ID: 1147400573

View in Genome Browser
Species Human (GRCh38)
Location 17:40178073-40178095
Sequence CTCCAGCCCCGGCTCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 227}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147400573_1147400579 -10 Left 1147400573 17:40178073-40178095 CCCCCGCCGAGCCGGGGCTGGAG 0: 1
1: 0
2: 3
3: 16
4: 227
Right 1147400579 17:40178086-40178108 GGGGCTGGAGCCGCCCCCTGAGG 0: 1
1: 1
2: 2
3: 46
4: 377
1147400573_1147400593 20 Left 1147400573 17:40178073-40178095 CCCCCGCCGAGCCGGGGCTGGAG 0: 1
1: 0
2: 3
3: 16
4: 227
Right 1147400593 17:40178116-40178138 AGGAGAGCCGGCGGGGGTCGCGG 0: 1
1: 0
2: 2
3: 33
4: 354
1147400573_1147400590 12 Left 1147400573 17:40178073-40178095 CCCCCGCCGAGCCGGGGCTGGAG 0: 1
1: 0
2: 3
3: 16
4: 227
Right 1147400590 17:40178108-40178130 GAGGAAGGAGGAGAGCCGGCGGG 0: 1
1: 0
2: 7
3: 105
4: 870
1147400573_1147400589 11 Left 1147400573 17:40178073-40178095 CCCCCGCCGAGCCGGGGCTGGAG 0: 1
1: 0
2: 3
3: 16
4: 227
Right 1147400589 17:40178107-40178129 GGAGGAAGGAGGAGAGCCGGCGG 0: 1
1: 1
2: 9
3: 172
4: 1417
1147400573_1147400591 13 Left 1147400573 17:40178073-40178095 CCCCCGCCGAGCCGGGGCTGGAG 0: 1
1: 0
2: 3
3: 16
4: 227
Right 1147400591 17:40178109-40178131 AGGAAGGAGGAGAGCCGGCGGGG 0: 1
1: 0
2: 0
3: 52
4: 559
1147400573_1147400583 0 Left 1147400573 17:40178073-40178095 CCCCCGCCGAGCCGGGGCTGGAG 0: 1
1: 0
2: 3
3: 16
4: 227
Right 1147400583 17:40178096-40178118 CCGCCCCCTGAGGAGGAAGGAGG 0: 1
1: 0
2: 1
3: 32
4: 258
1147400573_1147400588 8 Left 1147400573 17:40178073-40178095 CCCCCGCCGAGCCGGGGCTGGAG 0: 1
1: 0
2: 3
3: 16
4: 227
Right 1147400588 17:40178104-40178126 TGAGGAGGAAGGAGGAGAGCCGG 0: 1
1: 0
2: 16
3: 217
4: 1919
1147400573_1147400592 14 Left 1147400573 17:40178073-40178095 CCCCCGCCGAGCCGGGGCTGGAG 0: 1
1: 0
2: 3
3: 16
4: 227
Right 1147400592 17:40178110-40178132 GGAAGGAGGAGAGCCGGCGGGGG 0: 1
1: 0
2: 2
3: 64
4: 678
1147400573_1147400596 29 Left 1147400573 17:40178073-40178095 CCCCCGCCGAGCCGGGGCTGGAG 0: 1
1: 0
2: 3
3: 16
4: 227
Right 1147400596 17:40178125-40178147 GGCGGGGGTCGCGGAGGAGCCGG 0: 1
1: 0
2: 7
3: 83
4: 783
1147400573_1147400580 -7 Left 1147400573 17:40178073-40178095 CCCCCGCCGAGCCGGGGCTGGAG 0: 1
1: 0
2: 3
3: 16
4: 227
Right 1147400580 17:40178089-40178111 GCTGGAGCCGCCCCCTGAGGAGG 0: 1
1: 0
2: 2
3: 26
4: 189
1147400573_1147400581 -3 Left 1147400573 17:40178073-40178095 CCCCCGCCGAGCCGGGGCTGGAG 0: 1
1: 0
2: 3
3: 16
4: 227
Right 1147400581 17:40178093-40178115 GAGCCGCCCCCTGAGGAGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 170
