ID: 1147398786

View in Genome Browser
Species Human (GRCh38)
Location 17:40166158-40166180
Sequence CAATAGGCAAAATGGGTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147398786_1147398791 11 Left 1147398786 17:40166158-40166180 CCTATTACCCATTTTGCCTATTG 0: 1
1: 0
2: 0
3: 17
4: 212
Right 1147398791 17:40166192-40166214 TCTCCAGCCAGATAGATCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147398786 Original CRISPR CAATAGGCAAAATGGGTAAT AGG (reversed) Intronic
900183592 1:1323001-1323023 CAAGAGGCCAAATGGGAAAGGGG + Exonic
909174577 1:72339980-72340002 AAAAAGGCAATATGGGGAATGGG - Intergenic
910621011 1:89254467-89254489 CAAAAGCAAAAATGGGTAAATGG + Intergenic
911000221 1:93157210-93157232 TAATAGGCAAAATCAGTAAGAGG - Intronic
911546192 1:99220050-99220072 CAATAGCAAAAATAGGTAAATGG - Intergenic
912110621 1:106337451-106337473 AAAAAGACAAAATGGCTAATGGG - Intergenic
916592789 1:166209199-166209221 TAATAAGCAAAATGGGCAAAAGG - Intergenic
916788885 1:168107325-168107347 CAATAGGCAACATGGAGAAGTGG + Intronic
918986399 1:191633394-191633416 CCAAAGGAAAAATGGGTAAATGG + Intergenic
920584000 1:207139571-207139593 GAATAGACAAAATTGGTAGTTGG - Intronic
921745418 1:218735007-218735029 CATTAGGCAGGATGGGCAATAGG - Intergenic
922070162 1:222184252-222184274 CATAAGACAAAATGGGTAAGGGG - Intergenic
922194396 1:223347140-223347162 CAATAAGCAATATGGAAAATTGG + Intronic
922634550 1:227153863-227153885 CTAGAGCCAAAATGGGTAAGGGG + Intronic
924153852 1:241155842-241155864 AAATAGGCCAAATGGATCATAGG + Intronic
924329950 1:242931499-242931521 CAATAGACAAAATGGTTAGGGGG + Intergenic
924335223 1:242980789-242980811 CAAGAGGCAAAGTGGGTTTTAGG + Intergenic
1064941479 10:20740380-20740402 CAATGGTCATAATGGGTGATGGG + Intergenic
1068645527 10:59462546-59462568 TTATAGGCAGAATGGGTGATGGG + Intergenic
1069971821 10:72177474-72177496 CACTGGGCAGAATGGGTAATGGG - Intronic
1071459145 10:85875803-85875825 CAATAGAAATAATGTGTAATGGG - Intronic
1079658533 11:23012268-23012290 CAAGAGGCAAAATGTGTAGCCGG - Intergenic
1080420297 11:32103983-32104005 CAATCAGCAAAGTGGGGAATAGG - Intronic
1084961449 11:72718796-72718818 CAAAATGCAGAATGGGTAAGAGG + Intronic
1086242618 11:84714215-84714237 CAATATTCAAAATAGGTAAAGGG + Intronic
1087074155 11:94113390-94113412 CATGAGGGGAAATGGGTAATTGG + Exonic
1087158729 11:94928753-94928775 CAAAGGGCAAAATGGCTCATAGG + Intergenic
1087310730 11:96539205-96539227 GAATAGGCAAAATGATTAAAGGG - Intergenic
1088457584 11:110049374-110049396 CAATAGGCAAATAGGCAAATAGG - Intergenic
1089080445 11:115772207-115772229 CAGTAGGTAAAATGAGCAATAGG + Intergenic
1095400452 12:41808704-41808726 CAAAAGCCAAAATGGGGAAATGG + Intergenic
1096739296 12:53680442-53680464 TAATAGGCTATATGAGTAATAGG + Intergenic
1097424438 12:59425205-59425227 CAATATGAACAATGGTTAATGGG - Intergenic
