ID: 1147400464

View in Genome Browser
Species Human (GRCh38)
Location 17:40177728-40177750
Sequence CCGTGCCAGGCGCCAGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147400464 Original CRISPR CCGTGCCAGGCGCCAGACTG GGG (reversed) Intronic
900351676 1:2238024-2238046 CTGTGCCAGGCGCTGGGCTGTGG + Intronic
900367305 1:2316450-2316472 CAGAGCCAGGAGCCAGGCTGTGG - Intergenic
900669410 1:3841340-3841362 CCGTCCCAGCCGCCAGCCTGTGG - Intronic
903324999 1:22564332-22564354 CCCAGCCCGTCGCCAGACTGTGG - Intronic
904266764 1:29322839-29322861 CCCTCCCAGACTCCAGACTGTGG - Intronic
904822809 1:33256379-33256401 CCGCGCCAGGCGCCCGGCTCCGG - Intergenic
907373314 1:54016800-54016822 CAGTGCCAGGCACCTAACTGGGG + Intronic
912817791 1:112843480-112843502 CCGCGCCCGGCCCCAGATTGGGG - Intergenic
919181144 1:194083535-194083557 CCTTGCCAGATGCCAGACTCTGG + Intergenic
920805720 1:209231858-209231880 CCGTGCCCCGCGCCGGATTGGGG + Intergenic
924775154 1:247111315-247111337 CCGTGTCTGGCGCGAGGCTGGGG - Exonic
1067552975 10:47248013-47248035 CCAGGCCCGGCCCCAGACTGAGG + Intergenic
1069890737 10:71650863-71650885 CCCTGCCAGGCCCCAGACACTGG - Intronic
1069991958 10:72321540-72321562 CTGGGGCAGACGCCAGACTGGGG - Intergenic
1071511307 10:86264235-86264257 CCTGGCCAGGCTCCAGAGTGGGG - Intronic
1072818286 10:98531034-98531056 CCGTGCCAGGCACTATACTATGG + Intronic
1073442299 10:103559346-103559368 GTGTGCCAGGCGCCAGGCTGAGG - Intronic
1075080207 10:119378551-119378573 CCGTTCCAGGAGGCAGACAGCGG + Intronic
1076828302 10:132981507-132981529 CCTTGCCATGCCCCAGCCTGGGG - Intergenic
1077304951 11:1864829-1864851 CTGTGCCAGGTGCCAGAGGGAGG + Intronic
1078102138 11:8336268-8336290 CCGTGCCAGGCACCAGGCTGTGG + Intergenic
1084600071 11:70140028-70140050 CCGTGCCAGGCCCCGGGCTAAGG + Intronic
1085468096 11:76737829-76737851 ACGTTCCAAGGGCCAGACTGGGG + Intergenic
1088466414 11:110145035-110145057 CCCTTCTAGGCCCCAGACTGAGG + Intronic
1089122265 11:116145705-116145727 CCTTGCCAGGTGCCAGACCTGGG - Intergenic
1090422280 11:126583728-126583750 GCGTGCCAGGCACCGTACTGAGG - Intronic
1091284359 11:134399790-134399812 CTGTGCCAGGCTCCATGCTGTGG - Intronic
1091589675 12:1835837-1835859 CGGTGCCAGGCTGCAGGCTGTGG - Exonic
1092992928 12:13920606-13920628 CAGTGAGAGGCTCCAGACTGAGG + Intronic
1096109143 12:49018837-49018859 TCATGGCAGTCGCCAGACTGGGG + Intronic
1098725947 12:73966899-73966921 CCGTGCCCGGCCCCAGATTTGGG + Intergenic
1100641449 12:96485512-96485534 CTGTGCCAGGTGCCAGATTTGGG + Intergenic
1101737543 12:107474356-107474378 CCGTCCCAGGGGCCTGACTCAGG - Intronic
1102472597 12:113168033-113168055 CCCTGCGTGGCGCCCGACTGAGG + Intronic
1103779329 12:123388921-123388943 CCGGGCCGGGCGCCGGACGGTGG + Intronic
1103837071 12:123830125-123830147 CCGTGCCAGGCAGTGGACTGGGG - Intronic
1103967370 12:124648264-124648286 GTGTGCCAGGCACCAGCCTGAGG - Intergenic