1147400573_1147400594 23 Left 1147400573 17:40178073-40178095 CCCCCGCCGAGCCGGGGCTGGAG 0: 1
1: 0
2: 3
3: 16
4: 227
Right 1147400594 17:40178119-40178141 AGAGCCGGCGGGGGTCGCGGAGG 0: 1
1: 0
2: 3
3: 30
4: 354
1147400573_1147400597 30 Left 1147400573 17:40178073-40178095 CCCCCGCCGAGCCGGGGCTGGAG 0: 1
1: 0
2: 3
3: 16
4: 227
Right 1147400597 17:40178126-40178148 GCGGGGGTCGCGGAGGAGCCGGG 0: 1
1: 2
2: 4
3: 60
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147400573 Original CRISPR CTCCAGCCCCGGCTCGGCGG GGG (reversed) Intronic
900091141 1:921219-921241 CTCCAGCCTCAGCCCAGCGGCGG + Intergenic
900422383 1:2561180-2561202 CTCCATCCCAGGCTCCGCTGGGG - Intronic
901467078 1:9429070-9429092 CTCCAATCCCGCCTCGGGGGCGG - Intergenic
902513701 1:16979242-16979264 ATCCAGCCCCAGCTCAGTGGAGG + Intronic
904413903 1:30343041-30343063 CTCCAGCCGCGGCTGGGCCCTGG - Intergenic
904642007 1:31938131-31938153 CACCCGGCCCGGCCCGGCGGCGG + Exonic
905648199 1:39639435-39639457 CTCCAGCACCGCCTGGGCAGAGG - Intronic
906672206 1:47664553-47664575 CTCCAGCTCTGCCTCGGGGGTGG - Intergenic
908501008 1:64744586-64744608 CTCCAGCCCCATCTCGGGTGTGG + Intergenic
911591726 1:99755393-99755415 CTCCAGCCTGGGGTCGGAGGGGG + Intronic
914827575 1:151146601-151146623 GTCCAGCCGCGGATCCGCGGAGG + Intronic
919097818 1:193059085-193059107 CTCCAGACGCGGGGCGGCGGTGG + Intronic
919712182 1:200739298-200739320 CTCAGGCCCCGGGTGGGCGGAGG - Intergenic
920237268 1:204516463-204516485 CCCCCACCCGGGCTCGGCGGGGG + Exonic
920379867 1:205529148-205529170 CTCCAGCCCAGGCGCGGAGCGGG + Intronic
923728068 1:236524224-236524246 ACCCAGCCCCGGCTCTGCCGCGG - Intronic
924539757 1:244970323-244970345 CTCCAGGCCAGGCTCGCCGCGGG + Exonic
924554900 1:245109838-245109860 TTCCTGCCTCAGCTCGGCGGTGG + Intronic
1062823154 10:549661-549683 CTCCAGCACCTGGTCGGGGGGGG - Intronic
1062971266 10:1651292-1651314 ATCGAGCCCTGGCTCGGCGAAGG + Intronic
1067391153 10:45865381-45865403 CTGCCGCCCCGTCTGGGCGGTGG - Intergenic
1067836830 10:49646606-49646628 CTCCAGCTCCTTCACGGCGGAGG + Exonic
1068910536 10:62374481-62374503 CTGCGCCCGCGGCTCGGCGGAGG + Intronic
1069651414 10:70052726-70052748 CGCCAGCCCAGGCTCCGCGACGG - Intergenic
1069912472 10:71767874-71767896 CTCCAGCCCCGGATGCACGGAGG - Intronic
1069957433 10:72060653-72060675 CTCCAGCCCCGGCTCAGTTCAGG - Exonic
1070678617 10:78433320-78433342 CTCCAGCTCCAGCTCAGTGGGGG + Intergenic
1072152131 10:92691634-92691656 CCCCAGGCCCGGCCCGGCTGAGG - Intronic
1072926594 10:99621396-99621418 CTCCAGCCCCGCCTCGCCACCGG - Intergenic
1076870322 10:133189698-133189720 GTCCAGCACCGGCTCGCCAGGGG + Intronic
1076871184 10:133195880-133195902 CTCCACCCCCAGCTCAGCGAGGG - Intronic
1076947185 10:133659444-133659466 TTCCAGCCCCGGCTCTGCAAAGG + Intergenic
1077376889 11:2209392-2209414 TCCCAGCCCAGGCTGGGCGGGGG + Intergenic
1080015912 11:27506689-27506711 GTGCAGCCGAGGCTCGGCGGAGG - Intronic
1080387321 11:31817773-31817795 CTCCGGCCCCGGCCCGGCTCGGG - Intronic
1081699947 11:45146702-45146724 CGCCAGCCTCGGCGCGGCGGCGG - Intronic
1081832076 11:46122075-46122097 CTCCGGCCTCGCCTCGGCTGCGG - Intergenic
1083679657 11:64345251-64345273 CTCCAGCCCCAGCTCAGTGCTGG - Intronic
1083812298 11:65112605-65112627 CTCCAGCCCCGGCAGGGACGCGG - Exonic
1084043888 11:66558034-66558056 CTCCAGCCCCCGCCAGGCGTTGG - Exonic
1084189686 11:67493332-67493354 CTCCACCCCCGGATCGGCGGAGG - Intronic
1084934247 11:72578640-72578662 CACCAGCCCCAGCTTGGCAGTGG + Intronic
1085561265 11:77474203-77474225 CCCCCTCCCCGGCGCGGCGGCGG + Intronic
1088647235 11:111926983-111927005 CTCCAGCCGCGGCCTGGGGGTGG - Intergenic
1090805724 11:130200936-130200958 CTCCAGCTCTGGCTTGCCGGTGG + Intronic
1092426375 12:8378909-8378931 CTGCAGCCCCGGCTTAGCTGGGG - Intergenic
1094470361 12:30796535-30796557 TTCCAGCCCCGGCTCTGGTGGGG + Intergenic
1096928282 12:55173490-55173512 CCCCAGCCCCAGCTGGGTGGAGG - Intergenic
1097107692 12:56635026-56635048 CCCCAGCCCTGGGCCGGCGGCGG + Intronic
1097872108 12:64610435-64610457 CTCCAGGCGCGGCTCGGCCCCGG - Intergenic
1102375686 12:112419223-112419245 CTCCCGCCCCGGGTCGGGGTTGG + Intronic
1103362437 12:120361997-120362019 CAGCAGGCCCGGCTCGGCTGCGG - Intronic
1104814180 12:131636551-131636573 CTCCAGCCCCTGCTCTCCTGTGG - Intergenic
1104980061 12:132569725-132569747 CTCCAGGCCCCGCCCGGCGGAGG - Intronic
1108541504 13:51451744-51451766 CTCCCGGCCCGGCCCGGCAGCGG - Intronic
1112733672 13:102394641-102394663 TCCCAGCCTCGGCTCGCCGGGGG - Intronic
1113254851 13:108495736-108495758 CTCCGCCACCCGCTCGGCGGCGG - Intergenic
1113656034 13:112068228-112068250 CGCCTACCCCGGCTCGGTGGCGG + Exonic
1113949088 13:114061197-114061219 CTCCACCCCCGCCACGGCCGGGG + Intronic
1118289387 14:64505318-64505340 TTACAGCTGCGGCTCGGCGGCGG + Intronic
1119410365 14:74426322-74426344 CTCCGGACCCGGCTCCGGGGCGG + Intergenic
1121035832 14:90702864-90702886 CTCCAGCCACGGCTTTGGGGTGG + Intronic
1122784588 14:104157880-104157902 CCCCACCCCGGGCTCGGTGGGGG + Exonic
1122862894 14:104590379-104590401 CTCCAGCCCCGGTTCTGACGGGG + Intronic
1122987629 14:105219869-105219891 CTCCAGTGTCGGCTCGGGGGCGG - Intronic
1124374800 15:29123233-29123255 CTTCAGGCCCAGCTTGGCGGAGG - Exonic
1127387359 15:58477340-58477362 CTCCAGCCCCGGAACTGTGGTGG - Intronic
1127414892 15:58749020-58749042 CCCCAGCCCCTGCCCGGTGGCGG - Intronic
1128109624 15:65068141-65068163 CTCGAGGCCCAGCCCGGCGGTGG - Intronic
1128315114 15:66655132-66655154 CTCCCGGCCCGGCTCCGCGCTGG + Intronic
1128350658 15:66886249-66886271 CTTCAGCCCTGGCTGGGCTGAGG - Intergenic
1129045308 15:72728862-72728884 CTCCAGCCCTGCCTCTGTGGTGG + Intronic
1129458770 15:75689502-75689524 CTCCAGCACCAGCTGGTCGGAGG + Exonic
1129472182 15:75762060-75762082 CTCCATCCCCGGCTATGCTGTGG + Intergenic
1129676000 15:77632687-77632709 CGCCGGCCCCGGCCCCGCGGCGG - Intronic
1129799794 15:78405532-78405554 TTCCAGCCCCGGCGGGGCTGTGG - Intergenic
1130227869 15:82073424-82073446 CTCCAGCCCCAACTCGGAAGAGG + Intergenic
1131195601 15:90352385-90352407 CTCCATCCCCGGCTGGGCCCTGG + Exonic
1131367673 15:91853755-91853777 CTCCAGCCCCGGCAGGACGGGGG + Exonic
1132842298 16:1984083-1984105 CCCCAGCCCCGGCTCGGGCCCGG + Intronic
1133249986 16:4474487-4474509 CTCCATCCCCGCCTCTGCAGTGG - Exonic
1133273767 16:4624807-4624829 CCCCACCCCCGGCTCGGCCCGGG - Exonic
1138106135 16:54287916-54287938 GGCCAGCCCCAGCTCGGAGGCGG + Intergenic
1140034890 16:71364475-71364497 CTCCAGCCCCAGCCTGCCGGCGG + Intronic
1140364543 16:74371085-74371107 CTCCAGCACCGGCATGGCTGTGG + Intergenic
1142110671 16:88329444-88329466 CCCCAGCCCCTGCTTGGCTGTGG - Intergenic
1142136360 16:88453583-88453605 CTCTAGCCCCGGGCGGGCGGCGG - Exonic
1142305122 16:89280437-89280459 CTCCAGCCCCGGCTCAGCGACGG + Exonic
1142836838 17:2593811-2593833 CTCGAGCCCCGGAACGGCTGAGG + Exonic
1144756476 17:17682828-17682850 CGCCAGCCCGGGCTCCGCGCAGG - Intronic
1144930999 17:18858457-18858479 CTCCCGCCAGGGGTCGGCGGGGG + Intronic
1145746469 17:27323797-27323819 CTGCAGCCCGGGCTGGGCGGAGG + Intergenic
1146277588 17:31525128-31525150 CTCCAGAGCCTGCTCGGCCGTGG - Exonic
1146371154 17:32266201-32266223 CCCCAGCCCGGGCCCCGCGGTGG + Exonic
1146624127 17:34423165-34423187 CTCCAGCCCCTGCACTGAGGTGG + Intergenic
1147400573 17:40178073-40178095 CTCCAGCCCCGGCTCGGCGGGGG - Intronic
1147856397 17:43483732-43483754 CTCCCGCCCTGGGTCGGCAGAGG - Intergenic
1148075789 17:44934591-44934613 CTCCAGCAGCTGCTCGGCTGAGG + Exonic
1150747129 17:67825430-67825452 CTCCGTCCCAGGCTCGTCGGCGG + Intergenic
1151370739 17:73644878-73644900 CGCCAGCCGCGGGGCGGCGGGGG + Intergenic
1151370768 17:73644989-73645011 CTCCGGCCGGGGCGCGGCGGAGG - Intergenic
1151370834 17:73645206-73645228 CCGCAGCTCCGGCTCGGCGCAGG - Intergenic