1098463846 12:70764481-70764503 CAAAAGGCATCATGGGCAATGGG + Intronic
1099240595 12:80134109-80134131 CAATAGTCTAAATGAATAATAGG - Intergenic
1100677428 12:96882593-96882615 AAATAGGCAAAATGGATTACTGG + Intergenic
1100950400 12:99842605-99842627 CAAGAGGAAACATGGGTAAGAGG - Intronic
1102339056 12:112107828-112107850 CAATAACCGAAATGTGTAATTGG - Intronic
1102533259 12:113562278-113562300 CAACAGGGAACCTGGGTAATAGG + Intergenic
1103268379 12:119650512-119650534 AATTAGGGACAATGGGTAATAGG - Intergenic
1104533028 12:129590405-129590427 CAATATGAAAAGTGGGTAATTGG - Intronic
1105455274 13:20534748-20534770 CAATAGAGAAAATTGTTAATAGG + Intergenic
1108908202 13:55505964-55505986 CATTAGGAAGAATAGGTAATAGG + Intergenic
1109626179 13:64978185-64978207 CAAAAGGCAAAATGGACAAATGG - Intergenic
1109994958 13:70111079-70111101 CACTAAGCAAAAAGGTTAATCGG + Intergenic
1110387896 13:74935971-74935993 CAAAAGACAAAATTGGTAATAGG + Intergenic
1110629883 13:77696867-77696889 CAATAGGCAAAAATGGTTATGGG - Intergenic
1112252725 13:97798104-97798126 AAATAGGCAAAAGAGGGAATAGG - Intergenic
1114909402 14:27171440-27171462 CAATAGGGAAAATGTCTAAAGGG - Intergenic
1116758547 14:48980614-48980636 TAATAGGAAAAATTGCTAATTGG - Intergenic
1119300620 14:73568728-73568750 AAATAGCCAAATGGGGTAATAGG - Intronic
1119858091 14:77916081-77916103 CAATATGAAAAATGGGGAAAGGG - Intronic
1120410439 14:84147116-84147138 CAATAGGTAAAATAGGCAAAAGG + Intergenic
1120427315 14:84364673-84364695 CCATATGCAAAATGGGTATTGGG + Intergenic
1120712574 14:87807955-87807977 CAATAGCAAAAATGTGAAATAGG + Intergenic
1120810996 14:88803306-88803328 CAATGTGACAAATGGGTAATTGG + Intergenic
1121695808 14:95910931-95910953 CAGTAAGTAAAATGGGTAACCGG - Intergenic
1128882169 15:71253992-71254014 CAATGAGTAAAATGGCTAATAGG - Intronic
1130750290 15:86704266-86704288 CAAAAGGCAAAATTGGCAAATGG + Intronic
1131963525 15:97813452-97813474 AAATAGGCAACCTGTGTAATAGG - Intergenic
1134473461 16:14549312-14549334 GAATAGGGAATATGGGGAATAGG - Intronic
1139145131 16:64314356-64314378 CAATAGCCAAAATAGGGAAGTGG - Intergenic
1139406499 16:66723121-66723143 CACTAAGCAAAATGGGAATTAGG - Exonic
1142937534 17:3348257-3348279 CAAAAGCCAAAATGGATAAATGG - Intergenic
1146150739 17:30468114-30468136 AAATAGGATAAATGGGTATTGGG - Exonic
1146466925 17:33093741-33093763 CAATAGGCAGAATGCATAACGGG + Intronic
1146527644 17:33580497-33580519 CACTAGGCAAATTGGATGATGGG + Intronic
1147398786 17:40166158-40166180 CAATAGGCAAAATGGGTAATAGG - Intronic
1149184928 17:53986287-53986309 CAATATGGAAAATGGGCAAGAGG - Intergenic
1150495127 17:65601934-65601956 CAAAAGTCAAAATGGGAAATTGG - Intronic
1153128100 18:1820481-1820503 CAACAGGCACAATGGCTACTTGG - Intergenic
1155192427 18:23442020-23442042 AAATAGGCAGAATGTGAAATTGG + Intergenic
1155288482 18:24316370-24316392 AAATTGCCAGAATGGGTAATAGG + Intronic
1156294435 18:35777119-35777141 GAATTGGCAGAATGGGGAATGGG - Intergenic
1158207943 18:55014531-55014553 AAATAGGGAAAATGGATACTGGG - Intergenic
1160314538 18:77829483-77829505 AAATAGGAACTATGGGTAATAGG + Intergenic
1161527885 19:4768799-4768821 CAATAGCAAAAATTGGGAATGGG + Intergenic
1162189641 19:8934691-8934713 CACTAGGGAGAATGGGGAATGGG + Intronic
1162913256 19:13861376-13861398 CAGTAAGCAAAATTGTTAATGGG + Intergenic
1164439881 19:28267527-28267549 CAAAAGGCAAAAGGGGTGAAGGG + Intergenic
1166156663 19:40917786-40917808 CAAAAGGCAAAATGGACAAATGG + Intergenic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
1167691627 19:50987878-50987900 CAATGGCCAAAATGGGATATGGG - Intergenic
926808392 2:16734414-16734436 CCACAGGAAAAATGAGTAATGGG - Intergenic
926927935 2:18007056-18007078 GCATTGGCAAAAGGGGTAATGGG - Intronic
928809482 2:35205215-35205237 CCACAGTCAAAATGGTTAATGGG - Intergenic
929738669 2:44578639-44578661 TACAAGGCAAATTGGGTAATGGG + Intronic
930975156 2:57449316-57449338 GAATAGACAAAATGTCTAATAGG - Intergenic
931180274 2:59892528-59892550 AAACACACAAAATGGGTAATTGG - Intergenic
932003444 2:67905605-67905627 AAACAGGCAGAATGGGAAATAGG + Intergenic
932874711 2:75438945-75438967 CACTAGGGAAACTGGGTAAAGGG + Intergenic
932940677 2:76161164-76161186 CAATAGGCATCATTGGTCATTGG - Intergenic
938087195 2:128409328-128409350 CAAGAGGGAAAGTGGGTAATGGG + Intergenic
939520737 2:143226607-143226629 TAAAAGGCAAAATGGGCACTAGG + Intronic
939592094 2:144077265-144077287 CAATGTGCAGAATGGGTACTGGG - Intronic
940782839 2:157951669-157951691 CAATAGGAAAAATAGATAAATGG - Intronic
941073078 2:160976583-160976605 CAAAAGCCAAAATTGGCAATTGG - Intergenic
942554020 2:177152584-177152606 CAATATGCTGTATGGGTAATTGG + Intergenic
943228377 2:185210470-185210492 CAAAAGGCAAGATGGGTGGTGGG - Intergenic
943232331 2:185270901-185270923 CAAAAGCCAAAATTGTTAATTGG - Intergenic
943680725 2:190764777-190764799 AAAGAGCTAAAATGGGTAATAGG + Intergenic
945136845 2:206638731-206638753 CAATAAGCAACAGGGGTAAGAGG - Intergenic
946220906 2:218225992-218226014 CAATATGAAAAATAGGAAATAGG + Intronic
946503514 2:220275134-220275156 ACATAGGGAAAATGTGTAATTGG - Intergenic
946817942 2:223598280-223598302 GAATGGGCAAAATGGGGAAAGGG - Exonic
947421097 2:229942202-229942224 TGAGAGGTAAAATGGGTAATAGG + Intronic
1169378994 20:5090268-5090290 CACCTGGCACAATGGGTAATGGG + Intronic
1171128822 20:22629169-22629191 CAATAGGCCAAATGGGTTTTGGG - Intergenic
1172361879 20:34318426-34318448 GAATGGGCAACATGGGTAACAGG - Intergenic
1173676318 20:44838828-44838850 CAAAAGGTAAGATGGGAAATGGG + Intergenic
1174855652 20:54042832-54042854 CCCTAGGCAAATTGGGAAATAGG - Intronic