1104021238 12:124993804-124993826 CCGGGCCAGGGGCCCGCCTGAGG - Exonic
1105213442 13:18271239-18271261 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
1107357805 13:39586864-39586886 CCGTGCCTGGCCCCAAGCTGAGG - Intronic
1113227558 13:108176042-108176064 CTGTGCCAGTCACCAGGCTGTGG + Intergenic
1116244469 14:42392160-42392182 CCGGCCCTGGCCCCAGACTGTGG - Intergenic
1117736001 14:58769268-58769290 CCCTTCCAGGCCACAGACTGTGG + Intergenic
1119286891 14:73462399-73462421 GCGTGCCAGGCTCCAGCCTATGG + Intronic
1119323320 14:73744273-73744295 CAGGGCAAGGGGCCAGACTGTGG + Intronic
1119480079 14:74953557-74953579 GAGTGCCAGGGGCCAGAATGGGG - Intronic
1120887245 14:89461305-89461327 CCAGGCCAGGCGACAGAGTGAGG + Intronic
1122293491 14:100692334-100692356 CCCTGCCCGGCGCCGGGCTGGGG + Intergenic
1122650217 14:103221836-103221858 CCGAGGCAGGCCACAGACTGGGG + Intergenic
1125516177 15:40322694-40322716 CCAGGCCAGGCGCCAGGCAGTGG - Intergenic
1131160493 15:90102076-90102098 CCGTGCCAGGCGCTGGGGTGGGG - Intronic
1134086489 16:11360906-11360928 CGGGGCCAGCCGCCAAACTGGGG - Intronic
1134128043 16:11629867-11629889 ACTTGCCATGCGCCAGGCTGTGG - Intronic
1137977393 16:53042953-53042975 TTGTGCCAGGCGCCATGCTGAGG - Intergenic
1138583176 16:57954820-57954842 CGGTGCCAGGTACCACACTGGGG + Intronic
1138658095 16:58502094-58502116 CCCTGCCAGGTGCCAGTCTCAGG - Intronic
1139649507 16:68355314-68355336 CGGTGCCTGGCGGCAGGCTGGGG - Intronic
1141046788 16:80722798-80722820 CCATGCCAGGAGACAGACTACGG + Intronic
1142240385 16:88941939-88941961 CCGGGCCAGGCGCCGCGCTGGGG - Intronic
1142946644 17:3435033-3435055 CCGTGCCCGGCCACACACTGTGG + Intergenic
1143513115 17:7406587-7406609 CAGAGCCAGGCGCCAGCCCGCGG - Intronic
1143563539 17:7708705-7708727 CCTTCCCAGGCTCCAGGCTGTGG - Exonic
1145995396 17:29102158-29102180 CCATGCCAGGTGCCCGGCTGAGG - Intronic
1147315347 17:39617773-39617795 CCGTGCCAGGCGCGGGGCGGGGG - Intergenic
1147400464 17:40177728-40177750 CCGTGCCAGGCGCCAGACTGGGG - Intronic
1147582538 17:41635423-41635445 CGGTGCCAGCCACCAGCCTGCGG - Intergenic
1147925345 17:43942360-43942382 CCATCCCAGGCCCCAGCCTGGGG + Intronic
1148698242 17:49573918-49573940 CCGTGCCAGGCGCCAGGCCAGGG - Intergenic
1149544648 17:57494394-57494416 TGGTGCCAGGAGACAGACTGTGG + Intronic
1150618626 17:66791599-66791621 CCGTGCCAGGCAGCCGAGTGAGG + Intronic
1152120938 17:78417816-78417838 CGCTGCCAGGCGCCCCACTGAGG + Intronic
1152528321 17:80902363-80902385 CCGGGCCAGGGGCCAGCCAGGGG - Intronic
1152641651 17:81451919-81451941 CCGGGCCAGGGCCCAGGCTGGGG - Intronic
1152657488 17:81526814-81526836 ACGTGCCAGGCACCATCCTGGGG - Intergenic
1157579313 18:48764258-48764280 GTGTGCCAGGCACCAGCCTGGGG + Intronic
1159511279 18:69400896-69400918 CCGAGCGAGGCGCCAGCCCGTGG + Intergenic