1151780140 17:76240252-76240274 CTGCAGCCCCGGCCCGGCCCCGG + Exonic
1152461549 17:80444739-80444761 CTCCAGCCCTGGGTCGGGAGAGG - Intergenic
1152729129 17:81961265-81961287 CCGCCGCCCGGGCTCGGCGGAGG + Exonic
1152729170 17:81961397-81961419 CTCCCGGCCCGGCTCCGTGGGGG + Intronic
1158954301 18:62524151-62524173 GTGGAGCCCCGGGTCGGCGGCGG + Exonic
1160395050 18:78564620-78564642 CTCCGGCCCCTGCAAGGCGGTGG - Intergenic
1160455387 18:78995479-78995501 CTCCAGCCCCGGCTGCGGTGCGG + Intronic
1160930688 19:1568258-1568280 CTCTGGCTGCGGCTCGGCGGCGG + Intergenic
1160960607 19:1719050-1719072 CCCCAGCCCCGCTGCGGCGGCGG - Intergenic
1161132471 19:2599342-2599364 ATCCAGCCTCGGCTGGGAGGAGG - Intronic
1161224393 19:3136365-3136387 CTCCAGGGCCGGCTGGGCTGGGG + Exonic
1161480014 19:4505748-4505770 CTCCAGCACTGGCGCGGCGAGGG - Intronic
1161993464 19:7698474-7698496 CTCCATCCCCAGCTGGGAGGTGG - Intronic
1162366333 19:10251936-10251958 TTCCTGCACCGGCTCGTCGGAGG + Intronic
1163427251 19:17246181-17246203 CTCCCGCCGCGGCCCGGCAGGGG - Intronic
1163668472 19:18613861-18613883 CTCCAGCCCCGCCTGGGGGAGGG - Exonic
1164160639 19:22623612-22623634 GCCCAGCCCCTGCCCGGCGGTGG + Intergenic
1164179548 19:22807139-22807161 GCCCAGCCCCTGCCCGGCGGTGG - Intergenic
1165204522 19:34172460-34172482 CTCAAGCCGCGGCGCGGCGGCGG - Intergenic
1166373104 19:42313346-42313368 CTCCGGCCCCGGCTCCGCTCCGG - Exonic
1166543282 19:43619570-43619592 CCCCCGCTCCGGCTCTGCGGCGG + Exonic
1167464313 19:49642201-49642223 CTCCGGCCCCGGCGCGGGGCGGG - Exonic
1168173706 19:54607962-54607984 CTCCAGCCCCAGCTGCCCGGGGG - Intronic
1168420207 19:56197019-56197041 CTGCAGCCCCAGCTAGGTGGAGG + Intronic
1168637957 19:58010757-58010779 CTCCAGCCCCGGGCGGCCGGCGG + Exonic
925133932 2:1513335-1513357 CTCCAGCCAGGGCTCGTAGGAGG - Intronic
930031941 2:47063759-47063781 CTCCAGCCCAGGCTTGTGGGTGG - Intronic
931869039 2:66439902-66439924 CGCCACCCCCGGCTCGCGGGGGG - Exonic
933833023 2:86225712-86225734 CTCCAGCCCTGGTGCCGCGGAGG - Intronic
935349692 2:102142706-102142728 CTCTAGCCCCGCCGCTGCGGGGG - Intronic
937472855 2:122188741-122188763 CACCAGCCCCAGCTGGGTGGAGG - Intergenic
938064175 2:128272155-128272177 CTCCAGCCCCTCCACGGCAGAGG - Intronic
941110747 2:161416988-161417010 CACCAGCCCCGGCTGGGTGGAGG - Exonic
943669790 2:190648855-190648877 CCCCCGCCCCCGCCCGGCGGCGG + Intronic
945225878 2:207530486-207530508 CTCCGCGCCCGGCCCGGCGGCGG - Intronic
946275819 2:218630818-218630840 CTCCAGCCCAGGCTCTGCTGTGG + Intronic
948478123 2:238234411-238234433 CTCCAGCCCCGCCCCGCCAGAGG - Intergenic