1175008818 20:55713697-55713719 AAATAGGCAAAATAAATAATTGG - Intergenic
1176253237 20:64136998-64137020 CAATAAGAAAAATGGGTCAAGGG - Intergenic
1181794518 22:25295364-25295386 CAATAGCCACAATGGGTGAACGG - Intergenic
1184540792 22:45122900-45122922 CAATAGGCTATATGGTTAATTGG - Intergenic
950701460 3:14752466-14752488 CAATAGCCAAAATAGATAAATGG + Intronic
950955617 3:17050474-17050496 AAATGGGCAAAATGTTTAATAGG + Intronic
952548120 3:34444990-34445012 CAAAAGCAAAAATGGGTAAATGG - Intergenic
953520047 3:43633460-43633482 GAAGAGGCTAAATGGCTAATGGG + Intronic
956906343 3:73769721-73769743 CAAAAAGCAAAATGGGACATGGG + Intergenic
957864378 3:86003269-86003291 CCATGGGGAAAATGGGGAATGGG - Intronic
958204468 3:90371950-90371972 CAAGAGGTAAAATGAGGAATTGG - Intergenic
959295447 3:104529743-104529765 CAATAGGCAGATTGATTAATAGG - Intergenic
960045814 3:113196881-113196903 CAATAGGGAAACTGGGTGAAGGG - Intergenic
962648264 3:137462203-137462225 CAATAGTGAAAATGGGTAAGAGG + Intergenic
962752939 3:138447962-138447984 GAAAAAGCAAAATGGGGAATCGG + Intronic
964827517 3:160845646-160845668 CAAAAGTCAAAATGTATAATAGG - Intronic
965907768 3:173730413-173730435 AAATAGGTAAAATAGGTAAATGG + Intronic
966174378 3:177119659-177119681 TAATCTGCAAAATTGGTAATTGG - Intronic
967386352 3:188915342-188915364 AAATCTGCCAAATGGGTAATGGG - Intergenic
967682613 3:192382369-192382391 CCATTGGCAAAATGGGTACAGGG - Intronic
967694887 3:192519028-192519050 CATTAGGGAAATTGGGTAAATGG - Intronic
970691535 4:18625884-18625906 CAATAAACATAATGGGTAAATGG - Intergenic
971483196 4:27132533-27132555 CAGTAGAGAAAATAGGTAATTGG - Intergenic
973213309 4:47639986-47640008 TAATGGGAAAAATGGGTAAGTGG - Intronic
973343382 4:49029085-49029107 CAAAAGGCAGAATGGGTTGTAGG + Intronic
974284803 4:59850481-59850503 CAACAGGAAAAATGGGAACTGGG - Intergenic
974860251 4:67511751-67511773 AAATAGGCAAAATGTCTATTAGG - Intronic
975296996 4:72746349-72746371 CAAAAGCCAAAATGGGTGAATGG - Intergenic
975746525 4:77480694-77480716 CAATAGGATAAATGGGTAGATGG - Intergenic
977112509 4:92976586-92976608 CAATAGGCAAGTTGGGAAGTGGG - Intronic
978147257 4:105390291-105390313 CAAAAGCCAAAATTGGTAAGTGG + Intronic
979060447 4:116052868-116052890 GAATTGGCAAACTGGATAATAGG - Intergenic
979241889 4:118454491-118454513 CAAGAGGCAAAGTGGGTTTTAGG - Intergenic
980220986 4:129914889-129914911 CAAAAGGCAAAATGTGGATTAGG + Intergenic
981594097 4:146399545-146399567 CAAGAGGCAAAATGAGTTAATGG + Intronic
982603644 4:157485337-157485359 CAAAAGCCAAAATGGACAATTGG - Intergenic
983297799 4:165888655-165888677 CCATACCCAAAATAGGTAATAGG - Intronic
983768933 4:171523603-171523625 TAATAGGCAAATTAGATAATAGG - Intergenic
983872392 4:172837105-172837127 CAATAGGCAAAATGGTTACAAGG + Intronic
984362873 4:178759050-178759072 CAATAGACAAAATCTGGAATGGG - Intergenic
