ID: 1147387387

View in Genome Browser
Species Human (GRCh38)
Location 17:40090442-40090464
Sequence GTGTGGAAGGAGGAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2524
Summary {0: 1, 1: 1, 2: 9, 3: 217, 4: 2296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147387387_1147387394 -6 Left 1147387387 17:40090442-40090464 CCATCCACCTCCTCCTTCCACAC 0: 1
1: 1
2: 9
3: 217
4: 2296
Right 1147387394 17:40090459-40090481 CCACACCTTGGCACCCACCCAGG 0: 1
1: 0
2: 1
3: 27
4: 269
1147387387_1147387396 6 Left 1147387387 17:40090442-40090464 CCATCCACCTCCTCCTTCCACAC 0: 1
1: 1
2: 9
3: 217
4: 2296
Right 1147387396 17:40090471-40090493 ACCCACCCAGGAAAAAACTGTGG 0: 1
1: 0
2: 1
3: 19
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147387387 Original CRISPR GTGTGGAAGGAGGAGGTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr