ID: 1147400416

View in Genome Browser
Species Human (GRCh38)
Location 17:40177554-40177576
Sequence CTGCCGCCGCAGCGCAGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 146}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147400404_1147400416 28 Left 1147400404 17:40177503-40177525 CCGCCGCCGCCGCCGCCGCGTCC 0: 5
1: 100
2: 1594
3: 2690
4: 5011
Right 1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 146
1147400407_1147400416 19 Left 1147400407 17:40177512-40177534 CCGCCGCCGCGTCCTCTCAGCCT 0: 1
1: 0
2: 0
3: 30
4: 337
Right 1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 146
1147400412_1147400416 -10 Left 1147400412 17:40177541-40177563 CCGCCCGCTGCCTCTGCCGCCGC 0: 1
1: 3
2: 18
3: 199
4: 1196
Right 1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 146
1147400411_1147400416 -1 Left 1147400411 17:40177532-40177554 CCTTGCGCTCCGCCCGCTGCCTC 0: 1
1: 1
2: 1
3: 35
4: 326
Right 1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 146
1147400408_1147400416 16 Left 1147400408 17:40177515-40177537 CCGCCGCGTCCTCTCAGCCTTGC 0: 1
1: 0
2: 0
3: 17
4: 233
Right 1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 146
1147400409_1147400416 13 Left 1147400409 17:40177518-40177540 CCGCGTCCTCTCAGCCTTGCGCT 0: 1
1: 0
2: 0
3: 8
4: 159
Right 1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 146
1147400406_1147400416 22 Left 1147400406 17:40177509-40177531 CCGCCGCCGCCGCGTCCTCTCAG 0: 1
1: 1
2: 4
3: 52
4: 426
Right 1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 146
1147400405_1147400416 25 Left 1147400405 17:40177506-40177528 CCGCCGCCGCCGCCGCGTCCTCT 0: 1
1: 1
2: 83
3: 662
4: 3221
Right 1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 146
1147400410_1147400416 7 Left 1147400410 17:40177524-40177546 CCTCTCAGCCTTGCGCTCCGCCC 0: 1
1: 1
2: 1
3: 16
4: 252
Right 1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147400416 Original CRISPR CTGCCGCCGCAGCGCAGAGC CGG Intronic
900161362 1:1225519-1225541 CAGCCGCAGCAGCCCAGAGGTGG + Intronic
900974352 1:6007903-6007925 CTGCAGCCGCAGCCCTGAGAGGG + Intronic
901185500 1:7370130-7370152 CTGCTGCCCCCGCGGAGAGCTGG - Intronic
904237341 1:29123856-29123878 CTGGCGCCGCAGCGCCGCGCGGG + Intronic
904367988 1:30029129-30029151 CTGCCACAGGAGTGCAGAGCAGG + Intergenic
906526297 1:46495068-46495090 CTGCTGGGGCAGGGCAGAGCAGG + Intergenic
907051141 1:51330533-51330555 CTGCCGCCGCAACCCCGAGCCGG + Intronic
911237463 1:95426438-95426460 CTGGCGATGCAGTGCAGAGCAGG + Intergenic
912354215 1:109041941-109041963 CTCCTGCCGCAGCCCGGAGCCGG - Exonic
912670430 1:111619826-111619848 CTGCTGTCGCCGCGCAGAGCCGG + Exonic
920665453 1:207959655-207959677 CTCCCGCCACAGCGCAGAGGGGG - Intergenic
921325341 1:213982820-213982842 CTCCCGGCGCGCCGCAGAGCCGG - Intergenic
921718143 1:218439695-218439717 CTGCTGCCGCAGCCCAGAGGAGG - Intronic
923458177 1:234184595-234184617 ATGCTGCCGCAGGCCAGAGCAGG + Intronic
1064148161 10:12841701-12841723 CGGCCGCCTCAGGCCAGAGCAGG + Intergenic
1064208967 10:13347771-13347793 CCGCCGCCGCCGCGCGGGGCCGG - Intronic
1066752733 10:38675672-38675694 CAGCAGCAGCAGCACAGAGCAGG - Intergenic
1069876746 10:71567770-71567792 CTGCTGCCTCAGGGCATAGCTGG + Intronic
1070570648 10:77637748-77637770 CCGCCGCCGCCGCGGAGCGCGGG + Intronic
1070670334 10:78373173-78373195 CTGCCGCCAGATCCCAGAGCAGG - Intergenic
1070800843 10:79243571-79243593 CCGCCGCCGGGGCGCGGAGCGGG + Intronic
1072706821 10:97687076-97687098 CTCCCACCGCAGCGCCGAGCTGG + Exonic
1076311821 10:129513508-129513530 CTGGAGCAGCAGCTCAGAGCAGG + Intronic
1076741049 10:132485549-132485571 CTACCGCTGAAGCGTAGAGCAGG - Intergenic
1080728043 11:34916718-34916740 CGGCCGCCGAAGCGTAGGGCTGG + Exonic
1081567009 11:44266275-44266297 CTGCTGCCTGAGCGCACAGCTGG - Intronic
1084313680 11:68331470-68331492 CTGCTGCTCCACCGCAGAGCTGG - Intronic
1085281646 11:75334873-75334895 TTGCCACAGCAGGGCAGAGCTGG + Intronic
1087043017 11:93820021-93820043 CTGCTGCCTCAGAGCAGAGGTGG - Exonic
1089347040 11:117797204-117797226 CCGCCGCCGCAGCCGAGCGCTGG - Exonic
1090435766 11:126685212-126685234 CTGACTCCCCAGAGCAGAGCTGG - Intronic
1092156420 12:6284631-6284653 GTGCAGCAACAGCGCAGAGCTGG + Intergenic
1092743023 12:11648951-11648973 CGGCCGCCGCATCCCCGAGCGGG + Intergenic
1102520680 12:113476062-113476084 CCGCCGCCGCCGCGCAGACCCGG - Intergenic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103547423 12:121712331-121712353 CGGGCGGCGCAGCGCAGAGAGGG - Intergenic
1105472067 13:20703732-20703754 CCGCCGCCGCCGCCCCGAGCCGG - Intronic
1105525679 13:21176239-21176261 CTGCCACCGAGGCGCAGGGCGGG - Intronic
1105767815 13:23578968-23578990 CAGGCGCAGCAGCGCAGACCTGG + Intronic
1113527557 13:110992387-110992409 CTGGCACCTCAGAGCAGAGCAGG - Intergenic
1113656165 13:112068737-112068759 CAGCGGCCGCGGCGCAGAGCCGG + Exonic
1113906251 13:113820643-113820665 AGGCCGGCGCAGCGCAGAGCGGG - Exonic
1117176732 14:53153212-53153234 CTGCCGCCGCAGCTCGGGTCGGG - Intronic
1117978493 14:61320867-61320889 CTGCCCTTGCCGCGCAGAGCTGG + Intronic
1118809104 14:69260755-69260777 CGGCCCCGGCAGCGCAGAGCCGG - Intronic
1120763650 14:88308414-88308436 CTGCCCCAGCAGCCCAGAGAAGG + Intronic
1121877666 14:97468310-97468332 CTGCAGCCGCAGTGGAGAGCAGG - Intergenic
1123758267 15:23413885-23413907 CTGCCGTCGCTCCCCAGAGCTGG + Intergenic
1124640575 15:31393585-31393607 CTGCGACCGCAGAGCACAGCGGG - Intronic
