CAGCTATGAATTCTAAAGCATGG + Intergenic
1054214133 9:62327237-62327259 CAGCTATGAATTCTAAAGCATGG + Intergenic
1054365721 9:64338411-64338433 CAGCTATGAATTCTAAAGCATGG - Intergenic
1054673350 9:67828120-67828142 CAGCTATGAATTCTAAAGCATGG - Intergenic
1055707769 9:79025935-79025957 CAGTTACCAACCCTGCAGCATGG - Intergenic
1055979660 9:81989524-81989546 CAGTTAGCAATTCTGAAGGAGGG - Intronic
1056658373 9:88527051-88527073 CTGCTGCCAATGCTGGAGCAGGG + Intergenic
1057730517 9:97604500-97604522 CAGCTAGCAATGGTGAAGCCAGG + Intronic
1060069702 9:120535206-120535228 CACCTCCAAATGCTGAAGCTAGG + Intronic
1188746304 X:33848274-33848296 CAGATACCAATGCTGATTAAAGG + Intergenic
1188970871 X:36613577-36613599 CAGCTTCAAATGCTCAACCAGGG + Intergenic
1194852937 X:98891470-98891492 CAGCTACAGAAGCTAAAGCAGGG + Intergenic
1195573527 X:106423610-106423632 AAGGTACAAATGCTGAAGCTGGG - Intergenic
1195613167 X:106892053-106892075 CACGGACCAAGGCTGAAGCACGG + Intronic
1195905857 X:109843600-109843622 GAGCTAAGAATGGTGAAGCAGGG + Intergenic
1196090080 X:111731329-111731351 CAGTTTACAGTGCTGAAGCAGGG + Intronic