985123249 4:186664882-186664904 GCATAGGTAAAATTGGTAATTGG - Intronic
985368692 4:189261622-189261644 CAACATGCAAACTGGGTAACAGG - Intergenic
986046852 5:4046378-4046400 CAGAAGGCAAATTGGGGAATAGG - Intergenic
987167016 5:15209682-15209704 ACTTAGGCAAAAAGGGTAATTGG - Intergenic
987215328 5:15731110-15731132 CAAGAGGGAAAATGGATGATTGG + Intronic
987460885 5:18208340-18208362 CCATAAGTAAAATGGGTAATGGG + Intergenic
991525792 5:67556375-67556397 AAATGGGCAAAATGGGCAAAGGG - Intergenic
992480060 5:77142262-77142284 CAATATGCAAAAAGACTAATTGG - Intergenic
992696187 5:79289923-79289945 GAAAGGGCAAAATGGGGAATAGG + Intronic
994744627 5:103663547-103663569 CGATAGGCAATATAGGTATTTGG - Intergenic
994815585 5:104583157-104583179 AAATTAACAAAATGGGTAATAGG - Intergenic
995223156 5:109673810-109673832 CAATAGGCAAAATGTTTAGGGGG + Intergenic
997797378 5:136824024-136824046 CAAAAGGCAAAATCGACAATTGG - Intergenic
998100744 5:139432025-139432047 CAATTGGAAAAATGGGCAAAGGG - Intronic
1003192053 6:3882867-3882889 CAATAGACACAGTGGGTCATAGG + Intergenic
1008201113 6:48592036-48592058 CAAAAGCCAAAATAGGCAATGGG - Intergenic
1008376389 6:50796611-50796633 AAATAAGTAAAATGGGTAACAGG - Intergenic
1008452340 6:51667557-51667579 CAAAAGGCAAAATGGACAAATGG - Intronic
1008597313 6:53055404-53055426 CAAGAGGCAAAATGCTTAAAAGG - Intronic
1009307441 6:62108073-62108095 CAAAAGGCAAAATGGACAAATGG + Intronic
1009308050 6:62117017-62117039 CAATAGCCAAGATATGTAATTGG - Intronic
1009640977 6:66335955-66335977 CAAAAGGAAAAAAGGGTAGTGGG - Intergenic
1010477003 6:76300031-76300053 CAATAGCCAAAATTGGCAAATGG - Intergenic
1011258485 6:85448747-85448769 CATAAGGCAATATGGGTGATGGG + Intergenic
1011302366 6:85889924-85889946 CAGAAGGCAAAATTGGCAATGGG - Intergenic
1012528586 6:100206670-100206692 CAAAAGGCAAAATTGGTGAGGGG - Intergenic
1013082539 6:106825038-106825060 TAATAGCCAAAATGGGTCCTGGG + Intergenic
1013516722 6:110894193-110894215 AAATATGCAAAATGAGTAACTGG - Exonic
1015144812 6:129973488-129973510 CAAAATGCAAAATGGGTAGCTGG + Intergenic
1015206800 6:130649668-130649690 CAACAGGTAAAATGTGAAATTGG + Intergenic
1015463205 6:133517256-133517278 CAAAAAGAAAAATGGGTATTAGG + Intronic
1015775862 6:136813543-136813565 CAAAAGAGAAAATGTGTAATGGG - Intergenic
1017353883 6:153479004-153479026 AAATAGGCTAAATAGGTAAAAGG + Intergenic
1022556134 7:31298743-31298765 GAATAGACAAACTGAGTAATTGG + Intergenic
1022906566 7:34863359-34863381 CAAAAGCCAAAATTGGTAAATGG + Intronic
1024476313 7:49815884-49815906 CAAAAGAAAAAATGGCTAATAGG + Intronic
1024939512 7:54747258-54747280 CAATAGGTTAAAGGGGTATTCGG - Intergenic
1027910271 7:84241639-84241661 CAATAGCCAAAATGGACAAATGG - Intronic
1030755324 7:113280922-113280944 CAATAGGCATAAAAGGAAATAGG - Intergenic
1030894803 7:115045149-115045171 TATTAGGCAAAATGGCTAACTGG + Intergenic