1126299942 15:47184322-47184344 GCGCTGGCGCAGCGCAGAGCAGG - Intronic
1129311803 15:74718058-74718080 CGGCCGCCGCTGCACAAAGCAGG + Intergenic
1129616193 15:77100252-77100274 CTGCAGCTGCAGCCCAGAGAGGG - Intergenic
1132256463 15:100381005-100381027 CAGCCCCAGCAGCACAGAGCAGG - Intergenic
1132725990 16:1338609-1338631 CTTCCGCCGCAGGACTGAGCAGG + Exonic
1132752643 16:1465873-1465895 CGGCCGCCCCAGCTCAGGGCAGG + Intronic
1132848105 16:2009881-2009903 CTTCCGCCTCAGCGCGGCGCCGG + Intergenic
1133051416 16:3119380-3119402 CTGCGGCCGGAGCTCAGGGCCGG + Exonic
1133383432 16:5349823-5349845 CTGGGGCCTCAGCTCAGAGCAGG - Intergenic
1136406794 16:30052991-30053013 GGGCCGCGGCGGCGCAGAGCCGG + Intergenic
1138360750 16:56425441-56425463 CCGCCGCCGCCGCGCCGGGCCGG + Exonic
1139391589 16:66609147-66609169 CTTCCACCGCATCGCAGGGCAGG + Intronic
1141694505 16:85613288-85613310 CTGCCGCCGCCGAGCAGCCCCGG + Exonic
1142140906 16:88472301-88472323 CTGCCACCACAGCACAGAGAGGG + Intronic
1142245678 16:88969110-88969132 CTGCAGCCGAATCCCAGAGCCGG - Intronic
1142345871 16:89553735-89553757 CTGCAGGCGCAGAGCAGTGCTGG - Intronic
1142610838 17:1108695-1108717 CAGCCGCCGGAGCCCTGAGCTGG + Intronic
1143517390 17:7426737-7426759 CTGCAGCCTCAGCTCAGACCTGG - Exonic
1147400416 17:40177554-40177576 CTGCCGCCGCAGCGCAGAGCCGG + Intronic
1147964432 17:44186664-44186686 CTGGCGCCGCTGGGCAGAGCCGG - Intergenic
1148351214 17:46943327-46943349 CTGCAGGGGCAGCGAAGAGCTGG - Intronic
1150651850 17:67015696-67015718 CTGCCGCTGCAGAGCAAATCGGG + Intronic
1151431072 17:74063629-74063651 TGGCCGCTGCAGCTCAGAGCTGG - Intergenic
1151729806 17:75904597-75904619 CTACCGGCGCCGAGCAGAGCAGG - Exonic
1151828689 17:76537562-76537584 CCGCCGCCGCCGAGCAAAGCCGG - Exonic
1152980028 18:268038-268060 CAGGCGCCGCAGCGCAGTGGCGG - Intronic
1153526339 18:5998319-5998341 CTGCAGACGCAGCGCAGGGGAGG - Intronic
1156788123 18:40939835-40939857 CTGCGGCAGCCGCGCAGGGCTGG - Intergenic
1160791310 19:925034-925056 TTGTCGCCACTGCGCAGAGCAGG - Intergenic
1160896965 19:1407654-1407676 CCGCCGCCGTTGCGCAGATCCGG + Exonic
1162302402 19:9851201-9851223 CTGTGGCCGCTGGGCAGAGCTGG + Intergenic
1163500719 19:17674580-17674602 CTGGCCCCTCAGGGCAGAGCTGG - Intronic
1163844656 19:19631518-19631540 CTCCTGCAGCAGCCCAGAGCTGG - Intronic
1165046639 19:33109853-33109875 CAGCCGCTGCAGGGGAGAGCTGG - Exonic
1167468392 19:49662323-49662345 CTGCTGCCGCTGCTCAGAGTGGG - Exonic
925258305 2:2508031-2508053 CAGGCGGTGCAGCGCAGAGCAGG + Intergenic
925842900 2:8009178-8009200 CTGCTGCCTCAGCACAGGGCTGG + Intergenic
927964934 2:27262700-27262722 CGGCCGCCCCAGCGCACCGCGGG - Intronic
