ID: 1147391839

View in Genome Browser
Species Human (GRCh38)
Location 17:40114084-40114106
Sequence TTCTATAAGCCTTAGAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147391833_1147391839 16 Left 1147391833 17:40114045-40114067 CCTTCAAAGAATGTAGGTCATAG No data
Right 1147391839 17:40114084-40114106 TTCTATAAGCCTTAGAGGGGTGG No data
1147391832_1147391839 17 Left 1147391832 17:40114044-40114066 CCCTTCAAAGAATGTAGGTCATA No data
Right 1147391839 17:40114084-40114106 TTCTATAAGCCTTAGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147391839 Original CRISPR TTCTATAAGCCTTAGAGGGG TGG Intergenic
No off target data available for this crispr