948835466 2:240624130-240624152 CTCCAGTCCCTGCTTGACGGCGG + Intronic
1168883476 20:1226310-1226332 CTCCAGCCCCAGCTGGGCTGCGG - Intronic
1168996250 20:2135336-2135358 CACCAGCCCCTGCTCAGCAGGGG - Intronic
1169214734 20:3786518-3786540 CCCCCGCCCCGGGGCGGCGGCGG - Exonic
1169264727 20:4160932-4160954 CTCCAGCCCCGGGGAGGGGGTGG - Intronic
1170579460 20:17686934-17686956 CTCCAGCCTGGGCTTGGCTGGGG + Intergenic
1173806025 20:45925846-45925868 CTCAAGCCCAGCCTAGGCGGGGG + Intergenic
1175926544 20:62474234-62474256 CTCCAGGCCCGGCCCGGCGCCGG + Intronic
1176242685 20:64082437-64082459 CCCCAGCCCCGGCCAGGGGGTGG - Intronic
1176548054 21:8209881-8209903 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1176555947 21:8254091-8254113 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1176566985 21:8392916-8392938 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1176574884 21:8437126-8437148 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1176611499 21:8988422-8988444 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1180004608 21:45014567-45014589 AACCAGGCCCTGCTCGGCGGGGG - Intergenic
1180708949 22:17826733-17826755 CTGCAGCCCTGGGCCGGCGGTGG - Intronic
1180843668 22:18970513-18970535 GCCCAGCCCCGGCCCGGCAGCGG - Intergenic
1181185795 22:21102863-21102885 CTCCCGCTCCTGCTCGGCGTGGG - Intergenic
1181512986 22:23397105-23397127 CCCCAGCCCCGGCCTGGCTGCGG - Intergenic
1183702164 22:39457104-39457126 CCCCCGGCCCGGCGCGGCGGCGG + Intergenic
1184035282 22:41915095-41915117 CTCCCGCTCGGGCTCGGCGCGGG + Intergenic
1184038178 22:41928405-41928427 CTCCAGCCCTGGCCCTGGGGAGG - Intergenic
1185038262 22:48490532-48490554 CTCCAGCCTCGGCGCTGGGGAGG + Intronic
1203252933 22_KI270733v1_random:126181-126203 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1203260988 22_KI270733v1_random:171262-171284 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
950153769 3:10707785-10707807 CTCCCGCCCTGGCCCGGCGGGGG + Intronic
950454756 3:13086016-13086038 CTCCAGCGCCAGCCCTGCGGCGG - Intergenic
953761400 3:45689755-45689777 CGCCGACCCCGGCTCGGTGGGGG - Intronic
954063585 3:48088776-48088798 CCCCAGCTCCGTCTCGGCGGCGG - Exonic
954256523 3:49411565-49411587 CACCAGGCCCGGCCGGGCGGGGG + Intronic
955818761 3:62874741-62874763 CTCCAGCCCCAGCCCGTCGGTGG - Exonic
961081818 3:124033930-124033952 CTCCAGCCCCGACGCCGAGGGGG - Intergenic
961814567 3:129542895-129542917 CTCCAGCCCCTGGTGGGCAGAGG + Intergenic
962738886 3:138348739-138348761 CTCCAGCCCCGGCTCGGCTACGG - Intronic
