ID: 1147390977

View in Genome Browser
Species Human (GRCh38)
Location 17:40108978-40109000
Sequence CATGGTAAACAGTGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147390965_1147390977 20 Left 1147390965 17:40108935-40108957 CCCTGTCTCAAAAAAAAAAAAAA 0: 13494
1: 16907
2: 33917
3: 145359
4: 149502
Right 1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG No data
1147390966_1147390977 19 Left 1147390966 17:40108936-40108958 CCTGTCTCAAAAAAAAAAAAAAA 0: 13279
1: 16490
2: 27851
3: 54067
4: 109329
Right 1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG No data
1147390969_1147390977 -10 Left 1147390969 17:40108965-40108987 CCAATCAAGTCCTCATGGTAAAC No data
Right 1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147390977 Original CRISPR CATGGTAAACAGTGGGGGGA GGG Intergenic
No off target data available for this crispr