ID: 1147386202

View in Genome Browser
Species Human (GRCh38)
Location 17:40083826-40083848
Sequence CGGCGAAAGAAGCCCTGGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147386202 Original CRISPR CGGCGAAAGAAGCCCTGGGG TGG (reversed) Exonic
901040386 1:6359744-6359766 CTGGGAAAGCAGCCCTGGTGGGG - Intronic
901280069 1:8026738-8026760 GGGCCGAAGAAGCCCTGGAGGGG + Intergenic
902498065 1:16888878-16888900 CTGGGAAAGAAGCCCGGGAGCGG - Intronic
903550978 1:24157246-24157268 CTGGGAAAGCAGCCCTGAGGAGG - Exonic
905871414 1:41406596-41406618 AGCCGAAAGGAGCCCTGTGGGGG - Intergenic
905923182 1:41732536-41732558 AGGGGAAAGTAGCCTTGGGGTGG + Intronic
906319720 1:44808516-44808538 CGGCGAAAGAGGCCCTGGCTGGG - Exonic
907372875 1:54014373-54014395 GGGGGAAACAAGCCCGGGGGTGG + Intronic
913644735 1:120845127-120845149 CGGTGAAAGAAGCCGGGGAGCGG + Intergenic
914081992 1:144418456-144418478 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914095467 1:144540649-144540671 CGGGGAAAGAAGCCGGGGAGCGG + Intergenic
914099112 1:144568373-144568395 CGGGGAAAGAAGCCGGGGAGCGG + Intergenic
914176899 1:145286956-145286978 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914299875 1:146369291-146369313 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914303058 1:146393244-146393266 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914313484 1:146487436-146487458 CGGGGAAAGAAGCCGGGGAGCGG + Intergenic
914500864 1:148245945-148245967 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914531627 1:148528448-148528470 CGGGGAAAGAAGCCGGGGAGCGG - Intergenic
914636764 1:149559281-149559303 CGGGGAAAGAAGCCGGGGAGCGG + Intergenic
915351211 1:155227524-155227546 CGAGAAAAGCAGCCCTGGGGAGG + Intergenic
916761310 1:167820257-167820279 CGGCGCCAGCAGCCCTGTGGTGG - Intronic
919860870 1:201739003-201739025 CAGAGAAAGGAGCCCTGTGGGGG - Intronic
924475819 1:244381078-244381100 CGTCCCAAGGAGCCCTGGGGAGG + Intronic
1063114840 10:3066642-3066664 GGGGGGAAGAAGCCGTGGGGTGG - Intronic
1068186997 10:53598169-53598191 TGTGGAAAGAATCCCTGGGGAGG + Intergenic
1073328599 10:102656799-102656821 CGGCGTGAGCAGCTCTGGGGCGG + Exonic
1074701072 10:116093090-116093112 AGGCGAGATAAGCACTGGGGAGG - Intronic
1075614527 10:123881738-123881760 TGGGGAAAGAAGACCTGGGTGGG + Intronic
1076493665 10:130882279-130882301 CGGCCAAAGGATCCCTGGGCAGG - Intergenic
1077431973 11:2520249-2520271 AGGAGACAGAAGCCCTGGTGAGG - Intronic
1084182724 11:67454753-67454775 GGGCTAGAGAGGCCCTGGGGAGG - Intronic
1085518141 11:77123115-77123137 AGGAGAAGGAAGCCATGGGGAGG - Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096473187 12:51891347-51891369 AGGGGAAAGAAGCCCTGGGAGGG - Exonic
1098320702 12:69240104-69240126 CGGAGGAGGAAGCCCTGGCGGGG + Intronic
1112204288 13:97308903-97308925 AAGCAAAAGAAGCCCTGGGAAGG + Intronic
1119484577 14:74979393-74979415 GGGCTAGAAAAGCCCTGGGGGGG + Intergenic
1122722589 14:103730556-103730578 CAGTGCCAGAAGCCCTGGGGAGG - Intronic
1129462222 15:75705114-75705136 GGGAGAAACAGGCCCTGGGGAGG + Intronic
1129722639 15:77886734-77886756 GGGAGAAACAGGCCCTGGGGAGG - Intergenic
1131176741 15:90214009-90214031 TGGGGAAGGAAGCCCTCGGGTGG - Intronic
1135126963 16:19818923-19818945 CGGCGAGTAAAGCTCTGGGGTGG + Intronic
1138450691 16:57092274-57092296 CGGGCAAAGCAGGCCTGGGGAGG + Intergenic
1141429902 16:83966081-83966103 CGTCCAAAGATGCCCCGGGGAGG + Exonic
1143264287 17:5624189-5624211 CAGAGAAAGAAGCCCAGGAGGGG - Intergenic
1147386202 17:40083826-40083848 CGGCGAAAGAAGCCCTGGGGTGG - Exonic
1147920266 17:43912024-43912046 GGGCTCCAGAAGCCCTGGGGTGG - Intergenic
1147970901 17:44218869-44218891 CGGCGAAGGGAGCCCGGGAGGGG - Intronic