966866366 3:184260975-184260997 CTCCAGCCCGGGCTGGAGGGGGG - Intronic
966878951 3:184338923-184338945 CTCCAGCCAGGCCTAGGCGGGGG - Intronic
967847046 3:194052359-194052381 ATCCAGCCCTGGCTTGGCTGAGG - Intergenic
968372829 4:11298-11320 CTCCCGCCCCGGCGCCGCGCCGG - Intergenic
968433905 4:575501-575523 CTCGGCCCCCGGCTCGGCGCCGG - Intergenic
968433917 4:575525-575547 CTCAACCCCCGGCTCGGCCCCGG - Intergenic
968433927 4:575549-575571 TTCGAGCCCCGGCTCGGCCCCGG - Intergenic
972511187 4:39770117-39770139 CTCCAGCACGTTCTCGGCGGTGG + Intronic
977693773 4:99946249-99946271 CCCCAGCCCCGGCTCCGGGCTGG - Intronic
980930324 4:139177608-139177630 CTCCAGCCCCGGATTGGTGCAGG + Intergenic
985068442 4:186144971-186144993 CCCCAGCCCCGGGGCCGCGGGGG + Exonic
985450645 4:190060243-190060265 TTCCAGCCCCGGCTCTGCAAAGG + Intergenic
988538281 5:32087822-32087844 CTCCAGCCCCGGCTGGTGGGTGG - Exonic
992716306 5:79514223-79514245 CCCCGGCCGCGGCTCCGCGGCGG - Intergenic
993901245 5:93585206-93585228 CGCCACCCCCGGCACGGCGGGGG + Exonic
999717207 5:154370877-154370899 CTCCAGACCAGGCTCAGCAGAGG + Intronic
1002257776 5:177971338-177971360 CTCCAGCCCGGGCGGGGCCGGGG - Intergenic
1004396337 6:15248817-15248839 CTCCAGGCGCGGCGGGGCGGCGG + Intronic
1006271724 6:32970839-32970861 CTCCTGCCCCTCCTCGGAGGCGG + Intronic
1007736369 6:43984817-43984839 GTCCAGCCCTGGCGGGGCGGGGG - Intergenic
1008673380 6:53795223-53795245 CTCGGGACCCGGCTAGGCGGCGG + Exonic
1011624456 6:89271798-89271820 CTCCAGTCCTGGCTCCCCGGGGG - Intronic
1013232132 6:108168582-108168604 CTCCAGCCCCGGCTCAGGTCGGG + Intronic
1014947580 6:127516025-127516047 CGCCAGCCCCTGGGCGGCGGCGG + Exonic
1017012025 6:150069375-150069397 CTCCACCCCAGGCTCCGCGCGGG + Intergenic
1019276943 7:180583-180605 GTCCAGCCCCGGCCAGGCGATGG - Intergenic
1019408017 7:894000-894022 CTCCAGCCCTGGGTCGGTGTGGG + Intronic
1019474059 7:1235711-1235733 CTCCTGCCCCGGCCGAGCGGAGG + Intronic
1019474252 7:1236439-1236461 GTCCAGCCCCGCGGCGGCGGCGG - Exonic
1019605986 7:1910484-1910506 CTCCAGCTTTGGCTCCGCGGCGG - Intronic
1020001661 7:4759519-4759541 CACCAGCCAGGGCGCGGCGGGGG + Exonic
1021116777 7:16753747-16753769 CTCCTGCTCCGGCTCAGCTGCGG + Exonic
1022106189 7:27199600-27199622 ATGCAGCCCCTGCTCGGCAGCGG - Exonic
1024111912 7:46155480-46155502 CTCCAGCCCCTGGTTGGGGGTGG + Intergenic
1027001671 7:74658254-74658276 CTCGAGACCCGGCGAGGCGGTGG - Intronic
1027260519 7:76461763-76461785 CTGCAGCTCCGGCTCGGCCTGGG - Exonic
1027311896 7:76959876-76959898 CTGCAGCTCCGGCTCGGCCTGGG - Intergenic
1029073333 7:97917527-97917549 CTGCAGCCCCGGCTGAGCTGGGG - Intergenic