1160372568 18:78386632-78386654 GTGTGCCAAGTGCCAGACTGTGG + Intergenic
1160739591 19:679837-679859 CCTTGCCAGGCGCGAGTCTGGGG - Intronic
1161324536 19:3657120-3657142 GGGTGCCAGGGGCCAGAGTGGGG - Intronic
1163272529 19:16262774-16262796 CGGTGCCAGGCTCCAGGCTGGGG - Intergenic
1164735580 19:30538683-30538705 CCCTGCCTGGAGCCAGAGTGAGG - Intronic
926425287 2:12734163-12734185 CCCTGCCAGCCACCAGCCTGGGG - Intronic
928297997 2:30102118-30102140 TGGTGCCAGGTGCCAAACTGGGG + Intergenic
934300882 2:91775505-91775527 CAGTGCCAGGCTCTAGGCTGAGG + Intergenic
939189839 2:138902789-138902811 CAGTGCCTGTCCCCAGACTGAGG - Intergenic
1170574144 20:17649856-17649878 CACTGCCAGGCTCCAGAATGTGG + Intronic
1174396717 20:50251190-50251212 CAGTGCCAGGAACCAGCCTGGGG - Intergenic
1176095793 20:63343794-63343816 CTGTGCCAGGCACCAGGCAGCGG - Intronic
1179176872 21:39014246-39014268 CAGTGCCAGGCACCTGACAGTGG - Intergenic
1180816274 22:18791639-18791661 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
1180917621 22:19499859-19499881 CTGTGCCAGGTGACAGCCTGGGG - Intronic
1181202463 22:21225971-21225993 CAGTGCCAGGCTCTAGGCTGGGG - Intronic
1181236018 22:21448141-21448163 CAGTGCCTGGCTCCAGGCTGGGG - Exonic
1181699244 22:24610643-24610665 CAGTGCCAGGCTCTAGGCTGGGG + Intronic
1182105590 22:27686755-27686777 CAGTGCCAGGCAGCAGACAGTGG + Intergenic
1183377443 22:37473451-37473473 CAATGCCAGGCACCACACTGGGG - Intronic
1183520245 22:38292692-38292714 CCAAGCCAGGCCCCAGAGTGGGG + Intronic
1183601793 22:38844150-38844172 CAGTGCCGGGCGCCCGGCTGGGG + Intergenic
1184648076 22:45906943-45906965 CCGTGCCAGGCCCCAAATTCTGG + Intergenic
1184793885 22:46719879-46719901 CCATGCCAGGGTCCAGGCTGTGG + Intronic
1185365608 22:50435299-50435321 CCCTGCCAGGCGTCAGCGTGTGG + Intronic
1203224450 22_KI270731v1_random:69442-69464 CAGTGCCAGGCTCTAGGCTGGGG + Intergenic
1203266377 22_KI270734v1_random:17350-17372 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
949133205 3:530550-530572 CTGTGCCAGGGATCAGACTGAGG - Intergenic
949501663 3:4686020-4686042 GGGTGCCAGGCGCCATGCTGAGG + Intronic
950069673 3:10142141-10142163 CCGTGCCAGGCGGCAGCGTTGGG - Exonic
950172652 3:10850393-10850415 CTATGCCAGGCACCAGGCTGGGG + Intronic
952862791 3:37828762-37828784 CTCTGCCAGGCACCAGTCTGGGG + Intergenic
953562115 3:43999399-43999421 CCCTGCCCGGCGCCAGCCCGCGG + Intergenic
955348729 3:58179175-58179197 CCATGCCAGGCCCCGGGCTGGGG - Intergenic
956836021 3:73096784-73096806 ACGTGCCAGGCCCCAGCCTGCGG + Intergenic
958785719 3:98594182-98594204 CCGCGCCCGGCCCCAGCCTGGGG - Intergenic
961367875 3:126412919-126412941 ACTTGCCATGGGCCAGACTGGGG - Intronic
962419622 3:135216430-135216452 CCGTGCCCGGCTCAAGACTGAGG - Intronic
963306703 3:143661445-143661467 CAGTGCCAGGTGCCACAGTGGGG - Intronic
968562255 4:1290175-1290197 CCCTGCCAGGCGCCCGACTGTGG + Intronic