1156859590 18:41820297-41820319 GGGCGAAAGGCACCCTGGGGAGG - Intergenic
1161627695 19:5336836-5336858 CGGCAAAAGATGCCCAGGGAGGG - Intronic
1162869510 19:13574933-13574955 CGGCTCAAGGAGCCCTGGGGAGG - Intronic
1162939044 19:13997157-13997179 CGGCCCAAGCAGCCCAGGGGAGG + Intronic
1166712873 19:44948549-44948571 CGGGGAGGGAAGCCTTGGGGAGG + Intronic
1167617944 19:50546522-50546544 CGGTGCAAGAACCCCTGGGTGGG + Intronic
925690765 2:6520873-6520895 AGGCCAAAGAAGCCATGGGAAGG - Intergenic
926133583 2:10320663-10320685 TGGAGAGAGAATCCCTGGGGAGG + Intronic
932808025 2:74799623-74799645 TGGCTAAAGAAGGCCTGTGGAGG + Intergenic
938169199 2:129059764-129059786 TGGAGAGAGCAGCCCTGGGGTGG - Intergenic
943759304 2:191591243-191591265 CTGCGTCAGAAACCCTGGGGTGG + Intergenic
947771460 2:232673601-232673623 CAGGGAAAGCAGCCCAGGGGAGG - Intronic
948422101 2:237865892-237865914 CGGCGAAAGCTGCCCTTAGGAGG + Intronic
1174130910 20:48342755-48342777 CCTCGAAGGCAGCCCTGGGGAGG + Intergenic
1175494831 20:59406634-59406656 TTGCGAAAGAAGCCCTGCTGAGG + Intergenic
1179246389 21:39637588-39637610 CCAGGAAAGAAGCCCTGGGCGGG - Intronic
1179629162 21:42666085-42666107 AGGGGAAAGCAGCCCTGGGGTGG + Intronic
1179806898 21:43845105-43845127 CGGCAAAGGAAGCCCTCTGGTGG - Intergenic
1180082807 21:45494355-45494377 AGGCGCAGGCAGCCCTGGGGAGG - Intronic
1181037765 22:20178168-20178190 GGGCCAGAGACGCCCTGGGGTGG + Intergenic
1184706602 22:46218254-46218276 CGCCGAAAGAAGCCCTGTGAGGG - Exonic
956200388 3:66699476-66699498 AGGCCAAAGAAGCCCATGGGAGG - Intergenic
964504880 3:157388368-157388390 CAGCCAAAGAAGCATTGGGGTGG - Intronic
966912295 3:184566289-184566311 AGGGGAAAGAAGCCCAGGGCGGG - Intronic
968748261 4:2372342-2372364 CGGCGATGGAAGGGCTGGGGAGG - Intronic
983843687 4:172488819-172488841 CTGCGAAGGCAGTCCTGGGGTGG + Intronic
985309691 4:188583687-188583709 CTGCGAAAGCAGCTCTGGGCTGG - Intergenic
985876950 5:2607151-2607173 CAGCCCAAGAAGCCCTGGGATGG + Intergenic
989956081 5:50361825-50361847 CGACGTAAGAAGCCATTGGGTGG + Intergenic
991400843 5:66250222-66250244 GGTCGAAAGAAGGCCTGGTGGGG - Intergenic
992812968 5:80408033-80408055 CGGGGAAAGAAGCCCTGAGCCGG + Exonic
994648442 5:102498391-102498413 TGGCGGAGGACGCCCTGGGGTGG - Intronic
1008870321 6:56265238-56265260 AGGCACAAGAAGCTCTGGGGTGG + Intronic
1013441779 6:110179167-110179189 CAGCGAGAGCAGCCCCGGGGCGG + Intronic
1014137789 6:117908080-117908102 CGGCGCAGGGAGCCCTGGAGTGG + Intronic
1017970326 6:159306812-159306834 GGGAGAAAGAAATCCTGGGGTGG - Intergenic
1022240742 7:28510203-28510225 CAGGGAAAGAAGAGCTGGGGTGG - Intronic
1022382756 7:29875509-29875531 CAAGGACAGAAGCCCTGGGGTGG + Intronic
1023031376 7:36092988-36093010 GGGGGAAAGAAGACATGGGGTGG + Intergenic
1031478212 7:122248083-122248105 CTGTGAAAGAAGCTATGGGGTGG + Intergenic
1034407807 7:150916878-150916900 CAGCTGAAGAAGCCCTGGCGAGG - Intergenic
1038307353 8:26416866-26416888 CAGCTAAGGAAGCCCTGGGAAGG - Intronic
1041233160 8:55773276-55773298 CGGCGACAGAAGCTCTTCGGGGG + Exonic
1043274541 8:78376874-78376896 AGCTGAAAGAACCCCTGGGGGGG + Intergenic
1044730695 8:95226465-95226487 AGGGGAGAGGAGCCCTGGGGTGG - Intergenic
1045211721 8:100106211-100106233 CGGCGAACGAAGGCTGGGGGCGG + Intronic
1049509069 8:143018691-143018713 CGGCGGAAGGCGCCCTGCGGGGG + Intronic
1058618401 9:106860369-106860391 CGGGGAATTGAGCCCTGGGGAGG - Intergenic
1061215192 9:129217705-129217727 AGGCAAAAGAGGCTCTGGGGCGG + Intergenic
1062174675 9:135154583-135154605 TGGCAAGAGAAGCCCTGGGCTGG + Intergenic
1186355896 X:8789389-8789411 AGGCAAAAGAAGCACTGCGGAGG - Intergenic
1200231129 X:154444412-154444434 CGGCCCTGGAAGCCCTGGGGCGG + Intronic