929218115 2:39437105-39437127 CGGCGGCCGCAGCGTGGAGCCGG - Exonic
929646985 2:43637557-43637579 CTCCCGCCACAGCCCAGAGTCGG + Intronic
932500413 2:72178265-72178287 CTGCCCCCACAGTGCAGAGCTGG + Exonic
942459480 2:176159487-176159509 CTGATGCCGCTGAGCAGAGCTGG + Intronic
944172976 2:196799736-196799758 CTGCAGCTGCGGCGCAGACCGGG - Intergenic
948632821 2:239312913-239312935 CCGCCCCCACAGTGCAGAGCTGG - Intronic
1171186787 20:23128630-23128652 CAGCGGCCTCAGCACAGAGCAGG - Intergenic
1172703253 20:36864988-36865010 GAGCCACCGCAGGGCAGAGCTGG + Intergenic
1172781327 20:37438505-37438527 CAGCCTCCCCAGCCCAGAGCAGG + Intergenic
1173197353 20:40926616-40926638 CTGCCTCCTCACCTCAGAGCAGG + Intergenic
1173884690 20:46446814-46446836 CTGCCCCAGCAGAGCAGAGAGGG + Intergenic
1175140819 20:56859340-56859362 CTCCCGCTGGAGCTCAGAGCTGG - Intergenic
1182863235 22:33579572-33579594 CTGCAGCCCCAGCCCAGGGCTGG + Intronic
1183456736 22:37927063-37927085 CTGCCTCCGCACTGCAGATCAGG + Intronic
1184110268 22:42390052-42390074 CTCCGGCAGCAGCTCAGAGCAGG + Intronic
1184239874 22:43206449-43206471 CTGCCCCCACAGCACAGAGGAGG - Intronic
1184438968 22:44497431-44497453 CTCCCGCCTCAGCGCCGAGTTGG + Exonic
1184523333 22:45008208-45008230 TGGCCGCCTCAGCGCAAAGCGGG + Intronic
1184657279 22:45948196-45948218 CTGGCCCCTCAGCGCTGAGCTGG - Intronic
950023624 3:9806289-9806311 CTGCCGCCGCCGCGCTGCTCGGG - Exonic
950612719 3:14136670-14136692 CTGTGGCCACAGCCCAGAGCGGG + Intronic
955060458 3:55488221-55488243 CCGCCTCCGCCGCCCAGAGCCGG - Intronic
962770875 3:138609079-138609101 CCGCCGCCGCCGCCCAGAGATGG - Intronic
964622717 3:158732640-158732662 TCGCCTCCGCAGCGCAGGGCCGG + Exonic
966892624 3:184418129-184418151 CTCCCTCCTCAGAGCAGAGCTGG - Intronic
968464653 4:744667-744689 CTACCACCGCAGCGACGAGCAGG + Exonic
969043644 4:4320736-4320758 CCGCCGGAGCACCGCAGAGCGGG - Exonic
970637108 4:18021677-18021699 CCGCCGCCGCCGCTCAGTGCCGG - Exonic
973713396 4:53651299-53651321 ATGCTGACGCAGTGCAGAGCAGG - Intronic
984862499 4:184253161-184253183 CAGCCGCCTCCCCGCAGAGCAGG + Intergenic
985896305 5:2751596-2751618 CGGCGGCAGCAGCGCGGAGCCGG + Exonic
987329388 5:16842458-16842480 CTGCCGCTGAAGCCCAGGGCTGG - Intronic
988547715 5:32174037-32174059 CTCCCGCCGAGGCGCCGAGCCGG + Exonic
988777202 5:34487986-34488008 CTGACCACGCAGAGCAGAGCAGG + Intergenic
989103531 5:37840423-37840445 CTGCCGGTGCAGGGCAGCGCCGG + Intergenic
991371750 5:65926186-65926208 CTGCCGCCGCCACCCGGAGCCGG - Intergenic
1000342353 5:160287635-160287657 AGGCCGCAGCAGCGCAGTGCAGG + Intronic
1001641046 5:173244391-173244413 CGGCCGCAGCAGCACAGGGCTGG - Intergenic
1002139834 5:177132275-177132297 GTGCCACCGCCGCCCAGAGCGGG - Intergenic