1031212037 7:118841530-118841552 CAATAGCCAAAATAGATAAATGG - Intergenic
1031331077 7:120465300-120465322 CATAAGGCAAAATGTGTAATCGG + Intronic
1033393518 7:140951247-140951269 CCAAAGAAAAAATGGGTAATCGG + Intergenic
1036090223 8:5657163-5657185 CAATACTGAAAATGGGTCATTGG + Intergenic
1036226336 8:6960927-6960949 CAACAGGTAGAAAGGGTAATAGG + Intergenic
1037353673 8:17994157-17994179 GAATAGGGAAGATGGTTAATGGG - Intronic
1039090186 8:33819648-33819670 CAATATGTAAAATAGGGAATTGG + Intergenic
1042582971 8:70302599-70302621 TAATAGGCAAAATGAGTAGTTGG - Intronic
1043408151 8:79960989-79961011 CAATGGTCAAAATGGGTGAAAGG + Intronic
1043485139 8:80691764-80691786 CAATAGGAAACATGTTTAATAGG - Intronic
1044368726 8:91382830-91382852 CAATAACTAAAATAGGTAATAGG + Intronic
1044707037 8:95018826-95018848 CAATACACACAATGGGTGATGGG + Intronic
1050624587 9:7489219-7489241 AATTATGCAAAATGAGTAATAGG - Intergenic
1051354401 9:16228445-16228467 CAAAAGCCAAAATGGATAAATGG + Intronic
1052301592 9:26958381-26958403 TAATAGGCAAAATGTGTGTTAGG + Intronic
1052843142 9:33310740-33310762 TAAAAGGCAGAATGGCTAATAGG - Intronic
1055998851 9:82193152-82193174 AGAAAGGCAAGATGGGTAATAGG - Intergenic
1060329948 9:122658946-122658968 CAATAGTCTAAATGGGTGAGGGG + Intergenic
1061966312 9:134015611-134015633 CAATAGAGAAAATTGGTATTGGG - Intergenic
1186954325 X:14664985-14665007 CAACAGGAAAAATGGCAAATGGG + Intronic
1187576369 X:20560752-20560774 CAAAAGGCACATTGGGTATTAGG - Intergenic
1188215932 X:27477234-27477256 TTCTAGGCAAAATGGATAATAGG + Intergenic
1188719931 X:33509843-33509865 CAAAAGCCAAAATAGGTAAATGG + Intergenic
1189737308 X:44084855-44084877 CAATAGGCAAAAAGGAAAATAGG + Intergenic
1192741524 X:73897814-73897836 CAAAAGGCAAAATGGACAAATGG + Intergenic
1192975654 X:76281545-76281567 CAAAAGCCAAAATTGGCAATGGG - Intergenic
1193655326 X:84190256-84190278 CAATAGGCAGAATTGGGAAGAGG - Intergenic
1193947555 X:87756534-87756556 GAATAGGCAACATGGGTCCTTGG - Intergenic
1194455383 X:94096499-94096521 AAATAAGCAAAATGGGTACTTGG + Intergenic
1195018242 X:100799456-100799478 CAAAAGTCAAAATGGGAACTGGG + Intergenic
1195158930 X:102152598-102152620 GAAAAGGCAAAATGGGGATTCGG + Intergenic
1195549367 X:106149775-106149797 CAATTGGGAAACTGGGTAGTGGG + Intergenic
1197282907 X:124558785-124558807 CTATAGGGAAAAATGGTAATCGG + Intronic
1197640860 X:128966636-128966658 CACTTGGAAGAATGGGTAATGGG - Intergenic
1198521872 X:137461204-137461226 CAGTAGGCAAAAGGGGGAAGAGG + Intergenic
1201227301 Y:11830622-11830644 CAATAGACAAAATGGTTAGAGGG + Intergenic
1201252271 Y:12071405-12071427 CAAAAGTCAAAATGGGCAAATGG - Intergenic
1202389599 Y:24356316-24356338 CAAGAGGCAAAGTGGGTTTTAGG - Intergenic
1202481185 Y:25313798-25313820 CAAGAGGCAAAGTGGGTTTTAGG + Intergenic