1029302741 7:99598170-99598192 CTCCAGCTCCAGCTCTGCGGAGG - Intronic
1029540601 7:101180041-101180063 CTCCAGCTCCGGCTCCGGCGAGG - Exonic
1031531882 7:122886218-122886240 CTCCAGCCCCGACTCGGGAAGGG - Exonic
1032710064 7:134453361-134453383 GTCCAGCCCCGGTTCTGCTGGGG + Intronic
1033036748 7:137882554-137882576 ATCCAGCCCGGGCTCGGCTGGGG - Exonic
1033757036 7:144403977-144403999 CTCCAGCCCCGCCACGGGAGGGG - Intronic
1034344789 7:150379496-150379518 CCCCAGCCCGGGCCGGGCGGAGG - Intronic
1035168479 7:157005370-157005392 CTCCAGCCCCGGCCTGGGCGAGG + Exonic
1035719427 8:1780571-1780593 CTCCAGCCGGGGCTCCGGGGCGG + Exonic
1036244356 8:7103763-7103785 CTGCAGCCCCGGCTTAGCTGGGG + Intergenic
1037529402 8:19758218-19758240 TTCCAGCTCCGGTTCTGCGGTGG - Intergenic
1039468019 8:37797441-37797463 TCCCTGGCCCGGCTCGGCGGAGG + Exonic
1039554727 8:38467868-38467890 CGCCGGCCCCGGCTGGGCTGCGG + Intronic
1040408622 8:47133477-47133499 CTCCAGGCCCTGCTGAGCGGGGG + Intergenic
1042517283 8:69672902-69672924 TTCCAGCCCCGGGTCCGCAGAGG + Exonic
1043388155 8:79768016-79768038 CGCCCGCCCCTGCCCGGCGGCGG + Intergenic
1049288111 8:141787468-141787490 CGCCAGCCCCAGCTCTGAGGAGG - Intergenic
1049393291 8:142382960-142382982 CCCCAGACCCTGCTCGGCTGGGG - Intronic
1051170449 9:14314998-14315020 CCCCAGCCCCGGCCTGGGGGCGG - Intronic
1051835676 9:21335199-21335221 CTCCACGGCCCGCTCGGCGGCGG + Exonic
1051896380 9:21994037-21994059 CTCTAGCCCAGGCTAGGAGGAGG - Intronic
1059384266 9:113951889-113951911 CTCCACCCCAGGCTTTGCGGTGG - Intronic
1060592766 9:124829388-124829410 CTCCAGCCTCGGGTGGGTGGGGG - Intergenic
1061422439 9:130479666-130479688 CTCTGGGCCCGGCTCAGCGGAGG - Intronic
1061626909 9:131845961-131845983 CCCCAGCCCCGGCTGGGCCTTGG + Intergenic
1061832144 9:133303090-133303112 CTTCAGCCCCGGCTTTGCAGTGG + Intergenic
1062111335 9:134783640-134783662 CTGCAGCACCGGCTCGCAGGTGG + Intronic
1062275404 9:135728125-135728147 CTCCAGGCACCCCTCGGCGGTGG - Intronic
1062472433 9:136712412-136712434 TTCGACCCCCGGCTCGGCTGAGG - Intergenic
1203770743 EBV:48833-48855 CTCCAACTGCGGCTCTGCGGCGG + Intergenic
1203469335 Un_GL000220v1:109328-109350 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1203477156 Un_GL000220v1:153300-153322 CTCCGGCCCCGGCCGGGGGGCGG + Intergenic
1189262595 X:39689068-39689090 CTCCCTCCCCGGCTCCGCGCCGG - Intergenic
1192707075 X:73537801-73537823 CTCCAGCCCCCACTCTGCTGTGG + Intergenic
1195675886 X:107506980-107507002 GCCCAGCCCCGGCCCGGAGGGGG + Intergenic
1196808012 X:119605880-119605902 CTCCAGCACTGGCTCGGGCGGGG + Exonic