1004924111 6:20402581-20402603 CTGCCGCCGCGTCCCAGCGCTGG - Exonic
1006212269 6:32406398-32406420 CTGCCTCGGCACCGCAGAGCTGG - Intronic
1007410532 6:41658736-41658758 CTGCCCCCACAGCCCACAGCGGG - Intergenic
1011449020 6:87473190-87473212 CTGCAGCCGCAGCGGAAGGCAGG - Intronic
1016272249 6:142302207-142302229 GTCCCGCCGCGGCGCAGGGCTGG + Exonic
1018754362 6:166837027-166837049 CTGCACCCTCAGCGCTGAGCAGG + Intronic
1019175150 6:170155628-170155650 CTGCCTGTGCAGTGCAGAGCAGG - Intergenic
1019425686 7:975556-975578 CGGCCGGCGGAGCGCCGAGCAGG + Exonic
1019723876 7:2589983-2590005 CTGTCTGTGCAGCGCAGAGCTGG - Exonic
1019779172 7:2929642-2929664 CTGGGGCTGCAGCCCAGAGCAGG + Intronic
1023052457 7:36265074-36265096 TTGCCACCGCAGAGCAGAGCCGG + Intronic
1023054986 7:36283990-36284012 CGGCGGCAGCAGCGCAAAGCAGG + Intronic
1024099077 7:46010740-46010762 CCACCCCTGCAGCGCAGAGCAGG + Intergenic
1026909433 7:74083815-74083837 AAGCCGCCGCGGCGCCGAGCCGG + Intronic
1028641137 7:93043491-93043513 CAGCTGCCGCAGCCCAGCGCCGG + Intergenic
1033514537 7:142093240-142093262 CCGCCGTTGCAGCTCAGAGCTGG + Intronic
1034412201 7:150947515-150947537 CTGCAGCCAGAGAGCAGAGCTGG + Intronic
1035187680 7:157139087-157139109 CTCCCGCCCCAGGGCAGGGCTGG + Exonic
1035578625 8:725481-725503 CTGGCGCCTCAGTGCACAGCAGG - Intronic
1041068208 8:54102069-54102091 CTGCGGCGGCAGCGCGGACCTGG + Intergenic
1043502808 8:80873845-80873867 CCGCCGCCGCCGCGCAGCGCCGG - Intronic
1044599708 8:93991552-93991574 CTGCCCCCGCCGCGGGGAGCCGG - Intergenic
1045094751 8:98785553-98785575 CTGCCCCCTCAGGGCTGAGCAGG + Intronic
1049565316 8:143334999-143335021 CTGCTGCCGCAGCCCCGTGCAGG - Intronic
1049769846 8:144374707-144374729 CCGCCGCCTCAGGGCAGGGCAGG - Intronic
1049973588 9:841902-841924 GTACCGCCGCAGGGCAGAGCCGG + Exonic
1052993913 9:34539449-34539471 CTGCCCATGCAGGGCAGAGCGGG - Intergenic
1057227378 9:93299553-93299575 CTGGCGCCGGAGCACACAGCCGG - Intronic
1059320257 9:113463550-113463572 CTGCCGTCGCTGCTCAGCGCGGG + Intronic
1061821749 9:133232273-133232295 CTGACGAAGGAGCGCAGAGCTGG - Intergenic
1061889319 9:133609292-133609314 TCGCGGCCGCAGCGCGGAGCTGG - Intergenic
1062137675 9:134938306-134938328 TTGCAGCCACAGAGCAGAGCAGG - Intergenic
1062237500 9:135517820-135517842 CTGACGAAGGAGCGCAGAGCTGG + Intergenic
1062462992 9:136669624-136669646 CTACCGCCGCAGCCCTGGGCTGG + Exonic
1062696128 9:137877419-137877441 CTGGGGCTGCAGCCCAGAGCTGG - Intergenic
1190101128 X:47523816-47523838 CTCCCGCCGCAGCGCTGGGAGGG - Intergenic
1190844901 X:54182812-54182834 GAGCCGCGGCAGCGCCGAGCCGG + Exonic
1195702541 X:107716148-107716170 CGGCGGCAGCAGCGCTGAGCCGG - Intronic
1197749951 X:129957403-129957425 CTGTCGCCGCGGCGCAGGGCCGG - Intergenic