969257393 4:6011574-6011596 CAGCGCCAGGCCACAGACTGAGG - Intergenic
969534316 4:7746661-7746683 CTGTGCCAGGCAGCAGAGTGTGG + Intergenic
971451575 4:26806047-26806069 CAGTGCCAGGCAGCAGAGTGGGG - Intergenic
976751945 4:88457645-88457667 CCGAGCCAGGCGCGCGTCTGCGG - Intronic
983403977 4:167301907-167301929 CAGTGGCAGGTGCCAAACTGGGG - Intergenic
986682419 5:10246137-10246159 CTGTGCCAGGCCCCAGAATAGGG - Intronic
990954666 5:61331003-61331025 GCGTGCCAGGCGGCGGACGGCGG - Intergenic
994053455 5:95389089-95389111 CCATTCCAGGCCCCAGACTATGG - Intergenic
998176286 5:139904103-139904125 GCGTGCCAGGAGCCCGACAGTGG - Intronic
999110385 5:149115438-149115460 CTGTGCCAGGCACCATTCTGAGG + Intergenic
1001557038 5:172643632-172643654 CCTTGCCAGGCACCAGTCTCTGG - Intronic
1002276577 5:178107927-178107949 CTGGGCCAGGCCCCAGCCTGAGG - Intergenic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1006509674 6:34515177-34515199 CCGGGCCAGGGACCAGGCTGGGG + Intronic
1011740231 6:90352309-90352331 CAATGCCAGGCACCAGACTAGGG - Intergenic
1015088175 6:129321456-129321478 GCATGCCAGGCTTCAGACTGTGG - Intronic
1019049807 6:169174173-169174195 AGGTGCCAGGCCCCAGGCTGTGG - Intergenic
1019328380 7:450806-450828 CCTTGCCAGGCCCCTGCCTGTGG - Intergenic
1019393287 7:802092-802114 CCTCGCCAGATGCCAGACTGAGG + Intergenic
1019537285 7:1535855-1535877 CCTTTCCAGGATCCAGACTGAGG - Intronic
1019640539 7:2101257-2101279 CTGTGCCTGGCGCGAGACTGGGG + Intronic
1019656635 7:2199615-2199637 CCGTGCCAGGCGGGGCACTGCGG - Intronic
1019725089 7:2597484-2597506 CCGGGCCAGGCGCCAGGCGCAGG - Intronic
1021698178 7:23293602-23293624 CTGTGCCAGGCGCTGGACTAAGG - Intergenic
1025941382 7:66078176-66078198 CGGTGCCAGGCTCCTGGCTGAGG + Intronic
1033756510 7:144401346-144401368 CCGCTCCAGGCCCCAGACTCAGG - Exonic
1035026811 7:155831590-155831612 CTCTGCCAGGCTCCAGGCTGAGG - Intergenic
1035031902 7:155866290-155866312 CCGGTCCAGGCGGCAGAGTGGGG + Intergenic
1037781147 8:21869953-21869975 CCATGCCAGGCCCCAGATAGAGG + Intergenic
1038005217 8:23424173-23424195 CCATCCCTGGGGCCAGACTGTGG + Intronic
1039739019 8:40362846-40362868 CATTGCCAGGAGTCAGACTGAGG - Intergenic
1045098940 8:98825876-98825898 CCGCGCCGGCCGCCAGCCTGCGG + Intronic
1047213469 8:122858405-122858427 CTGTGCCAGGCACCAGAAGGGGG - Intronic
1048366825 8:133745601-133745623 CTGTGCCAGGCACCATGCTGAGG - Intergenic
1049952210 9:656200-656222 CTGGGAAAGGCGCCAGACTGTGG - Intronic
1051431245 9:16983209-16983231 CCGTCCCTGCCGCCTGACTGTGG + Intergenic
1051497248 9:17737182-17737204 CCCTGACAGGCGCCAGTGTGTGG - Intronic
1055514691 9:77023069-77023091 CGGTCCCAGGCCCCAGGCTGTGG - Intergenic
1059424048 9:114209788-114209810 ACCTGCCAGGCACCAGCCTGGGG + Intronic
1061217488 9:129230172-129230194 CTCTGCCAGGCCCCACACTGGGG - Intergenic
1190443774 X:50502472-50502494 CAGTGCCAGGCACGATACTGTGG + Intergenic